SEARCH

SEARCH BY CITATION

Keywords:

  • Hordeum vulgare;
  • ABA;
  • gibberellins;
  • hydrogen peroxide;
  • ROS;
  • seed

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Seed dormancy, defined as the inability to germinate under favourable conditions, is controlled by abscisic acid (ABA) and gibberellins (GAs). Phytohormone signalling interacts with reactive oxygen species (ROS) signalling regarding diverse aspects of plant physiology and is assumed to be important in dormancy alleviation. Using dormant barley grains that do not germinate at 30 °C in darkness, we analysed ROS content and ROS-processing systems, ABA content and metabolism, GA-responsive genes and genes involved in GA metabolism in response to hydrogen peroxide (H2O2) treatment. During after-ripening, the ROS content in the embryo was not affected, while the antioxidant glutathione (GSH) was gradually converted to glutathione disulphide (GSSG). ABA treatment up-regulated catalase activity through transcriptional activation of HvCAT2. Exogenous H2O2 partially alleviated dormancy although it was associated with a small increase in embryonic ABA content related to a slight induction of HvNCED transcripts. H2O2 treatment did not affect ABA sensitivity but up-regulated the expression of HvExpA11 (GA-induced gene), inhibited the expression of HvGA2ox3 involved in GA catabolism and enhanced the expression of HvGA20ox1 implicated in GA synthesis. In barley, H2O2 could be implicated in dormancy alleviation through activation of GA signalling and synthesis rather than repression of ABA signalling.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Seed dormancy is defined as the inability to germinate under conditions that are favourable for germination (Bewley 1997). It prevents untimely germination, allowing better seedling establishment according to seasonal changes and better population development. Cereal grains can usually not germinate at harvest, particularly at temperatures above 20 °C, and this dormancy is released by dry storage, termed after-ripening. For cereal crops, dormancy is important because it prevents pre-harvest sprouting, but in barley, high dormancy levels are unwanted as they prevent the rapid and uniform germination required in the malting process. Barley seed dormancy and germination are regulated by two main hormones: abscisic acid (ABA) and gibberellins (GAs). The role of ABA in the onset and maintenance of dormancy has been well documented by genetic and physiological approaches (Koornneef, Bentsink & Hilhorst 2002; Finkelstein et al. 2008; Nambara et al. 2010). Dormancy is reduced in ABA-deficient seeds with mutations or chemical inhibition of biosynthesis, whereas overexpression of ABA biosynthetic genes leads to enhanced dormancy (Nambara & Marion-Poll 2003). During seed development, ABA is produced in maternal tissues and in the embryo, but only embryonic ABA is necessary to impose a lasting dormancy (Nambara & Marion-Poll 2003) and de novo ABA synthesis in the embryo during imbibition allows maintenance of dormancy (Kucera, Cohn & Leubner-Metzger 2005). In barley, the embryonic ABA content decreased quickly after imbibition in non-dormant grains or in grains imbibed at 20 °C (where germination occurred) but remained high in dormant grains imbibed at 30 °C (where germination was prevented) (Benech-Arnold et al. 2006). Similarly, dormant barley grains imbibed in the light contained more ABA than non-dormant ones (Millar et al. 2006). ABA content is regulated by the balance between its biosynthesis and catabolism (Nambara et al. 2010). In several species, the transcriptional regulation of nine-cis-epoxycarotenoid dioxygenase (NCED) and ABA-8′-hydroxylase (ABA8′OH) genes are considered key steps in this control (Nambara et al. 2010). In barley, HvNCED1 is particularly important in the regulation of primary dormancy in blue light (Gubler et al. 2008) or at high temperatures (Leymarie et al. 2008), whereas HvNCED2 expression could be implicated in the induction of primary dormancy (Chono et al. 2006) and the maintenance of secondary dormancy (Leymarie et al. 2008). The HvABA8′OH1 gene plays a major role in ABA catabolism required for dormancy alleviation of barley grain dormancy (Chono et al. 2006; Millar et al. 2006; Gubler et al. 2008).

The balance of ABA/GA levels and sensitivity is a major regulator of dormancy status, where GAs promote progression from release through germination (Finkelstein et al. 2008). In the aleurone layer of cereals, the role of GAs is crucial after dormancy breakage, where it is required for reserve mobilization and germination (Jones & Jacobsen 1991; Gubler et al. 2002). Studies with barley grains suggest that GAs have no major role during after-ripening (Jacobsen et al. 2002) and that GAs respond in a pathway downstream of ABA (Barrero et al. 2009). The GA biosynthetic pathway is regulated via GA3-oxidases and GA20-oxidases, whereas GA2-oxidases can deactivate GAs (Yamaguchi 2008). Some genes of the biosynthetic pathway, such as HvGA3ox2, are regulated by dormancy in barley (Gubler et al. 2008).

Hormonal signalling interacts with other signalling pathways; recent data have highlighted the importance of reactive oxygen species (ROS) signalling with respect to plant growth and development (Fujita et al. 2006). ROS are implicated in stress-induced damage and ageing, but evidence is increasing that they are also key components of signal transduction networks in plants (Møller, Jensen & Hansson 2007; El-Maarouf-Bouteau & Bailly 2008). The interaction between ROS and ABA has been mainly studied at the cellular level in guard cells, where ROS are considered second messengers in the ABA transduction pathway (Neill et al. 2008; Wang & Song 2008). Exogenous ABA leads to an increase in H2O2 in guard cells (Pei et al. 2000; Zhang et al. 2001) regulating ion channels leading to stomatal closure (Schroeder, Kwak & Allen 2001). Moreover, ABA-mediated nitric oxide (NO) generation is dependent on ABA-induced H2O2 production in guard cells (Bright et al. 2006; Neill et al. 2008) and this model could be extended to maize mesophyll cells (Zhang et al. 2007). H2O2 stimulates ABA-dependent signalling through the inactivation of ABI1 and ABI2, which are negative regulators of the ABA response (Meinhard & Grill 2001; Meinhard, Rodriguez & Grill 2002) and interact with ABA receptors (Miyazono et al. 2009; Yin et al. 2009; Cutler et al. 2010; Nishimura et al. 2010 for review). Hence, the crosstalk between ABA and ROS appears to be in the first steps of ABA signalling in the stomata.

At the whole-plant level, ABA improves drought tolerance through the activation of ROS-scavenging enzymes (Lu et al. 2009; Zhang et al. 2009). Transcriptional responses induced by exogenous ABA or H2O2 in Arabidopsis seedlings overlapped substantially, although this overlap did not represent the major fraction of genes regulated by these signals (Wang et al. 2006). Furthermore, while, in guard cells, H2O2 and ABA both induce stomatal closure, in seeds, these molecules have antagonistic effects on germination. ABA inhibits germination, whereas H2O2 breaks seed dormancy in several species including barley (Fontaine et al. 1994; Wang et al. 1998), rice (Naredo et al. 1998), wild oat (Hsiao & Quick 1984), Cinnamomum camphora (Chien & Lin 1994), Zinnia elegans (Ogawa & Iwabuchi 2001), sunflower (Oracz et al. 2009), several warm-season grasses (Sarath et al. 2007) and Arabidopsis (Liu et al. 2010). H2O2 also accelerates the germination of non-dormant seeds of barley (Ishibashi et al. 2010) and pea, and stimulates the early growth of pea seedlings (Barba-Espin et al. 2010). Therefore, ROS appear to be involved in dormancy alleviation. Moreover, H2O2 and superoxide anion accumulation during after-ripening are associated with changes in protein carbonylation, which has been proposed as a mechanism of dormancy alleviation in sunflower (Oracz et al. 2007) and Arabidopsis (Müller et al. 2009). Cellular redox state can also affect signal transduction pathways (Schafer & Buettner 2001; Foyer & Noctor 2005). Glutathione, a key redox buffer in plant cells, has been suggested to be implicated in dormancy alleviation (Fontaine, Billard & Huault 1995). It is well established that the redox state of low-molecular-weight thiols and protein thiols changes during seed development and germination (Buchanan & Balmer 2005; Colville & Kranner 2010). During seed maturation drying, thiol groups are gradually oxidized to disulphides (S-S), and upon germination, disulphides are reduced back to thiols. As a consequence, dry seeds contain considerably more disulphides than hydrated tissues (Colville & Kranner 2010). In barley, thioredoxin h facilitates protein redox changes during germination (Lozano et al. 1996) and is considered a major regulator in the network linking the endosperm, the embryo and the aleurone layer (Wong et al. 2002). In barley aleurone cells, changes in the redox state of membrane proteins are controlled by GA (Maya-Ampudia & Bernal-Lugo 2006).

