Postharvest temperature influences volatile lactone production via regulation of acyl-CoA oxidases in peach fruit

Authors

  • WAN-PENG XI,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    2. Agricultural College of Shihezi University, Shihezi, Xin Jiang 832003, China
    Search for more papers by this author
    • These authors contributed equally to this work.

  • BO ZHANG,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    Search for more papers by this author
    • These authors contributed equally to this work.

  • LI LIANG,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    2. College of Life and Environmental Science, Wenzhou University, Wenzhou, Zhejiang 325027, China
    Search for more papers by this author
  • JI-YUAN SHEN,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    Search for more papers by this author
  • WEN-WEN WEI,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    Search for more papers by this author
  • CHANG-JIE XU,

    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
    Search for more papers by this author
  • ANDREW C. ALLAN,

    1. The New Zealand Institute for Plant and Food Research, Private Bag 92169, Auckland, New Zealand
    Search for more papers by this author
  • IAN B. FERGUSON,

    1. The New Zealand Institute for Plant and Food Research, Private Bag 92169, Auckland, New Zealand
    Search for more papers by this author
  • KUN-SONG CHEN

    Corresponding author
    1. Laboratory of Fruit Quality Biology/The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Zijingang Campus, Hangzhou, Zhejiang 310058, China
      K-S. Chen. Fax: +86 571 88982224; e-mail: akun@zju.edu.cn
    Search for more papers by this author

Errata

This article is corrected by:

  1. Errata: Erratum Volume 37, Issue 7, 1722, Article first published online: 2 June 2014

K-S. Chen. Fax: +86 571 88982224; e-mail: akun@zju.edu.cn

ABSTRACT

The biosynthesis of volatile compounds in plants is affected by environmental conditions. Lactones are considered to be peach-like aroma volatiles; however, no enzymes or genes associated with their biosynthesis have been characterized. White-fleshed (cv. Hujingmilu) and yellow-fleshed (cv. Jinxiu) melting peach (Prunus persica L. Batsch) fruit were used as materials in two successive seasons and responses measured to four different temperature treatments. Five major lactones accumulated during postharvest peach fruit ripening at 20 °C. Peach fruit at 5 °C, which induces chilling injury (CI), had the lowest lactone content during subsequent shelf life after removal, while 0 °C and a low-temperature conditioning (LTC) treatment alleviated development of CI and maintained significantly higher lactone contents. Expression of PpACX1 and activity of acyl-CoA oxidase (ACX) with C16-CoA tended to increase during postharvest ripening both at 20 °C and during shelf life after removal from cold storage when no CI was developed. There was a positive correlation between ACX and lactones in peach fruit postharvest. Changes in lactone production in response to temperatures are suggested to be a consequence of altered expression of PpACX1 and long-chain ACX activity.

INTRODUCTION

Peach (Prunus persica L. Batsch) fruit ripen and senesce rapidly, softening within 2–3 d at ambient temperature after harvest. Low-temperature storage is the primary technology used to delay quality deterioration, although storage life is often limited by loss of quality due to chilling injury (CI). CI symptoms tend to develop faster and more intensely when peaches are stored at temperatures between 2 and 7 °C (Lurie & Crisosto 2005). These symptoms mainly develop after transfer of the fruit from cold storage to ambient or warmer temperatures.

Tolerance to low-temperature damage can be induced by techniques such as low-temperature conditioning (LTC) (Wang 2010). This temperature management involves treating fruit with non-damaging low temperatures for various periods, before transfer to lower storage temperatures. The key factors for the application of this technology are the differences between conditioning and cold storage temperatures, and the duration of the conditioning treatment (Sevillano et al. 2009). It has been applied successfully in alleviating or delaying CI development in avocados (Woolf et al. 2003), grapefruit (Biolatto et al. 2005), loquat (Cai et al. 2006) and peach fruit (Jin et al. 2009).

Aroma is an important factor for peach fruit quality, and has a major impact on consumer preference. More than 100 volatiles have been identified in peach (Aubert et al. 2003), but only a few compounds with high odour active values are essential to impact on fruit flavour quality (Eduardo et al. 2010). Among these compounds, lactones are considered particularly as peach-like aroma volatiles (Eduardo et al. 2010), and these accumulate significantly during ripening (Horvat et al. 1990; Zhang et al. 2010) and decrease in response to CI temperatures (Raffo et al. 2008). Our previous study showed that peach fruit with CI could be distinguished from undamaged fruit using electronic nose analysis, and gas chromatograph results showed that the difference was mainly caused by loss of lactone production (Zhang et al. 2011).