ROS signalling pathways interact with GAs, as ROS play a key role in the hormone-regulated programmed cell death in barley aleurone cells, which is stimulated by GAs, which induce ROS accumulation, whereas ABA maintains low ROS concentrations through the activation of the alternative oxidase pathway and ROS-scavenging systems (Fath et al. 2002). An interaction between GA and ROS related to growth regulation has also been demonstrated by Achard et al. (2008), who showed that DELLA proteins, which are major negative regulators of GA signalling, activate ROS-scavenging enzymes.

The aim of this study was to examine the role of ROS signalling in barley seed dormancy and, in particular, the crosstalk between ROS, ABA and GA metabolism and signalling. For this purpose, we used dormant barley grains that were unable to germinate at 30 °C but were able to germinate at 20 °C. Treatments were applied that induce an increase in H2O2 content at 30 °C and grains were also treated with ABA at 20 °C. We analysed germination, ROS content and ROS-scavenging systems, ABA content and genes involved in ABA and GA signalling and metabolism in the embryo.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Plant material

Barley (Hordeum vulgare L., cv. Pewter) grains harvested in July 2005 and kindly provided by the ‘Coopérative agricole de la Beauce et du Perche’ (28310 Toury, France) were used. Experiments were carried out with dormant grains that had been stored at −20 °C from harvest until the experiments began in order to maintain their initial dormancy (Lenoir, Corbineau & Côme 1983). Non-dormant grains were used as controls, i.e. grains from the same harvest but stored for 3 months at 20 °C for after-ripening before storage at −20 °C.

Germination assays

Germination tests were conducted in the dark by placing whole grains (50 per dish) in Petri dishes on a layer of cotton wool imbibed with either deionized water or with the treatment solutions described below. A grain was considered as germinated when the coleorhiza protruded through the seed-covering structures (seed coat plus pericarp and glumellae). Germination was scored daily up to 7 d. Solutions were prepared in deionized water using chemicals from Sigma-Aldrich (St Louis, MO, USA) [cis-trans ABA, gibberellic acid (GA3), 30% H2O2, methyl viologen dichloride hydrate, menadione, aminotriazole and diphenyleneiodonium (DPI) chloride]. Germination percentages obtained from three independent replicates are shown as mean ± standard deviation (SD).

Hydrogen peroxide content measurements

H2O2 content was determined in embryos isolated from grains according to O'Kane et al. (1996). For each replicate, 20 embryos were ground in a mortar on ice and homogenized in 1 mL perchloric acid (0.2 M). After 15 min of centrifugation at 13 000 g and 4 °C, the resulting supernatant was neutralized to pH 7.5 with 4 M KOH and then centrifuged at 13 000 g and 4 °C. The supernatant was immediately used for spectrophotometric determination of H2O2 at 590 nm using a peroxidase-based assay. The assay was performed in a volume of 1.5 mL with 400 µL of 3-dimethylaminobenzoic acid (12.5 mM in 1 M phosphate buffer, pH 6.5), 80 µL of 3-methyl-2-benzothiazolidone hydrazone (1.3 mM), 20 µL (0.25 U) horseradish peroxidase (Sigma), 850 µL of deionized water and 150 µL of extract. The increase in absorbance at 590 nm was monitored for 10 min after the addition of peroxidase at 25 °C and analysed using a calibration curve obtained with known amounts of H2O2. Data were expressed in nmol H2O2 per embryo, the average dry weight of an excised embryo being 1.27 ± 0.024 mg.

Glutathione content measurements

Extraction and determination of antioxidant glutathione (GSH) and glutathione disulphide (GSSG) in isolated embryos were carried out according to Kranner & Grill (1996). For each replicate, 15 embryos were ground using liquid nitrogen and extracted with 1 mL of 0.1 M HCl with polyvinylpolypyrrolidone (PVPP) (equal weight as the embryos) on ice. Extracts were centrifuged for 20 min at 20 000 g and 4 °C. One part of the supernatant was used to determine total glutathione content (i.e. GSH + GSSG) and the other for the determination of GSSG after blockage of GSH with N-ethylmaleimide (NEM). For determination of total glutathione, 120 µL of the supernatant was mixed with 180 µL of 200 mM 2-5N-cyclohexyl(amino)ethane-sulphonic acid (CHES) buffer (pH 9.3) and 30 µL of 3 mM dithiothreitol (DTT) and incubated for 60 min at room temperature to allow reduction of GSSG. Thiol groups were labelled with 20 µL of 15 mM monobromobimane (mBBr) for 15 min at room temperature in the dark. The extract was then acidified with 250 µL of 0.25% methanesulfonic acid (MSA) and centrifuged for 45 min at 20 000 g at 4 °C. The supernatant was used for reversed-phase high-performance liquid chromatography (HPLC) (Jasco, Great Dunmow, Essex, UK) analysis. GSH was separated from other low-molecular-weight thiols on a 4.6 × 250 mm HiQsil C18V column (KYA-Technologies, Tokyo, Japan) and detected with a fluorescence detector (excitation: 380 nm, emission: 480 nm). The amounts of GSH in extracts were calculated using a calibration curve. For determination of GSSG, 400 µL of the supernatant was mixed with 30 µL of 50 mM NEM to block free thiols and 600 µL of 200 mM CHES (pH 9.3) buffer immediately after extraction. After 15 min incubation at room temperature, excess NEM was removed by extracting five times with equal volumes of toluene. Thereafter, 30 µL of 3 mM DTT were added to a 300 µL aliquot of the NEM-treated extract and left for 60 min at room temperature to reduce GSSG. These aliquots were labelled with mBBr, acidified with MSA, centrifuged and analysed as described above. The GSH half-cell reduction potential (EGSSG/2GSH) was calculated as suggested by Schafer & Buettner (2001) and Kranner et al. (2006) based on the Nernst equation:

  • image

where R is the gas constant, T is temperature in K, F is the Farraday constant, n is the number of transferred electrons (here, n = 2) and E°′ is the standard half-cell reduction potential of glutathione (−0.240 V) at pH 7.

Measurement of antioxidant enzyme activities

Enzyme activities were determined using protein extracts as described by Bailly et al. (1996). Twenty isolated embryos were ground using liquid nitrogen and extracted with polyvinylpyrrolidone (PVP) in potassium phosphate buffer (0.1 M, pH 7.8) containing 2 mM DTT, 0.1 mM (ethylenediaminetetraacetic acid) EDTA and 1.25 mM PEG4000. After centrifugation (15 min, 13 000 g), the extracts were eluted on Sephadex PD10 columns (GE Healthcare, Orsay, France) in 1.5 mL of potassium phosphate buffer (0.1 M, pH 7.8). Protein contents in the extracts were determined using Bio-Rad (Marnes-la-Coquette, France) concentrate dye reagent with bovine serum albumin as a calibration standard. Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined by measuring the inhibition of nitroblue tetrazolium chloride (NBT) photoreduction (Giannopolitis & Ries 1977). The assays contained 1.3 µM riboflavin, 13 mM methionine and 63 µM NBT in 0.1 M potassium phosphate buffer (pH 7.8) in a reaction volume of 1.5 mL. Per test tube, 50 µL of protein extract was added. Transparent tubes were immersed in a thermostated bath at 25 °C and illuminated with a fluorescent lamp. Identical tubes were placed in the dark as blanks. After illumination for 15 min, absorbance was measured at 560 nm. One unit of SOD is defined as the enzyme activity that inhibited the photoreduction of NBT to blue formazan by 50%.

Glutathione reductase (GR, EC 1.8.1.7) activity was determined at 25 °C following the decrease in absorbance of NADPH at 340 nm (Bailly et al. 1996). Assays were performed in phosphate buffer (pH 7.8, 67 mM) containing 0.3 mM NADPH, 6.7 mM GSSG, 3 mM MgCl2 with 150 µL of protein extract in a total volume of 0.9 mL. GR activity was expressed as the amount of enzyme required to oxidize 1 nmol NADPH mg–1 protein min–1.

Catalase (CAT, EC 1.11.1.6) activity was determined according to Bailly et al. (1996). Assays were performed in potassium phosphate buffer (50 mM, pH 7) containing 3.125 mM H2O2 and 100 µL of protein extract in a total volume of 1.5 mL. CAT activity was expressed as the amount of enzyme required to decompose 1 nmol H2O2 mg–1 protein min–1.

For all enzyme activities, data are shown as means of three biological replicates ± SD.

ABA content measurements

ABA was measured by a HPLC-enzyme-linked immunoSorbent assay (ELISA) technique. Twenty-five embryos were isolated from the grains and immediately frozen in liquid nitrogen and stored at −80 °C. They were ground in microcentrifuge tubes using metal balls with a Retsch laboratory mixer mill (VERDER S.A.R.L., Eragny sur Oise, France). ABA was extracted in 10 mL of 80% aqueous methanol, supplemented with 40 mg L–1 butylhydroxytoluene as an antioxidant, for 24 h, in the dark, at 4 °C. At the beginning of the extraction, 3H-ABA (GE Healthcare) was added to the extracts to measure the yield of the ABA purification. Extracts were filtered (0.2 µm, Millipore, Billerica, MA, USA) and eluted through a Sep-Pak cartridge with 80% aqueous methanol. The eluate volume was reduced by rotary evaporation and then adjusted to 500 µL with 0.1% trifluoroacetic acid (TFA) in 10% acetonitrile prior to HPLC purification. HPLC (System Gold, Beckman Coulter, Villepinte, France) was performed through a 4.6 × 250 mm C18 column (Phenomenex, Le Pecq, France), at a flow rate of 1 mL min−1, with a gradient of 90% acetonitrile, 0.1% TFA (solvent B) in 10% acetonitrile, 0.1% TFA (solvent A) for 25 min. ABA was eluted at 50% B in A. The fraction containing ABA was determined by separate injection of ABA standard (Sigma) and determination of radioactivity (scintillation counting) in 10 µL aliquots. The ABA-containing fractions were evaporated with a vacuum centrifuge, methylated with 250 mL of diazomethane in ether, evaporated to dryness and dissolved in 1.5 mL distilled water with 0.2 g L−1 NaN3 as a preservative. The radioactive counts of 50 µL aliquots were used to quantify the ABA recovery. The immunoquantitation was performed in microtitration plates as described in Julliard et al. (1994) based on the competition of a limited amount of anti-ABA monoclonal antibodies (LPDP229), between a known amount of adsorbed ABA conjugated with ovalbumin and free methylated ABA in solution. The anti-hormone antibodies bound to the plate were quantified with peroxidase-labelled goat anti-mouse IgG (Sigma). The enzyme activity was measured spectrophotometrically at 405 nm after addition of 2,2′-azino-bis (3-ethylbenzthiazoline)-6-sulfonic acid (ABTS) in perborate buffer (pH 4.6) as peroxidase substrate. Up to 10 technical replicates were performed for each sample and the results presented correspond to the means of four biological replicates ± SD.

RNA extraction

Embryos were isolated from the rest of the caryopses and immediately frozen in liquid nitrogen and stored at −80 °C. Twenty-five embryos were ground in liquid nitrogen in a mortar, and total RNA was isolated by TRIzol (Invitrogen, Cergy Pontoise, France) according to the supplier's instructions using 1 mL of TRIzol reagent and precipitation with high salt solution (0.8 M sodium citrate, 1.2 M sodium chloride) as recommended for samples containing polysaccharides. RNA was further purified on columns with Nucleospin RNA clean-up kit (Macherey-Nagel, Düren, Germany). RNA concentration was measured with Nanovue (GE Healthcare).

Northern blots

Total RNA was separated (10 µg per lane) in 1% agarose–formaldehyde gel and transferred to a nylon membrane (Hybond N, GE Healthcare) by capillarity action with 10× saline sodium citrate buffer (SSC) (Sambrook & Russel 2001) and fixed by ultraviolet cross linking (Stratalinker, Stratagene, La Jolla, CA, USA). The probe sequences corresponded to fragments 1454–1874 of HvCAT1 (gi: 684945, Skadsen, Schulze-Lefert & Herbst 1995), 1323–1747 bp of HvCAT2 (gi: 684947, Skadsen et al. 1995), 325–1828 bp of HvGR2 (gi: 157362218, Bashir et al. 2007) and 152–565 bp of HvSOD (gi: 151420943, Sakamoto, Ohsuga & Tanaka 1992; Sakamoto et al. 1995). The HvSOD probe can hybridize both mRNA of copper/zinc cytosolic SOD: SODCC1 (gi: 685241) and SODCC2 (gi: 310320) (Sakamoto et al. 1992, 1995). DNA probes were labelled with α32P-dCTP (Perkin Elmer, Courtaboeuf, France) using Rediprime II (GE Healthcare) as described by the manufacturer. Membranes were hybridized at 65 °C in 0.5 M sodium phosphate buffer (pH 7.2), 5% sodium dodecyl sulphate (SDS), 10 mM EDTA overnight, then washed at 65 °C in 1× SSC, 0.1% SDS and, if required, in 0.1× SSC, 0.1% SDS. The membranes were analysed with a Phosphorimager (Storm 840, GE Healthcare) and ImageQuant software (GE Healthcare). Each membrane was used twice (with different probes), after stripping in 0.05× SSC, 0.1% SDS and checking the signal removal with Phosphorimager.

Real-time quantitative RT-PCR

Total RNA (5 µg) was treated with DNase I (Sigma), reverse transcribed with Revertaid H minus M-MuLV RT (Fermentas, Saint-Rémy-lès-Chevreuse, France) in a 25 µL reaction volume and amplified with Mastercycler ep Realplex (Eppendorf, Le Pecq, France) using 5 µL of 50× diluted cDNA solution. Primers were obtained from Eurogentec (Angers, France) and the primer sequences are reported in Table 1. Real-time PCR reactions were performed with the Maxima SYBR Green qPCR Master Mix (Fermentas) and 0.23 µM of each primer (Fermentas) in a 15 µL reaction volume. Reactions were initiated at 94 °C for 15 min followed by 40 cycles at 94 °C for 30 s, 56 °C for 30 s, 72 °C for 30 s. Critical thresholds (Ct) were calculated using the Realplex 2.0 software (Eppendorf). For each plate and each gene, a standard curve made with dilutions of cDNA pools was used to calculate the reaction efficiencies, and the relative expressions were calculated according to Hellemans et al. (2007) with at least two reference genes among HvActin, HvEF1α and HvMub1. An arbitrary value of 100 was assigned to the dry dormant grain samples, which were used as control samples for normalization (Pfaffl 2001).

Table 1.  Sequences of primers used in real time RT-PCR experiments
GeneAccession n°Forward primerReverse primerReference
HvActinAY145451CCAAAAGCCAACAGAGAGAAGCTGACACCATCACCAGAGLeymarie et al. 2007
HvMub1 (Ubiquitin)M60175GTAACCAGGCTCAGGAAGTCTGGTTGTAGACATAGGTGAWhite et al. 2008
HvEF1αL11740AATGGTGATGCTGGGTTCGGTCGGCTCCTTCTTCTCSutton & Kenefick 1994
HvABA8′OH1DQ145932AGCACGGACCGTCAAAGTCTGAGAATGCCTACGTAGTGMillar et al. 2006
HvNCED1DQ145930CCAGCACTAATCGATTCCGAGAGTGGTGATGAGTAAMillar et al. 2006
HvNCED2DQ145931CATGGAAAGAGGAAGTTGCGAAGCAAGTGTGAGCTAACMillar et al. 2006
HvNADPHoxAJ251717CCGATCAGATGTATGCTCCACAGAAGGCATTGAAGCCAGTTrujillo et al. 2006
HvExpA11EU557046TGACCGCCACCAACTTCTGGATGCCCCCTTTCTTCA
HvGA20ox1AY551428CTGGAGATCATGGAGGTGCTCACGGCGGGTAGTAGTTGASpielmeyer et al. 2004
HvGA3ox2AY551431TGGTAGCTTAGCTGAGGTAGCTAGGATTGGCTAGCTGCAGATGTAGAACGubler et al. 2008
HvGA2ox1300785535CTGCTTGAGTTGCAGGCAATCTGCAAGCATCACTTCTGTACAAAGCTAGGubler et al. 2008
HvGA2ox324223269GAGAGCAGAGCCTGTACAAGTGGCTACCTGTGGAAGTGAGGubler et al. 2008

Statistical analyses

To compare the treatment effects and discriminate homogenous groups, statistical tests were performed with the StatBox 6.40 software (Grimmer logiciels, Paris, France). When populations were normal and with equal variance, Newman–Keuls tests (threshold: 5%) were performed after analysis of variance (anova). When the anova assumptions were not accepted (for data of GSSG, EGSSG/2GSH, transcript expressions of HvCAT1 and HvNADPHox) the Kruskal–Wallis test was used.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Barley grain germination