Despite the sensory importance of lactones for peach fruit quality, there is a lack of information on characterization of both the enzymes and genes associated with their biosynthesis. It has been suggested that β-oxidation of saturated fatty acids is a lactone biosynthesis pathway (Schwab, Davidovich-Rikanati & Lewinsohn 2008; Husain 2010) (Fig. 1). Acyl-CoA oxidase (ACX, EC 1.3.3.6) is the first enzyme involved in fatty acid β-oxidation, and is regarded as a key step controlling flux through the pathway (Arent, Pye & Henriksen 2008). Aliphatic long-chain acyl-CoA is first converted to 2-trans-enoyl-CoA by ACX, and finally yields an acyl-CoA. However, the breakdown of acetyl-CoA can be stopped between β-oxidation cycles or inside the reaction sequence due to many factors, resulting in the liberation of volatile lactones (Husain 2010). Depending on the above and another four reactions, 4- or 5-hydroxyl carboxylic acids are produced, which are considered as precursors of corresponding lactones (Schöttler & Boland 1996; Schwab et al. 2008). ACX has been widely involved in embryo development, seed germination, seedling establishment and in biosynthesis of jasmonic acid (JA) in response to stresses (reviewed in Baker et al. 2006). In addition, roles of ACX genes in turnover of fatty acids during natural senescence in plants have been reported (Yang & Ohlrogge 2009). Because there is a lack of lactone compounds in model plants such as Arabidopsis, rice and tomato, an association of ACX with fruity aroma formation is unclear. Because, as mentioned above, lactones are characteristic peach-like volatiles (Eduardo et al. 2010), peach fruit is a good model for investigating the relationships between lactones and ACX.

Figure 1.

Biosynthesis of volatile lactones derived from the β-oxidation mediated degradation of fatty acids in plants (Husain 2010).

In the present study, white- and yellow-fleshed melting peaches were used to study changes in lactones during fruit ripening at ambient temperature and cold storage plus subsequent shelf life after removal. Four ACX genes were cloned from peach fruit based on data from the peach genome database, and their expression profiles were determined by real-time quantitative PCR (RT-qPCR). Relationships between lactones, ACX gene expression and ACX enzyme activity using different substrates were analysed, and the role of temperatures in regulating lactone formation in peach fruit is discussed.

MATERIALS AND METHODS

Plant material and tissue sampling

Experiments were carried out in two successive seasons (2009 and 2010) using two melting peach (P. persica L. Batsch) cultivars. White-fleshed (cv. Hujingmilu) and yellow-fleshed (cv. Jinxiu) fruit were harvested at commercial maturity from Jiaxing, Zhejiang Province, China. Fruit were transported to the laboratory on the day of harvest, and screened for uniform size and lack of visible defects or decay.

Our previous work with these cultivars has shown that CI develops faster at 5 °C than 0 °C, and that LTC treatment, where fruit were held at 8 °C for 3 d followed by storage at 5 °C, prevented CI development (Jin et al. 2009). In the 2009 season, ‘Jinxiu’ (JX) fruit were therefore treated with the above low temperatures. The first group was treated with 5 °C to induce CI, the second with LTC and the third with 0 °C to prevent CI development. The fruit were stored at the low temperatures for 14, 21 and 28 d followed by shelf life at 20 °C for 3 d. In order to investigate the effect of ambient temperature on lactone production, JX and ‘Hujingmilu’ (HJML) fruit were also held at 20 °C for 7 d for postharvest ripening and sampled every day.

In the 2010 season, the study of the effects of low-temperature treatments on peach fruit aroma lactones was extended to both HJML and JX cultivars. The fruit were again divided into three groups. The first group was held at 5 °C, the second was stored at 0 °C and the third was treated with the above LTC treatment. The fruit were stored at the low temperatures for 14, 21 and 28 d followed by transfer to shelf life at 20 °C for up to 3 d.

For each treatment, three replicates of three fruit each were used for each analysis. At each sampling time, slices of mesocarp without skins (about 1 cm thick) were combined and frozen in liquid nitrogen and stored at −80 °C until analysis.

Fruit ripening evaluations

Ethylene production was determined on three replicates each of three fruit at the given sampling times. The three fruit were placed in a 2 L flask and capped with a rubber stopper for 1 h. One mL of headspace gas was sampled and analysed for ethylene using gas chromatography (SP 6800; Lunan Chemical Engineering Instrument, Shandong, China) according to Zhang et al. (2009).

A texture analyzer (TA-XT2i Plus; Stable Micro System Ltd., Surrey, UK) fitted with a 7.9-mm-diameter head was used for fruit firmness analysis according to Zhang et al. (2010). Two measurements were made on opposite sides at the circumference of each fruit after the removal of a 1-mm-thick slice of skin.

An internal browning (IB) index was used to evaluate CI development of peach fruit during cold storage and subsequent shelf life according to our previous work (Zhang et al. 2011). The IB index was calculated by rating on a scale (0–4) with the IB index = 100% × Σ[(internal browning scale) × (number of fruit at that internal browning scale)]/[4 × total number of fruit in each treatment]. The scale used was 0 = 0% flesh surface area affected, 1 = 1–25% area affected, 2 = 26–50% area affected, 3 = 51–70% area affected, 4 = 76–100% area affected.