Figure 1 shows the germination kinetics of dormant barley grains in response to different treatments at 30 and 20 °C. At 30 °C, water-imbibed dormant grains did not germinate, but fully germinated at 20 °C. Treatment with H2O2 (1 M, 24 h) or the superoxide inducer menadione (1 mM, 24 h treatment) partially alleviated seed dormancy as 50 to 60% of grains had germinated at 30 °C after 7 d. The optimum H2O2 concentration (24 h treatment) for dormancy alleviation was surprisingly high (1–2 M, Table 2). A subsequent germination test at 10 °C showed that, up to 2 M, these high concentrations were not toxic because all grains germinated (data not shown). Therefore, a concentration of 1 M H2O2 was chosen for subsequent experiments. Several ROS inducers were also tested, but dormancy was not broken by methyl viologen (paraquat, which stimulates superoxide production) and aminotriazole (a CAT inhibitor), although several concentrations and durations were tested (data not shown). GAs broke dormancy completely. The same percentage of dormant grains treated with GA3 (1 mM) at 30 °C germinated compared to grains imbibed at 20 °C (Fig. 1). ABA (1 mM) delayed and inhibited germination at 20 °C where only 31% of dormant grains germinated (Fig. 1).

image

Figure 1. Germination percentages of dormant barley grains in the dark imbibed at 30 °C with water (black circles), 1 M H2O2 (black triangles), 1 mM menadione (MN) (black squares), 1 mM GA3 (black diamonds), and at 20 °C with water (open circles) or 1 mM abscisic acid (ABA) (open diamonds). Hydrogen peroxide was applied for 24 h, menadione for 15 h, GA3 and ABA continuously. Data are means of 3 independent experiments ± SD.

Download figure to PowerPoint

Table 2.  Effect of 24 h treatment of barley grains with different concentrations of H2O2 on germination percentages after 7 d at 30 °C in the dark
H2O2 concentrationGermination (% ± SD)
  1. Data are means of three independent experiments ± SD.

014.0 ± 2.3
50 mM13.0 ± 8.2
200 mM37.0 ± 12.4
1 M62.7 ± 6.4
2 M71.3 ± 7.6
5 M11.3 ± 3.1

To study the effect of DPI, which blocks NADPH oxidase activity, germination tests were conducted with isolated embryos that are able to germinate at both 30 and 20 °C. DPI drastically reduced the germination of isolated embryos at 30 °C, since only 4% of the control germinated, and had a smaller effect at 20 °C (Table 3).

Table 3.  Effects of diphenyleneiodonium (DPI, 1 mM) on the germination percentages obtained after 3 d with embryos imbibed in DPI as compared to water-imbibed controls
Incubation temperatureGermination (% of control)
  1. Data are means of three independent experiments ± SD.

30 °C3.98 ± 3.55
20 °C62.50 ± 7.5

Hydrogen peroxide and glutathione content

Hydrogen peroxide was determined in embryos excised from grains imbibed in the presence of H2O2 (1 M) at 30 °C or ABA (1 mM) at 20 °C for 8 or 24 h (Fig. 2). The embryo H2O2 content of dry dormant and dry non-dormant grains did not differ significantly (Fig. 2). Seed imbibition with water caused a decrease in embryo H2O2 content at 30 °C but not at 20 °C. Exogenous H2O2 induced an increase in H2O2 embryo content. It is important to note that the embryo H2O2 content remained in a physiological range and was only 50% greater than in dry grains. In the presence of ABA at 20 °C, the embryo H2O2 content was reduced to levels comparable with those of grains imbibed at 30 °C.

image

Figure 2. Hydrogen peroxide content of barley embryos (nmol per embryo) from dry dormant (D) and non-dormant (ND) grains (white bars) and from dormant grains imbibed with water (dark grey bars) or 1 M H2O2 (hatched bars) at 30 °C for 8 h or 24 h, and with water (light grey bars) or 1 mM abscisic acid (ABA) (dotted bars) for 8 h at 20 °C. Data are means of three independent experiments ± SD. The same letters above bars indicate that the data did not differ significantly (P < 0.05).

Download figure to PowerPoint

During after-ripening, the embryo total glutathione content did not change, but GSSG content increased, associated with a decrease in GSH, resulting in EGSSG/2GSH slightly shifting from −235 to −222 mV (Fig. 3). Imbibition at 20 and 30 °C induced an increase in total glutathione content and in EGSSG/2GSH towards more positive values, but incubation in the presence of H2O2 or ABA had no additional significant effect (Fig. 3).

image

Figure 3. Glutathione content (grey, GSSG; white, GSH) of barley embryos (nmol g−1 DW) in dry dormant (D) and non-dormant (ND) grains, and in dormant grains imbibed with water, 1 M H2O2 or 1 mM abscisic acid (ABA) at 30 °C or 20 °C for 8 h. Triangles represents the glutathione half-cell reduction potential (EGSSG/2GSH). Data are means of five independent experiments ± SD. Statistical tests (P < 0.05) were performed for these variables. For total glutathione, they revealed two distinct homogenous groups: D dry, ND dry, D 20 °C ABA on the one hand and D 30 °C water, D 20 °C water, D 30 °C H2O2 on the other hand. For GSH, only ND dry was significantly different from other treatments. For GSSG, only D dry was significantly different from others. For EGSSG/2GSH, there was no significant effect of ABA and H2O2.

Download figure to PowerPoint

ROS metabolism

The activities of ROS-processing enzymes were measured in embryos isolated from non-dormant dry grains and from dormant dry grains or grains imbibed for 8 h with water at 30 and 20 °C, H2O2 (30 °C) or ABA (20 °C). After-ripening had no effect on the activity of any enzyme tested (Fig. 4). Compared to control grains imbibed with water, CAT activity was significantly induced by the H2O2 and ABA treatments (Fig. 4a). SOD and GR activities were similar in all conditions tested (Fig. 4b,c). Nevertheless, after 24 h of H2O2 treatment, GR activity was significantly higher than in grains imbibed with water (139.7 ± 16.1 versus 105.5 ± 10.7 nmol NADPH mg−1 prot min, data not shown).

image

Figure 4. In vitro activities of enzymes involved in reactive oxygen species scavenging in embryos isolated from dormant and non-dormant dry grains (white bars) or from dormant grains imbibed for 8 h with water at 30 °C or 20 °C (grey bars), 1 M H2O2 at 30 °C (hatched bars), 1 mM abscisic acid (ABA) at 20 °C (dotted bar). (a) Catalase activity (nmol H2O2 mg−1protein min−1); (b) Glutathione reductase (GR) activity (nmol NADPH mg−1 protein min); (c) Superoxide dismutase (SOD) activity. Data are means of three (CAT) or four (GR and SOD) independent experiments ± SD. Asterisks above bars indicate that treatments differed significantly from their corresponding control (P < 0.05).

Download figure to PowerPoint

The accumulation of gene transcripts coding for these enzymes was studied by northern blotting (Fig. 5a–c & Supporting Information Fig. S1). After-ripening did not induce any significant changes in transcript abundance (Fig. 5a–c). The HvCAT1 and HvCAT2 transcripts, coding for barley CAT (Skadsen et al. 1995), showed different responses to the treatments: HvCAT1 appeared to be constitutively expressed in all treatments tested, and the HvCAT2 transcripts increased fourfold in the presence of H2O2 (Fig. 5a). The HvGR2 transcript, coding for the cytosolic GR gene (Bashir et al. 2007), was significantly more abundant after a H2O2 treatment for 8 h (Fig. 5b) and this difference was amplified after 24 h (325 units as compared to 102 with water after 24 h, data not shown). The HvSOD (Sakamoto et al. 1992, 1995) transcript abundance was not significantly affected by H2O2 and ABA (Fig. 5c). The expression of the HvNADPHox gene, analysed by quantitative RT-PCR, did not reveal any significant effect of after-ripening, H2O2 or ABA treatment (Fig. 5d).

image

Figure 5. Transcript abundance of genes involved in reactive oxygen species (ROS) scavenging (a–c) analysed by northern blots and in ROS production (d) analysed by real time RT-PCR (relative expression to HvActin, HvEF1α and HvMub1 as reference genes) from dormant and non-dormant dry grains, and from dormant grains imbibed for 8 h with water at 30 °C and 20 °C, 1 M H2O2 at 30 °C (hatched bars) or 1 mM abscisic acid (ABA) at 20 °C (dotted bars). The data are expressed in arbitrary units with a value of 100 assigned to the D dry sample. (a) HvCAT1 (black bars) and HvCAT2 (grey bars); (b) HvGR2; (c) HvSOD; (d) HvNADPHox. Data are means of three independent experiments ± SD. Asterisks above bars indicate that treatments differed significantly from their controls (P < 0.05).

Download figure to PowerPoint

ABA metabolism and signalling

The ABA content in the embryos of dry dormant grains was 850 pg mg dry weight (DW)−1 and did not change significantly during grain imbibition at 30 °C (Fig. 6). Surprisingly, incubation of dormant grains in H2O2 at 30 °C resulted in a significant increase by 50% in the embryo ABA content (Fig. 6). According to the data in Bradford et al. (2008), a 50% increase in ABA content corresponds to 0.12 log units that only change germination to less than 10% germination. Quantitative RT-PCR analysis of gene transcripts implicated in ABA catabolism (HvABA8′OH1) and synthesis (HvNCED1 and HVNCED2) showed that imbibition with water resulted in reduced amounts of HvABA8′OH1 transcripts, and this was not altered by H2O2 treatment (Fig. 7a). Imbibition with water also reduced the HvNCED1 and HvNCED2 transcript levels, but these transcripts were more abundant in the presence of H2O2. HvNCED1 and HvNCED2 transcript abundance increased by 60 and 100%, respectively, compared to water-imbibed grains (Fig. 7b).

image

Figure 6. Abscisic acid (ABA) content (pg/mg dry weight) of embryos from dormant grains, dry (white bar) or imbibed with water (grey bars) or 1 M H2O2 (hatched bars) for 8 h and 24 h. Data are means of four independent experiments ± SD. Asterisks above bars indicate significant effect of the H2O2 treatment versus the water control (P < 0.05).

Download figure to PowerPoint

image

Figure 7. Expression of (a) HvABA8′OH-1, and (b) HvNCED1 and HvNCED2 transcripts analysed by real time RT-PCR (arbitrary units with the value 100 assigned to the D dry sample, and relative expression to HvActin and HvEF1α as reference genes) in embryos from dormant and non-dormant dry grains, and from dormant grains imbibed at 30 °C for 8 h with water or 1 M H2O2. Data are means of four independent experiments ± SD. Asterisks above bars indicate that the H2O2 treatment differed significantly from the water-imbibed control (P < 0.05).

Download figure to PowerPoint

To determine whether H2O2 can modify the sensitivity to ABA in dormant barley grains, germination at 20 °C was observed in the presence of different ABA concentrations after a pretreatment at 30 °C for 8 h with H2O2 or water as the control. Pretreatment with water induced secondary dormancy at 30 °C as previously shown (Leymarie et al. 2008), and this was inhibited by H2O2 (Fig. 8). Grains treated with H2O2 were less sensitive (by 28%) to 0.1 mM ABA, but this was not statistically significant (Fig. 8).

image

Figure 8. Effects of H2O2 treatment on grain sensitivity to abscisic acid (ABA): germination percentage after 4 d at 20 °C of barley grains imbibed with different ABA concentrations after pretreatment at 30 °C with 1 M H2O2 or water for 8 h. Data are means of three independent experiments ± SD.

Download figure to PowerPoint

GA signalling and metabolism

The transcript abundance of the expansin gene HvExpA11 was analysed because expansins, associated with cell elongation, are induced by GA (Chen & Bradford 2000; Yamauchi et al. 2004; Thiel et al. 2008). Here, GA3 induced a 50% increase in HvExpA11 transcript abundance when dormant grains were imbibed for 8 h (Fig. 9). Treatment with H2O2 induced HvExpA11 expression even more than GA3 treatment (Fig. 9). It is noteworthy that gene expression was analysed after 8 h, before radicle elongation commenced (as shown by Barrero et al. 2009).

image

Figure 9. Expression of HvExpA11 transcripts analysed by real-time RT-PCR (arbitrary units with the 100 value for the D dry sample, and relative expression to HvActin and HvMub1 reference genes) in embryos from dormant grains imbibed for 8 h with water, 1 M H2O2 or 1 mM GA3. Data are means of three independent experiments ± SD. The same letters above bars indicate that the data did not differ significantly (P < 0.05).

Download figure to PowerPoint

Analysis of the relative expression of two genes involved in GA catabolism, HvGA2ox1 and HvGA2ox3, revealed that only HvGA2ox3 transcript abundance was reduced by H2O2 treatment (by about 30%). Of the genes involved in GA synthesis, HvGA3ox2 abundance was unaltered by the H2O2 treatment, while HvGA20ox1 transcript abundance increased threefold (Fig. 10).

image

Figure 10. Expression of HvGA2ox1, HvGA2ox3, HvGA3ox2 and HvGA20ox1 transcripts analysed by real time RT-PCR (arbitrary units with the 100 value for the D dry sample, and relative expression to HvActin and HvMub1 reference genes) in embryos from dormant grains imbibed in water or 1 M H2O2 for 8 h. Data are means of three independent experiments ± SD. Asterisks above bars indicate that imbibition in water and H2O2 differed significantly (P < 0.05).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

During after-ripening of barley embryos, no increase in ROS content was observed (Fig. 2), unlike in sunflower embryonic axes (Oracz et al. 2007). The seeds of these two species differ greatly regarding anatomy, seed storage compounds composition and dormancy. In the dicotyledonous sunflower seeds, which are characterized by embryo dormancy, dormancy status could be related to fluctuations in ROS contents, while in the monocotyledonous cereal grains, dormancy is dependent on the surrounding structures and could be mediated by another mechanism. The total glutathione content was not altered during after-ripening, but we observed a clear increase (×2.15) in GSSG (Fig. 3). This may indicate that ROS were produced during after-ripening but were scavenged by GSH, while the re-reduction from the resulting GSSG to GSH failed due to the lack of water in the dry seeds (Colville & Kranner 2010). Fontaine et al. (1995) observed an increase in glutathione content during seed after-ripening and suggested that glutathione may play a role in dormancy alleviation, but they did not discriminate between GSH and GSSG. Our data show that GSSG accumulates during dry storage of grains, in agreement with many other studies on desiccation-tolerant life-forms, but do not confirm a role of GSH or GSSG in dormancy alleviation. The data for mRNA abundance did not reveal any effect of after-ripening on transcript amounts for genes involved in ABA metabolism or enzymatic ROS scavenging (Figs 5 & 7) in agreement with the unchanged ROS (Fig. 2) and ABA (Benech-Arnold et al. 2006) contents during after-ripening.

The primary dormancy level of the grain batch used was similar to that previously observed for the same cultivar (Leymarie et al. 2008) and is a typical feature of cereal grains where it is expressed only at relatively high temperatures (Côme, Corbineau & Lecat 1988). To study the effects of compounds that alleviate dormancy, experiments were conducted at 30 °C, a temperature at which dormancy is expressed. The effects of compounds that inhibit germination, such as ABA, were studied at 20 °C, a temperature at which freshly harvested barley grains are able to germinate. H2O2 or menadione treatments alleviated dormancy partially (Fig. 1, Table 2). The germination percentage of dormant grains after 7 d in the presence of H2O2 was similar to that observed by Oracz et al. (2009) in sunflower with 0.5 mM H2O2 and by Fontaine et al. (1994) in barley with 20 mM H2O2, but Fontaine et al. (1994) pretreated the grains for 24 h by stirring in H2O2 solution. The 1 M H2O2 concentration appears to be very high and perhaps not physiological, but this concentration was also used to break dormancy in rice species (Naredo et al. 1998). Furthermore, 1 M H2O2 did not negatively affect seed viability in recalcitrant (i.e. desiccation sensitive) sweet chestnut seeds, and even enhanced seed viability in desiccation-stressed seeds (Roach et al. 2010). In cereal grains, the glumellae represent a barrier for chemicals, which could partly explain why some compounds, such as methyl viologen or aminotriazole, did not have any effect, as they may not have reached the embryo. In addition, breakdown by CATs and peroxidases may occur as the H2O2 diffused to the embryo. In agreement with this assumption, exogenous treatment with 1 M H2O2 increased the H2O2 content of the embryo only by about 50%, which is in the physiological range and had no effect on glutathione content and oxidation state.

The H2O2 treatment induced an increase in CAT activity after 8 h (Fig. 4) and in GR activity after 24 h (data not shown). These inductions at the protein level were associated with accumulation of the HvCAT2 and the HvGR2 transcripts in the embryos (Fig. 5). The regulation of CAT activity by ABA (Fig. 4) through HvCAT2 mRNA (Fig. 5) was similar in embryos and in barley aleurone layer cells (Fath et al. 2002). The up-regulation of expression and activity of antioxidant enzymes by ABA, through H2O2 and NO production and MAPK activation, was also observed in maize leaves (Zhang et al. 2007).