Lactone analysis

Lactones were analysed according to Zhang et al. (2010). Briefly, 5 g of frozen flesh tissues was homogenized with saturated sodium chloride for 1.5 min using an Ultra Turrax. Before sealing the vials, 30 µL of 2-octanol (8.69 mg mL−1) was added as an internal standard, and vortexed for 10 s. For manual solid-phase micro-extraction (SPME) analysis, samples were equilibrated at 40 °C for 30 min. A fibre coated with 65 µm of polydimethylsiloxane and divinylbenzene (PDMS/DVB) (Supelco Co., Bellefonte, PA, USA) was used for lactone extraction. The lactones were then analysed using an Agilent 6890N equipped with a FID detector and a DB-WAX column (0.32 mm, 30 m, 0.25 µm; J&W Scientific, Folsom, CA, USA). Oven temperature was held at 34 °C for 2 min, increased by 2 °C min−1 to 60 °C then increased by 5 °C min−1 to 220 °C and held for 2 min. Nitrogen was used as a carrier gas at 1.0 mL min−1. Five lactones (γ-hexalactone, γ-octalactone, γ-decalactone, δ-decalactone and γ-dodecalactone) were obtained from Sigma-Aldrich, and used as authentic compounds. A standard concentration series ranging from 2.20 µg mL−1 to 4.50 mg mL−1 was prepared and then analysed by GC for standard curves. Quantitative determination of compounds was carried out using the peak of the internal standard as a reference value and calculated based on standard curves of authentic compounds.

ACX enzyme activity assay

ACX enzyme activity was analysed according to Adham et al. (2005) with modifications. One gram of frozen powdered flesh was added to 5 mL extraction buffer comprising 150 mm Tris-HCl (pH 7.5), 10 mm KCl, 1.0 mm EDTA and 25% (w/v) sucrose. Polyvinylpolypyrrolidone (100 mg) was added to each sample, and the homogenate was centrifuged at 12857 g for 10 min at 4 °C. The reaction mixture consisted of 50 µL acyl-CoA substrate, 50 µL phenol (1.06 mm), 450 µL colour development solution (60 U mL−1 horseradish peroxidase, 1.64 mm 4-aminoantipyrine and 20 µm flavin adenine dinucleotide). The extracted crude enzyme (450 µL) was added to the reaction system, and the increase in absorbance at 500 nm over 1 min was recorded to detect H2O2 production. Protein measurements were performed according to Bradford (1976) using bovine serum albumin (BSA) as a standard.

Sequence analysis of ACX genes

Candidate ACX sequences were found using the BLAST algorithm in the draft assembled and annotated peach genome (peach v1.0) database (http://www.phytozome.org/peach) from the International Peach Genome Initiative. At least four ACX genes were found in peach fruit, and the deduced protein sequence alignment of ACX genes was performed with ClustalX (version 1.81). The phylogenetic tree was drawn using TreeView with default parameters (http://www.bioon.com/Soft/Class1/Class13/200408/127.html).

RT-qPCR analysis

Total RNA was extracted from approximately 3 g of frozen tissues according to the method described by Zhang et al. (2006). Contaminating genomic DNA was removed by RNase-free DNase I (Fermentas, Vilnius, Lithuania) treatment. The first-strand cDNA was synthesized from 2.0 µg DNA-free RNA with RevertAid™ Premium Reverse Transcriptase (Fermentas), and was diluted for RT-qPCR analysis on a CFX 96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). PpTEF2 was used as an internal control to normalize small differences in template amounts according to Tong et al. (2009). Sequences of ACX primers for the qPCR are described in Table 1. Expression levels from the qPCR are expressed as a ratio relative to the fruit at the harvest time point, which was set to 1. At least three different RNA isolations and cDNA syntheses were used as replicates for the qPCR.

Table 1.  ACX genes and primers used in real-time quantitative PCR analysis
Gene nameForward primer (5′ to 3′)Reverse primer (5′ to 3′)
PpACX1CAAAACCAGAGACAGCACGACGTGTTTGTTTACTGGGGCT
PpACX2CACAGTCCATCACCAACAGGCCTGACACCCAATTACCCAC
PpACX3ATGCAAATTCGTGGTCTTCAGTTCATGTGCGGAACTGT
PpACX4TATCGGCGACCACAACAATAAGCAGAAACAAATGTCCCGT

Experimental design and statistical analysis

A completely randomized design was used in the experiments. Standard errors (SEs), figures and the correlation between enzyme activity and total lactones were made by OriginPro 7.5 G (Microcal Software, Inc., Northampton, MA, USA). Least significant difference (LSD) or Duncan's test at the 5% level was analysed by DPS (version 2.00; Zhejiang University, Hangzhou, China). Principal component analyses (PCA) were analysed using the AlphaSoft version 11.0 (Alpha MOS, Toulouse, France) according to Zhang et al. (2011). Samples were characterized by volatile lactones, flesh browning, ACX gene expression, enzyme activity and ethylene production. Data were centred and weighted by using the data reduction algorithm in order to avoid dependence on measured units, and to reduce the weight of large peaks so that the minor peaks have same impact. This methodology ensures that the weighting on variables in the PCA is not unit dependent, otherwise larger valued units that vary more will be dominant in the PCA.