It is noteworthy that whole dormant grains cannot germinate at 30 °C, while isolated embryos can germinate at either 20 or 30 °C. Results obtained with DPI-treated embryos (Table 3) also suggest a positive effect of ROS generated by NADPH oxidase on germination as was observed in barley (Ishibashi et al. 2010), cress and Arabidopsis (Müller et al. 2009), warm-season C4 grasses (Sarath et al. 2007) and sunflower (Oracz et al. 2009). The lack of any effect of H2O2 on HvNADPHox gene expression (Fig. 5d) suggests that the activity of this enzyme was controlled at the post-transcriptional rather than at the transcriptional level. The analysis of several NADPH oxidase-deficient mutants clearly showed that ROS are rate-limiting in guard cell ABA signal transduction (Kwak et al. 2003) and they are also implicated in seed germination in Arabidopsis (Müller et al. 2009).

Although H2O2 induced germination, the ABA content in the embryo was unexpectedly slightly higher after this treatment (Fig. 6), whereas Wang et al. (1998) and Barba-Espin et al. (2010) showed that treatment with H2O2 resulted in a decrease in ABA content in barley embryos and in pea seedlings, respectively. The increase in ABA content observed here (Fig. 6) was consistent with the induction of HvNCED1 and HvNCE2 genes while HvABA8′OH1 expression was not altered (Fig. 7). The HvNCED1 gene was already shown to play a key role in regulating ABA levels under conditions that inhibit germination such as at 30 °C in the dark (Leymarie et al. 2008) and in the light (Gubler et al. 2008). Furthermore, LeNCED4 appears to be a major factor responsible for thermoinhibition in lettuce seeds (Argyris et al. 2008, 2011). The HvABA8′OH1 transcript amount was also not affected by light, which inhibits germination in barley (Gubler et al. 2008), but was higher during imbibition of non-dormant grains (Millar et al. 2006) or at 20 °C where dormant grains germinate (Leymarie et al. 2008). However, Barrero et al. (2009) showed that the ABA localization within the embryo is not uniform. Therefore, it is possible that ABA level does not increase in the coleorhiza, the most important tissue for regulation of germination (Barrero et al. 2009). This increase of ABA content by H2O2 could be related to the role of ABA in the activation of antioxidant defence to counteract oxidative stress like in vegetative parts (Neill et al. 2008; Lu et al. 2009; Zhang et al. 2009).

Germination in the presence of H2O2 in conjunction with high ABA levels can be related to the inhibition of ABA signalling, or to GA signalling or biosynthesis activation, because the ABA/GA balance, rather than absolute hormone amounts, controls germination (White et al. 2000; Cadman et al. 2006; Finch-Savage & Leubner-Metzger 2006). Oxidizing treatments induced a reduction in the sensitivity to ABA in the stomata of spring barley (Atkinson, Wookey & Mansfield 1991) and Leontodon hispidus (Wilkinson & Davies 2009). However, Wang et al. (1998) showed that the ABA concentration required for 50% inhibition of germination of isolated barley embryos was the same after H2O2 treatment. In agreement with this study, we did not find a clear insensitivity to ABA of H2O2-treated embryos (Fig. 8). We also did not detect any significant effect on the relative expression of HvABI5 and HvVP1 (Supporting Information Fig. S2), which are involved in ABA signalling (Finkelstein et al. 2008). This supports the hypothesis that H2O2 does not affect the ABA sensitivity of barley embryos.

If ABA signalling and sensitivity are not altered by ROS treatment while ABA content is high, it is reasonable to assume that the GA signalling was affected by the H2O2 treatment. Expansins are induced by GA (Chen & Bradford 2000; Yamauchi et al. 2004; Thiel et al. 2008) and transcriptomic analyses revealed that several expansin genes are expressed in barley embryos during germination (Sreenivasulu et al. 2008; Barrero et al. 2009). The expansin HvExpA11 transcript was induced by H2O2 by the same order of magnitude as by GA3 (Fig. 9). H2O2 treatment is assumed to increase the GA content as the expression of the GA catabolism gene HvGA2ox3 was reduced and HvGA20ox1, which is involved in GA synthesis, was strongly induced (Fig. 10), which should be validated by GA content measurements in future studies. In Arabidopsis seeds, an activation of GA biosynthesis genes by H2O2 was also observed, although it was associated with activation of ABA catabolism (Liu et al. 2010).

In conclusion, our results suggest a role for H2O2 in the regulation of barley seed dormancy through the interaction with hormonal signalling pathways. This role of ROS appears to be mediated by the activation of GA signalling and/or biosynthesis rather than by the inhibition of ABA signalling. This finding highlights the relevance of the ABA/GA balance in integrating information and leads to the proposed model presented in Fig. 11. We suggest that in the case of low ROS content, such as found in dormant barley grains under control conditions at 30 °C, ABA signalling is activated while GA signalling is low, resulting in dormancy. Exogenous H2O2 changes this network; it does not appear to alter ABA biosynthesis and signalling, but has a more pronounced effect on GA signalling, inducing a change in hormonal balance that results in germination (Fig. 11).

image

Figure 11. Proposed model for the interaction between reactive oxygen species and hormones in dormant barley grains at 30 °C. In dormant grains, abscisic acid (ABA) signalling is activated while gibberellin (GA) signalling is reduced, resulting in dormancy. Exogenously applied H2O2 changes this network, as it has a strong effect on GA signalling, inducing a change in hormonal balance leading to germination.