RESULTS

Changes in firmness, ethylene and lactone production of peach fruit at ambient temperature

Fruit softened rapidly after harvest at 20 °C, with firmness loss from 38.96 N at harvest to 2.83 N at 4 d in HJML peaches (Fig. 2a) and from 26.14 N at harvest to 2.77 N at 6 d in JX fruit (Fig. 2b). As the fruit softened there was a typical ethylene climacteric rise for the two cultivars. The climacteric peak of ethylene production appeared 4 d after harvest for HJML fruit and 6 d after harvest for JX fruit, respectively. We did not follow the fruit through a post-climacteric phase.

Figure 2.

Changes in firmness, ethylene and lactone production of HJML (a, c, e, g) and JX (b, d, f, h) peach fruit during ripening at 20 °C. Empty squares represent changes associated with the left y axis while empty triangles represent changes with the right y axis. Lactones were determined from headspace analysis by solid-phase micro-extraction and gas chromatography. Error bars indicate standard error from three replicates (2009). FW, fresh weight; HJML, Hujingmilu; JX, Jinxiu; LSD, least significant difference.

Five major lactones were identified from the two cultivars, including γ-hexalactone, γ-octalactone, γ-decalactone, δ-decalactone and γ-dodecalactone. Among them, γ-decalactone showed the highest concentrations during ripening at 20 °C (Fig. 2c–h). Lactone levels were similar in both cultivars except for γ-octalactone, which was about 20-fold higher in JX fruit (Fig. 2c,d). When the ethylene climacteric rise occurred, total lactones of HJML fruit reached a maximum of 2792 µg g−1 fresh weight (FW) at about 4 d, and γ-decalactone accounted for 92% of the total (Fig. 2g). In the case of JX fruit, levels of lactones increased with the ethylene rise and peaked at about 6 d with a concentration of 2375 µg g−1 FW (Fig. 2h).

Peach fruit firmness, ethylene and IB index during postharvest cold storage and subsequent shelf life

Fruit treated with 5 °C showed a normal softening pattern during shelf life after 14 d of storage (from 10.8 to 3.2 N), but the white-fleshed HJML fruit failed to soften after 21 and 28 d of storage (Table 2). The fruit during the shelf life after extended storage at 5 °C presented a leathery texture (data not shown). The fruit treated with LTC or stored directly at 0 °C softened normally after 21 d of storage plus subsequent shelf life (Table 2). Upon removal from cold storage, a climacteric rise in ethylene production was observed after 14 d of cold storage. With prolonged storage, ethylene production tended to decrease, especially for the fruit treated at 5 °C which had significantly lower levels than that treated with LTC or 0 °C after 28 d of storage (Table 2). Peach fruit treated with 5 °C had a higher IB index throughout the experimental periods, and showed the most severe flesh browning among the three temperature treatments, followed by LTC and 0 °C.

Table 2.  Change in firmness, ethylene and IB index of peach fruit at harvest and after 14, 21 or 28 d of storage plus up to 3 d at 20 °C shelf life (2010)
HJMLTa (°C)0 d14 d14 d S3b21 d21 d S328 d28 d S3
Firmness (N)548.110.8 b3.22 a9.17 b13.6 a8.74 b26.1 a
LTC7.92 b3.89 a7.06 b3.77 b7.64 b4.62 b
043.9 a3.61 a40.7 a4.45 b33.8 a26.5 a
Ethylene (µL kg−1 h−1)50.211.28 a87.1 a1.69 a17.6 b1.45 a17.8 b
LTC1.19 a96.6 a1.40 a93.0 a0.97 a37.1 a
00.08 a24.6 b0.06 b24.7 b0.09 b30.0 a
IBc index (%)50010.02.86 a21.1 a7.74 a55.3 a
LTC002.26 a10.7 b5.00 a16.7 b
00003.21 c04.04 c
JXT0 d14 d14 d S321 d21 d S328 d28 d S3
  1. Values represent means of three replicates. Means with different letters within a column are significant different at P < 0.05. aTreatment. b3 d at 20 °C shelf life after storage. cIB, internal browning.

  2. HJML, Hujingmilu; JX, Jinxiu; LTC, low-temperature conditioning.

Firmness (N)526.113.6 b2.97 a9.39 b4.63 a8.68 b6.23 a
LTC18.7 a2.69 a13.2 b5.06 a12.38 b6.56 a
022.5 a2.66 a24.6 a4.08 a25.40 a5.19 a
Ethylene (µL kg−1 h−1)53.111.65 a63.6 a1.33 a23.4 b1.04 a9.73 b
LTC1.94 a59.9 a1.98 a34.9 a1.47 a15.4 b
00.19 b33.9 b0.17 b42.4 a0.08 b29.5 a
IB index (%)5000033.3 a13.392.1 a
LTC00017.7 b062.3 b
0000009.68 c

The yellow-fleshed JX fruit exhibited normal softening throughout the experimental periods regardless of storage temperature (Table 2), and showed a mealy texture (data not shown). The highest ethylene production during shelf life ripening was observed in fruit transferred from 0 °C after 21 and 28 d of storage, while the lowest was found in the fruit treated with 5 °C. Flesh tissue browning was affected by storage temperature and period. After 21 d of storage at 5 °C, fruit transferred to 20 °C exhibited flesh browning. Browning was also observed during shelf life after 28 d of storage at 0 °C (Table 2).

Changes in lactones during cold storage plus shelf life after transfer

Production of the five lactones remained low during cold storage (Table 3). When HJML peaches were transferred to ambient temperature, the content of lactones increased in fruit treated with 5 °C after 14 d of storage. High levels of lactones were also observed for fruit after removal from LTC and 0 °C conditions. The levels of lactones at 3 d of shelf life decreased with longer storage at low temperature. In addition, lactones such as γ- and δ-decalactone, and γ-dodecalactone were under the detection limits during shelf life after 28 d of storage. Fruit ripened at ambient temperature after storage at 0 °C showed the highest concentrations of lactones followed by LTC and 5 °C treatments throughout the experimental periods.

Table 3.  Changes in lactones (µg g−1 FW) of HJML peach fruit at harvest and after 14, 21 or 28 d of storage plus up to 3 d at 20 °C shelf life (2010)
LactonesTa (°C)0 d14 d14 d S3b21 d21 d S328 d28 d S3
  1. Values represent means of three replicates. Means with different letters within a column are different at P < 0.05.

  2. aTreatment. b3 d at 20 °C shelf life after storage. cBelow the level of detection.

  3. FW, fresh weight; HJML, Hujingmilu; LTC, low-temperature conditioning; UD, under the level of detection.

γ-hexalactone52.43.22b149 c2.47 b94.5 c1.71 a22.1 c
LTC2.58 b247 b1.87 c189 b1.34 b86.3 b
03.89 a315 a3.24 a255 a1.92 a149 a
γ-octalactone57.336.45 a53.2 b6.16 b14.2 c6.32 a4.59 c
LTC7.97 a54.2 b5.76 b29.4 b6.46 a8.17 b
08.23 a73.2 a6.87 a42.2 a5.37 b11.3 a
γ-decalactone56.437.65 a422 c8.12 a87.5 cUDcUD
LTC6.32 a764 b5.46 b345 b5.93 a14.2 b
08.65 a924 a5.46 b542 a6.22 a123 a
δ-decalactone526.328.1 a103 b17.9 b72.3 c12.3 bUD
LTC25.3 a232 a22.0 a123 b20.1 a33.5 b
027.7 a259 a23.1 a180 a15.3 b86.4 a
γ-dodecalactone5UDUD32.11 bUD8.71 cUDUD
LTCUD38.8 bUD14.2 bUD2.4 b
0UD45.1 aUD22.7 aUD4.5 a
Total lactones542.545.5 a760 c34.6 a277 c20.4 b26.7 c
LTC42.2 a1089 b35.1 a701 b33.9 a145 b
048.4 a1301 a38.7 a1042 a28.8 a375 a

Increased contents of lactones were found in JX fruit after removal from 5 °C after 14 and 21 d of storage (Table 4). After 28 d of storage at 5 °C, concentrations of δ-decalactone and γ-dodecalactone were under the limits of detection, and no lactones were detected during subsequent shelf life at 20 °C. A similar trend of changes in lactones was also observed in another fruit season (Supporting Information Table S1). LTC treatment significantly delayed the loss of lactones during cold storage and subsequent holding at 20 °C, and 0 °C treated fruit maintained substantially higher lactone levels after transfer (Table 4, Supporting Information Table S1).

Table 4.  Changes in lactones (µg g−1 FW) of JX peach fruit at harvest and after 14, 21 or 28 d of storage plus up to 3 d at 20 °C shelf life (2010)
LactonesTa (°C)0 d14 d14 d S3b21 d21 d S328 d28 d S3
  1. Values represent means of three replicates. Means with different letters within a column are different at P < 0.05.

  2. aTreatment. b3 d at 20 °C shelf life after storage. cBelow the level of detection.