Download figure to PowerPoint

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

This work was supported by the British-French Alliance programme (Grant 07.075), which allowed EB to work at the Royal Botanic Gardens, Kew. We thank Kent Bradford for critical comment on the manuscript.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information
  • Achard P., Renou J.-P., Berthomé R., Harberd N.P. & Genschik P. (2008) Plant DELLAs restrain growth and promote survival of adversity by reducing the levels of reactive oxygen species. Current Biology 18, 656660.
  • Argyris J., Dahal P., Hayashi E., Still D.W. & Bradford K.J. (2008) Genetic variation for lettuce seed thermoinhibition is associated with temperature-sensitive expression of abscisic acid, gibberellin and ethylene biosynthesis, metabolism and response genes. Plant Physiology 148, 926947.
  • Argyris J., Truco M., Ochoa O., McHale L., Dahal P., Van Deynze A., Michelmore R. & Bradford K. (2011) A gene encoding an abscisic acid biosynthetic enzyme (LsNCED4) collocates with the high temperature germination locus Htg6.1 in lettuce (Lactuca sp.). Theoretical and Applied Genetics 122, 95108.
  • Atkinson C.J., Wookey P.A. & Mansfield T.A. (1991) Atmospheric pollution and the sensitivity of stomata on barley leaves to abscisic acid and carbon dioxide. New Phytologist 117, 535541.
  • Bailly C., Benamar A., Corbineau F. & Côme D. (1996) Changes in malondialdehyde content and in superoxide dismutase, catalase and glutathione reductase activities in sunflower seeds as related to deterioration during accelerated aging. Physiologia Plantarum 97, 104110.
  • Barba-Espin G., Diaz-Vivancos P., Clemente-Moreno M.J., Albacete A., Faize L., Faize M., Pérez-Alfocea F. & Hernandez J.A. (2010) Interaction between hydrogen peroxide and plant hormones during germination and the early growth of pea seedlings. Plant, Cell & Environment 33, 981994.
  • Barrero J.M., Talbot M.J., White R.G., Jacobsen J.V. & Gubler F. (2009) Anatomical and transcriptomic studies of the coleorhiza reveal the importance of this tissue in regulating dormancy in barley. Plant Physiology 150, 10061021.
  • Bashir K., Nagasaka S., Itai R., Kobayashi T., Takahashi M., Nakanishi H., Mori S. & Nishizawa N. (2007) Expression and enzyme activity of glutathione reductase is upregulated by Fe-deficiency in graminaceous plants. Plant Molecular Biology 65, 277284.
  • Benech-Arnold R.L., Gualano N., Leymarie J., Côme D. & Corbineau F. (2006) Hypoxia interferes with ABA metabolism and increases ABA sensitivity in embryos of dormant barley grains. Journal of Experimental Botany 57, 14231430.
  • Bewley J.D. (1997) Seed germination and dormancy. The Plant Cell 9, 10551066.
  • Bradford K.J., Benech-Arnold R.L., Côme D. & Corbineau F. (2008) Quantifying the sensitivity of barley seed germination to oxygen, abscisic acid, and gibberellin using a population-based threshold model. Journal of Experimental Botany 59, 335347.
  • Bright J., Desikan R., Hancock J.T., Weir I.S. & Neill S.J. (2006) ABA-induced NO generation and stomatal closure in Arabidopsis are dependent on H2O2 synthesis. The Plant Journal 45, 113122.
  • Buchanan B.B. & Balmer Y. (2005) Redox regulation: a broadening horizon. Annual Review of Plant Biology 56, 187220.
  • Cadman C.S.C., Toorop P.E., Hilhorst H.W.M. & Finch-Savage W.E. (2006) Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. The Plant Journal 46, 805822.
  • Chen F. & Bradford K.J. (2000) Expression of an expansin is associated with endosperm weakening during tomato seed germination. Plant Physiology 124, 12651274.
  • Chien C. & Lin T. (1994) Mechanisms of hydrogen peroxide in improving the germination of Cinnamomum camphora seed. Seed Science and Technology 22, 231236.
  • Chono M., Honda I., Shinoda S., Kushiro T., Kamiya Y., Nambara E., Kawakami N., Kaneko S. & Watanabe Y. (2006) Field studies on the regulation of abscisic acid content and germinability during grain development of barley: molecular and chemical analysis of pre-harvest sprouting. Journal of Experimental Botany 57, 24212434.
  • Colville L. & Kranner I. (2010) Desiccation tolerant plants as model systems to study redox regulation of protein thiols. Plant Growth Regulation 62, 242255.
  • Côme D., Corbineau F. & Lecat S. (1988) Some aspects of metabolic regulation of cereal seed germination and dormancy. Seed Science and Technology 16, 97104.
  • Cutler S.R., Rodriguez P.L., Finkelstein R.R. & Abrams S.R. (2010) Abscisic acid: emergence of a core signaling network. Annual Review of Plant Biology 61, 651679.
  • El-Maarouf-Bouteau H. & Bailly C. (2008) Oxidative signaling in seed germination and dormancy. Plant Signaling & Behavior 3, 175182.
  • Fath A., Bethke P., Beligni V. & Jones R. (2002) Active oxygen and cell death in cereal aleurone cells. Journal of Experimental Botany 53, 12731282.
  • Finch-Savage W.E. & Leubner-Metzger G. (2006) Seed dormancy and the control of germination. New Phytologist 171, 501523.
  • Finkelstein R., Reeves W., Ariizumi T. & Steber C. (2008) Molecular aspects of seed dormancy. Annual Review of Plant Biology 59, 387415.
  • Fontaine O., Huault C., Pavis N. & Billard J.P. (1994) Dormancy breakage of Hordeum vulgare seeds: effects of hydrogen peroxide and scarification on glutathione level and glutathione reductase activity. Plant Physiology and Biochemistry 32, 677683.
  • Fontaine O., Billard J.P. & Huault C. (1995) Effect of glutathione on dormancy breakage in barley seeds. Plant Growth Regulation 16, 5558.
  • Foyer C.H. & Noctor G. (2005) Oxidant and antioxidant signalling in plants: a re-evaluation of the concept of oxidative stress in a physiological context. Plant, Cell & Environment 28, 10561071.
  • Fujita M., Fujita Y., Noutoshi Y., Takahashi F., Narusaka Y., Yamaguchi-Shinozaki K. & Shinozaki K. (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Current Opinion in Plant Biology 9, 436442.
  • Giannopolitis C. & Ries S. (1977) Superoxide dismutases. I. Occurence in plants. Plant Physiology 59, 309314.
  • Gubler F., Chandler P.M., White R.G., Llewellyn D.J. & Jacobsen J.V. (2002) Gibberellin signaling in barley aleurone cells. Control of SLN1 and GAMYB expression. Plant Physiology 129, 191200.
  • Gubler F., Hughes T., Waterhouse P. & Jacobsen J. (2008) Regulation of dormancy in barley by blue light and after-ripening: effects on abscisic acid and gibberellin metabolism. Plant Physiology 147, 886896.
  • Hellemans J., Mortier G., De Paepe A., Speleman F. & Vandesompele J. (2007) qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biology 8, R19.
  • Hsiao A.I. & Quick W.A. (1984) Actions of sodium and hydrogen peroxide on seed dormancy and germination of wild oats, Avena fatua L. Weed Research 24, 411419.
  • Ishibashi Y., Tawaratsumida T., Zheng S.-H., Yuasa T. & Iwaya-Inoue M. (2010) NADPH oxidases act as key enzyme on germination and seedling growth in barley (Hordeum vulgare L.). Plant Production Science 13, 4552.
  • Jacobsen J.V., Pearce D.W., Poole A.T., Pharis R.P. & Mander L.N. (2002) Abscisic acid, phaseic acid and gibberellin contents associated with dormancy and germination in barley. Physiologia Plantarum 115, 428441.
  • Jones R.L. & Jacobsen J.V. (1991) Regulation of synthesis and transport of secreted protein in cereal aleurone. International Review of Cytology 126, 4988.
  • Julliard J., Maldiney R., Sotta B., Miginiac E., Kerhoas L. & Einhorn J. (1994) HPLC-ELISA and MS as complementary techniques to study plant hormone metabolites. Analysis 22, 483489.
  • Koornneef M., Bentsink L. & Hilhorst H. (2002) Seed dormancy and germination. Current Opinion in Plant Biology 5, 3336.
  • Kranner I. & Grill D. (1996) Determination of glutathione and glutathione disulphide in lichens: a comparison of frequently used methods. Phytochemical Analysis 7, 2428.
  • Kranner I., Birtic S., Anderson K.M. & Pritchard H.W. (2006) Glutathione half-cell reduction potential: a universal stress marker and modulator of programmed cell death? Free Radical Biology & Medicine 40, 21552165.
  • Kucera B., Cohn M. & Leubner-Metzger G. (2005) Plant hormone interactions during seed dormancy release and germination. Seed Science Research 15, 281307.
  • Kwak J.M., Mori I.C., Pei Z.M., Leonhardt N., Torres M.A., Dangl J.L., Bloom R.E., Bodde S., Jones J.D.G. & Schroeder J.I. (2003) NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis. The EMBO Journal 22, 26232633.
  • Lenoir C., Corbineau F. & Côme D. (1983) Principales caractéristiques de la dormance de l'Orge de brasserie et de son élimination. Bios 14, 2429.
  • Leymarie J., Bruneaux E., Gibot-Leclerc S. & Corbineau F. (2007) Identification of transcripts potentially involved in barley seed germination and dormancy using cDNA-AFLP. Journal of Experimental Botany 58, 425437.
  • Leymarie J., Robayo-Romero M.E., Gendreau E., Benech-Arnold R.L. & Corbineau F. (2008) Involvement of ABA in induction of secondary dormancy in barley (Hordeum vulgare L.) seeds. Plant & Cell Physiology 49, 18301838.
  • Liu Y., Ye N., Liu R., Chen M. & Zhang J. (2010) H2O2 mediates the regulation of ABA catabolism and GA biosynthesis in Arabidopsis seed dormancy and germination. Journal of Experimental Botany 61, 29792990.
  • Lozano R.M., Wong J.H., Yee B.C., Peters A., Kobrehel K. & Buchanan B.B. (1996) New evidence for a role for thioredoxin h in germination and seedling development. Planta 200, 100106.
  • Lu S., Su W., Li H. & Guo Z. (2009) Abscisic acid improves drought tolerance of triploid bermuda grass and involves H2O2- and NO-induced antioxidant enzyme activities. Plant Physiology and Biochemistry 47, 132138.