  3. FW, fresh weight; JX, Jinxiu; LTC, low-temperature conditioning; UD, under the level of detection.

γ-hexalactone52.362.61 a3.31 b1.89 a1.21 c0.76 bUDc
LTC2.09 b6.31 a1.56 b3.88 b1.76 a1.62 b
02.57 a7.22 a2.01 a5.22 a1.81 a2.67 a
γ-octalactone5UD0.87 b1.23 c0.64 b0.32 c0.47 bUD
LTC0.89 b4.22 b0.64 b1.02 b0.66 a0.54 b
01.23 a6.31 a0.92 a4.43 a0.63 a2.17 a
γ-decalactone512.7140 a213 b103 a161 c65.2 bUD
LTC119 b581 a130 a362 b103 a122 b
0133 a633 a125 a477 a115 a158 a
δ-decalactone5UD1.47 a26.4 c1.04 b4.1 cUDUD
LTC1.81 a42.6 b1.54 a24.3 b1.21 a3.71 b
01.57 a55.0 a1.87 a39.8 a1.33 a11.3 a
γ-dodecalactone5UD21.3 a52.7 b14.4 b7.16 cUDUD
LTC19.2 a71.3 a17.1 a22.2 b11.7 b2.65 b
017.9 a72.9 a14.3 b56.2 a15.9 a14.4 a
Total lactones515.06167 a296 b122 c174 c66.4 cUD
LTC143 a706 a151 a413 b118 b131 b
0157 a775 a144 b583 a135 a188 a

Sequence analysis of peach ACX genes

According to sequences in the peach genome database, four ACX genes were isolated from peach fruit and designated PpACX1-4. A phylogenetic tree based on translated amino acid sequences indicated that the four genes were separated into four clusters (Fig. 3). Peach PpACX1 (ppa002510m) was grouped with Arabidopsis AtACX1 (NP_567513), AtACX5 (NP_181112), tomato LeACX1A (AY817109), LeACX1B (AY817110), cucumber GmACX1-1 (AAL01887) and GmACX1-2 (AAL0188), sharing 63–86% sequence homology (Fig. 3a). The second group contained peach PpACX2 (ppa002282m) and Arabidopsis AtACX2 (NP_201316) (Fig. 3b), together with genes from cucumber (AAC15870) and parsley (AAF14635). Peach PpACX3 (ppa002439m) and Arabidopsis AtACX3 (NP_172119) and AtACX6 (NP_172120) were clustered together in the third group (Fig. 3c). The fourth group was consisted of peach PpACX4 (ppa005916m) and Arabidopsis AtACX4 (NP_190752) (Fig. 3d).

Figure 3.

Phylogenetic analysis of acyl-CoA oxidase (ACX) from peach and other plant species. Data were organized using ClustalW and TreeView software with default parameters. Peach sequences are indicated in bold. Accession numbers in GenBank of sequences used to build the tree are as follows: AtACX1 (NP_567513), AtACX2 (NP_201316), AtACX3 (NP_172119), AtACX4 (NP_190752), AtACX5 (NP_181112), AtACX6 (NP_172120), GmACX1-1 (AAL01887), GmACX1-2 (AAL01888), HvACX (CAA04688), PcACX (AAF14635), LeACX1A (AY817109), LeACX1B (AY817110), CmACOX (AAC15870), PhaACOX (AAB67883), ZmACX (AY105897). Accession numbers of ACX genes in peach genome database are as follows: PpACX1 (ppa005916m), PpACX2 (ppa002282m), PpACX3 (ppa002510m) and PpACX4 (ppa002439m).

ACX gene expression and enzyme activity during ripening at 20 °C

In HJML fruit, PpACX1 showed a remarkable increase and peaked about 4 d after harvest followed by a decrease (Fig. 4a). Continued transcript accumulation of PpACX1 was found in JX fruit during postharvest ripening (Fig. 4b). Expression of PpACX2 was relatively constant after harvest in the two cultivars (Fig. 4c,d). Expression of transcripts of PpACX3 remained relatively constant during ripening at 20 °C for HJML and JX fruit (Fig. 4e,f). In contrast, there was an increase in PpACX4 levels immediately after harvest followed by constant expression levels during ripening at 20 °C (Fig. 4g,h).

Figure 4.

Expression of the acyl-CoA oxidase (ACX) gene family in peach fruit by qPCR analysis during ripening at 20 °C for Hujingmilu (HJML) (a, c, e, g) and Jinxiu (JX) (b, d, f, h) and changes in ACX activity with C16-CoA in HJML (i) and JX (j) peaches. Expression levels of each gene are expressed as a ratio relative to the harvest time (0 d), which was set at 1. Error bars indicate standard error from three replicates (2009). LSD, least significant difference.

Enzyme activity of ACX was analysed using the short-chain substrate C6-CoA, the medium-chain substrate C10-CoA and the long-chain substrate C16-CoA, respectively. ACX activities with the long-chain substrate tended to increase during HJML fruit ripening, peaking at about 4 d with threefold higher levels than at harvest (Fig. 4i). Changes in activity of ACX during ripening at 20 °C (Fig. 4i) showed a similar trend to that of ethylene, lactone production and PpACX2 expression (Fig. 2). In the case of JX fruit, ACX activity with C16-CoA substrate continued to increase up to 6 d during ripening at 20 °C. (Fig. 4j), while the enzyme activity using C10-CoA (Supporting Information Fig. S1a) and C6-CoA (Supporting Information Fig. S1b) as substrates maintained constant throughout the fruit ripening up to 7 d.