  • Maya-Ampudia V. & Bernal-Lugo I. (2006) Redox-sensitive target detection in gibberellic acid-induced barley aleurone layer. Free Radical Biology & Medicine 40, 13621368.
  • Meinhard M. & Grill E. (2001) Hydrogen peroxide is a regulator of ABI1, a protein phosphatase 2C from Arabidopsis. FEBS Letters 508, 443446.
  • Meinhard M., Rodriguez P.L. & Grill E. (2002) The sensitivity of ABI2 to hydrogen peroxide links the abscisic acid-response regulator to redox signalling. Planta 214, 775782.
  • Millar A.A., Jacobsen J.V., Ross J.J., Helliwell C.A., Poole A.T., Scofield G., Reid J.B. & Gubler F. (2006) Seed dormancy and ABA metabolism in Arabidopsis and barley: the role of ABA 8′-hydroxylase. The Plant Journal 45, 942954.
  • Miyazono K., Miyakawa T., Sawano Y., et al. (2009) Structural basis of abscisic acid signalling. Nature 462, 609614.
  • Møller I.M., Jensen P.E. & Hansson A. (2007) Oxidative modifications to cellular components in plants. Annual Review of Plant Biology 58, 459481.
  • Müller K., Carstens A.C., Linkies A., Torres M.A. & Leubner-Metzger G. (2009) The NADPH-oxidase AtrbohB plays a role in Arabidopsis seed after-ripening. New Phytologist 184, 885897.
  • Nambara E. & Marion-Poll A. (2003) ABA action and interactions in seeds. Trends in Plant Science 8, 213217.
  • Nambara E., Okamoto M., Tatematsu K., Yano R., Seo M. & Kamiya Y. (2010) Abscisic acid and the control of seed dormancy and germination. Seed Science Research 20, 5567.
  • Naredo M., Juliano A., Lu R., de Guzman F. & Jackson M. (1998) Responses to seed dormancy-breaking treatments in rice species (Oryza L.). Seed Science and Technology 26, 675689.
  • Neill S., Barros R., Bright J., Desikan R., Hancock J., Harrison J., Morris P., Ribeiro D. & Wilson I. (2008) Nitric oxide, stomatal closure, and abiotic stress. Journal of Experimental Botany 59, 165176.
  • Nishimura N., Sarkeshik A., Nito K., et al. (2010) PYR/PYL/RCAR family members are major in vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. The Plant Journal 61, 290299.
  • Ogawa K. & Iwabuchi M. (2001) A mechanism for promoting the germination of Zinnia elegans seeds by hydrogen peroxide. Plant & Cell Physiology 42, 286291.
  • O'Kane D., Gill V., Boyd P. & Burdon R. (1996) Chilling, oxidative stress and antioxidant responses in Arabidopsis thaliana callus. Planta 198, 371377.
  • Oracz K., El-Maarouf-Bouteau H., Farrant J.M., Cooper K., Belghazi M., Job C., Job D., Corbineau F. & Bailly C. (2007) ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. The Plant Journal 50, 452465.
  • Oracz K., El-Maarouf-Bouteau H., Kranner I., Bogatek R., Corbineau F. & Bailly C. (2009) The mechanisms involved in seed dormancy alleviation by hydrogen cyanide unravel the role of reactive oxygen species as key factors of cellular signaling during germination. Plant Physiology 150, 494505.
  • Pei Z., Murata Y., Benning G., Thomine S., Klusener B., Allen G., Grill E. & Schroeder J. (2000) Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature 406, 731734.
  • Pfaffl M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29, e45.
  • Roach T., Beckett R.P., Minibayeva F.V., Whitaker C., Chen H., Bailly C. & Kranner I. (2010) Extracellular superoxide production, viability and redox poise in response to desiccation in recalcitrant Castanea sativa seeds. Plant, Cell & Environment 33, 5975.
  • Sakamoto A., Ohsuga H. & Tanaka K. (1992) Nucleotide sequences of two cDNA clones encoding different Cu/Zn-superoxide dismutases expressed in developing rice seed (Oryza sativa L.). Plant Molecular Biology 19, 323327.
  • Sakamoto A., Okumura T., Kaminaka H. & Tanaka K. (1995) Molecular cloning of the gene (SodCc1) that encodes a cytosolic copper/zinc-superoxide dismutase from rice (Oryza sativa L.). Plant Physiology 107, 651652.
  • Sambrook J. & Russel W. (2001) Molecular Cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
  • Sarath G., Hou G., Baird L. & Mitchell R. (2007) Reactive oxygen species, ABA and nitric oxide interactions on the germination of warm-season C4-grasses. Planta 226, 697708.
  • Schafer F.Q. & Buettner G.R. (2001) Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple. Free Radical Biology & Medicine 30, 11911212.
  • Schroeder J., Kwak J. & Allen G. (2001) Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410, 327330.
  • Skadsen R.W., Schulze-Lefert P. & Herbst J.M. (1995) Molecular cloning, characterization and expression analysis of two catalase isozyme genes in barley. Plant Molecular Biology 29, 10051014.
  • Spielmeyer W., Ellis M., Robertson M., Ali S., Lenton J.R. & Chandler P.M. (2004) Isolation of gibberellin metabolic pathway genes from barley and comparative mapping in barley, wheat and rice. Theoretical and Applied Genetics 109, 847855.
  • Sreenivasulu N., Usadel B., Winter A., et al. (2008) Barley grain maturation and germination: metabolic pathway and regulatory network commonalities and differences highlighted by new MapMan/PageMan profiling tools. Plant Physiology 146, 17381758.
  • Sutton F. & Kenefick D. (1994) Nucleotide sequence of a cDNA encoding an elongation factor (EF-1alpha) from barley primary leaf. Plant Physiology 104, 807.
  • Thiel J., Weier D., Sreenivasulu N., Strickert M., Weichert N., Melzer M., Czauderna T., Wobus U., Weber H. & Weschke W. (2008) Different hormonal regulation of cellular differentiation and function in nucellar projection and endosperm transfer cells: a microdissection-based transcriptome study of young barley grains. Plant Physiology 148, 14361452.
  • Trujillo M., Altschmied L., Schweizer P., Kogel K.-H. & Ralph H. (2006) Respiratory burst oxidase homologue A of barley contributes to penetration by the powdery mildew fungus Blumeria graminis f. sp. horde. Journal of Experimental Botany 57, 37813791.
  • Wang P. & Song C.-P. (2008) Guard-cell signalling for hydrogen peroxide and abscisic acid. New Phytologist 178, 703718.
  • Wang M., van der Meulen R.-M., Visser K., van Schaik H.-P., van Duijn B. & de Boer A.-H. (1998) Effects of dormancy-breaking chemicals on ABA levels in barley grain embryos. Seed Science Research 8, 129137.
  • Wang P.-C., Du Y.-Y., An G.-Y., Zhou Y., Miao C. & Song C.-P. (2006) Analysis of global expression profiles of Arabidopsis genes under abscisic acid and H2O2 applications. Journal of Integrative Plant Biology 48, 6274.
  • White C.N., Proebsting W.M., Hedden P. & Rivin C.J. (2000) Gibberellins and seed development in maize. I. Evidence that gibberellin/abscisic acid balance governs germination versus maturation pathways. Plant Physiology 122, 10811088.
  • White J., Pacey-Miller T., Bundock P. & Henry R. (2008) Differential LongSAGE tag abundance analysis in a barley seed germination time course and validation with relative real-time RT-PCR. Plant Science 175, 858.
  • Wilkinson S. & Davies W.J. (2009) Ozone suppresses soil drying- and abscisic acid (ABA)-induced stomatal closure via an ethylene-dependent mechanism. Plant, Cell & Environment 32, 949959.
  • Wong J.H., Kim Y.-B., Ren P.-H., Cai N., Cho M.-J., Hedden P., Lemaux P.G. & Buchanan B.B. (2002) Transgenic barley grain overexpressing thioredoxin shows evidence that the starchy endosperm communicates with the embryo and the aleurone. Proceedings of the National Academy of Sciences of the United States of America 99, 1632516330.
  • Yamaguchi S. (2008) Gibberellin metabolism and its regulation. Annual Review of Plant Biology 59, 225251.
  • Yamauchi Y., Ogawa M., Kuwahara A., Hanada A., Kamiya Y. & Yamaguchi S. (2004) Activation of gibberellin biosynthesis and response pathways by low temperature during imbibition of Arabidopsis thaliana seeds. The Plant Cell 16, 367378.
  • Yin P., Fan H., Hao Q., Yuan X., Wu D., Pang Y., Yan C., Li W., Wang J. & Yan N. (2009) Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nature Structural & Molecular Biology 16, 12301236.
  • Zhang X., Zhang L., Dong F., Gao J., Galbraith D.W. & Song C.-P. (2001) Hydrogen peroxide is involved in abscisic acid-induced stomatal closure in Vicia faba. Plant Physiology 126, 14381448.
  • Zhang A., Jiang M., Zhang J., Ding H., Xu S., Hu X. & Tan M. (2007) Nitric oxide induced by hydrogen peroxide mediates abscisic acid-induced activation of the mitogen-activated protein kinase cascade involved in antioxidant defense in maize leaves. New Phytologist 175, 3650.
  • Zhang Y., Tan J., Guo Z., Lu S., He S., Shu W. & Zhou B. (2009) Increased abscisic acid levels in transgenic tobacco over-expressing 9 cis-epoxycarotenoid dioxygenase influence H2O2 and NO production and antioxidant defences. Plant, Cell & Environment 32, 509519.

Supporting Information

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Figure S1. Northern blots showing the expression of HvCAT1, and HvCAT2, HvGR2 and HvSOD transcripts. These images illustrate data that are presented in Fig. 5 together with statistical analysis.

Figure S2. Expression of (a) HvABI5 and (b) HvVP1 transcripts analysed by real time RT-PCR (arbitrary units with the 100 value for the D dry sample, and relative expression to HvEF1α and HvMub1, and HvActin and HvMub1 reference genes, respectively) in embryos from dry dormant grains or from grains that had been imbibed for 8 h at 30 °C in water or 1 M H2O2. Data are means of 4 (HvABI5) or 3 (HvVP1) independent experiments ± SD.

FilenameFormatSizeDescription
PCE_2298_sm_fS1.pdf41KSupporting info item
PCE_2298_sm_fS2.pdf13KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.