Expression of ACX genes during cold storage and subsequent shelf life after removal

There was an increase in PpACX1 expression during shelf life after 14 d of storage at 5 °C, but this accumulation was lost with extension of storage times (Fig. 5a,m). With LTC fruit, transcript levels of PpACX1 were induced even after storage for 21 d (Fig. 5b,n). The 0 °C treatment resulted in higher expression levels of PpACX1 than LTC and 5 °C treatments during the shelf life after 14 and 21 d of storage (Fig. 5c,o). A lack of increase in transcript levels of PpACX1 was observed when CI occurred after 28 d of cold storage at 0 °C. Expression of PpACX2 decreased after removal from 5 °C after 21 and 28 d of storage (Fig. 5d,p). For the LTC fruit, transcripts of PpACX2 tended to accumulate after transfer after 14 and 21 d of storage, even though the extent of accumulation was limited (Fig. 5e,q). A slight increase in expression of PpACX2 was also observed for fruit treated with 0 °C, and this induction was lost after 28 d of storage (Fig. 5f,r). Expression of PpACX3 was maintained constant regardless of storage temperature and period for HJML (Fig. 5g,h,i) and JX (Fig. 5s,t,u) fruit. Expression of PpACX4 increased immediately after harvest, and then the transcripts were maintained constant during cold storage plus shelf life at 20 °C regardless of temperature and period (Fig. 5j–l). No significant differences in expression of PpACX4 were found between the three different temperature treatments in JX fruit (Fig. 5v–x).

Figure 5.

Expression of acyl-CoA oxidase (ACX) gene family by qPCR analysis in peach fruit treated with 5 °C [a, d, g, j for Hujingmilu (HJML); m, p, s, v for Jinxiu (JX)], low-temperature conditioning (LTC) (b, e, h, k for HJML; n, q, t, w for JX) and 0 °C (e, f, i, l for HJML; o, r, u, x for JX) plus subsequent shelf life. Error bars indicate standard error from three replicates. Expression levels of each gene are expressed as a ratio relative to the harvest time (0 d), which was set at 1. In the x axis, 0 and 3 represent days of shelf life after removal from low-temperature storage for 14, 21 and 28 d (2010). LSD, least significant difference.

ACX activity during cold storage and subsequent shelf life after removal

ACX enzyme activity with C16-CoA in HJML fruit substantially increased after 14 d of storage at 5 °C. The shelf life increases declined after 21 d of storage, and were lost after 28 d of storage at 5 °C (Fig. 6a). For the fruit treated with LTC, there was a significant increase in the enzyme activity using the long-chain substrate during shelf life at 20 °C after 14 and 21 d of storage (Fig. 6c). Fruit at 0 °C showed a similar activity profile to that of fruit from LTC after 14 and 21 d of storage, but for longer storage times the increased levels were lower after 28 d of storage (Fig. 6e). A positive correlation between ACX activity and lactones was observed, R2 ranging from 0.80 to 0.96 (Fig. 6b,d,f). There was an increase in enzyme activity with C16-CoA during shelf life at 20 °C after 14 and 21 d of storage for JX fruit treated with LTC and 0 °C (Fig. 6i,k). The fruit at 0 °C had higher activity than that at 5 °C throughout the experimental period (Fig. 6g). Regression analysis showed that positive correlations were also found in JX fruit between lactone production and ACX activity during storage at 5 °C (R2 = 0.81) and treated with LTC (R2 = 0.94) and 0 °C (R2 = 0.96) (Fig. 6h,j,l). When the medium-chain C10-CoA was used as substrate, ACX enzyme activity of JX fruit was maintained constant during cold storage and subsequent shelf life (Supporting Information Fig. S2a,b,c). In addition, a similar profile of the enzyme activity with C6-CoA was found for the fruit throughout the experiment periods (Supporting Information Fig. S2d,e,f).

Figure 6.

Changes in acyl-CoA oxidase activity with C16-CoA and its correlation with total lactones in Hujingmilu (HJML) (a–f) and Jinxiu (JX) fruit (g–l) treated with 5 °C, low-temperature conditioning (LTC) and 0 °C plus subsequent shelf life. Error bars indicate standard error from three replicates. In the x axis, 0 and 3 represent days of shelf life after removal from low-temperature storage for 14, 21 and 28 d (2010). FW, fresh weight; LSD, least significant difference.

Full-data PCA model during cold storage and subsequent shelf life after removal

A PCA model provided an overview of the relationships within the whole dataset. When production of the five lactones, expression of PpACX1-4, ACX activity with the long-chain C16-CoA, ethylene production, firmness and flesh browning were used to characterize peach fruit at low-temperature storage and subsequent shelf life, PC1 and PC2 accounted for 82% for HJML (Fig. 7a) or 88% for JX fruit (Fig. 7b) of the total variability. The fruit with CI symptoms after transfer from cold storage was clustered (red circle) with browning flesh tissues, and differed from normal ripening fruit (Fig. 7). Peach fruit without CI symptoms after transfer from cold storage were grouped and characterized by high levels of lactone production, PpACX2 transcripts, ACX activity with C16-CoA and ethylene production (green circle) (Fig. 7). In the case of fruit during low temperature, these samples were clustered into one group (black circle) and did not exhibit CI symptoms (Fig. 7).

Figure 7.

Principal component analyses of the first two principal components for lactone, acyl-CoA oxidase (ACX) gene family, ACX activity with C16-CoA, ethylene, firmness and flesh browning in Hujingmilu (a) and Jinxiu (b) peach fruit treated with 5 °C (red dot), low-temperature conditioning (LTC) (blue star) and 0 °C (green triangle) plus subsequent shelf life after removal. 5C14S3: the first number represents the fruit treatment, S means shelf life, the number before S means days after storage, the number after S means days during shelf life at 20 °C (2010). CI, chilling injury.

DISCUSSION

This study reports significant changes in aroma-related lactones of peach fruit during postharvest ripening, and is in agreement with our previous results showing loss of lactone levels in CI fruit during the shelf life period after transfer from low-temperature treatment (Zhang et al. 2011). Fruit stored at a CI-inducing temperature (5 °C) failed to produce lactones which accompanied flesh browning at room temperature after 21 d of storage. However, the content of lactones was effectively maintained when development of CI was delayed by the LTC treatment. According to volatile lactones content during shelf life after removal, the 0 °C treatment was the most effective for maintaining aroma quality, followed by the LTC treatment that alleviated the loss of lactones caused by CI. These results confirm that loss of fruity aromas is a symptom of CI in peach fruit, contributing to separation of normal ripening fruit from the CI fruit based on electronic nose analysis (Zhang et al. 2011). Although the importance of lactone compounds on peach fruit aroma has been widely reported, no enzymes or genes related to lactone production have been characterized.

Because β-oxidation has been suggested to be involved in lactone formation (Schwab et al. 2008; Husain 2010), changes in expression of ACX genes and activity of the encoding enzyme located in the first step of the pathway were studied. Among the four ACX gene members, PpACX1 had a distinct expression profile. Transcript levels of PpACX1 increased with accumulated lactones both during ripening at ambient temperature and during shelf life after cold storage with or without LTC treatment when no CI was developed. PpACX2 exhibited a similar expression pattern to PpACX1 but had substantial lower fold changes in transcript levels during postharvest ripening at 20 °C and cold storage plus subsequent shelf life. In the case of other two ACX genes, transcripts were relatively constant both at ambient and low temperature except for PpACX4 which had a sharp increase in expression at the first day after harvest. In addition, expression levels of the family members were compared according to the method described by Schmittgen & Livak (2008), and PpACX1 had the highest levels during peach fruit ripening (data not shown). These results suggest a relationship between expression of PpACX1/PpACX2 and lactone production in peach fruit. Sequence analysis showed that PpACX1 was clustered with Arabidopsis AtACX1 that exhibited activity with medium- to long-chain fatty acyl-CoAs, equally for C10-CoA to C16-CoA but lower with longer-chain substrates (Froman et al. 2000). PpACX2 had sequence homology with AtACX2 that was active on a long-chain substrate, and the activity was increased from C14-CoA to C18-CoA (Hooks, Kellas & Graham 1999). In our study, the short-chain substrate C6-CoA, the medium-chain substrate C10-CoA and the long-chain substrate C16-CoA were used to determine ACX activity. ACX activity with C16-CoA resulted in a positive correlation between the enzyme activity and lactone production, while the enzyme activity with the medium- and short-chain substrates did not change significantly throughout the experiment. Datasets in the PCA model showed that fruit samples with high levels of lactones were characterized by ACX activity and PpACX1 expression, indicating that transcripts of PpACX1 might be responsible for changes in the enzyme activity of ACX with the long-chain substrate during peach fruit ripening at ambient or low temperatures. Our results confirm that ACX has an association with lactones, and suggests a possible role of ACX in formation of peach-like lactones.

β-oxidation is the primary pathway of fatty acid degradation in plants, and it plays an essential role during development, senescence and in response to stresses (Goepfert & Poirier 2007; Castillo & León 2008; Yang & Ohlrogge 2009). Degradation of saturated long-chain fatty acids in peroxisomes has been shown to be involved in formation of flavour molecules such as γ- and δ- lactones that originate from 4- and 5-hydroxyl carboxylic acids (Schwab et al. 2008; Husain 2010). Our previous study showed that the content of saturated palmitic acids (C16:0) tended to decline in melting peach fruit during ripening at ambient temperature (Zhang et al. 2010). Other published work has shown that peach fruit stored at 5 °C had significantly higher contents of palmitic acids than fruit treated with a CI-delaying temperature (0 °C) (Zhang & Tian 2009). We also have unpublished data showing that higher levels of palmitic acid were observed in peach fruit at 5 °C than in those treated with LTC during the shelf life after 21 d of storage. In the present study, it is of interest to note that ACX had higher activity in non-CI fruit during shelf life after removal, indicating that the changes in ACX enzyme activity may reflect levels of palmitic acid. However, if the degradation of saturated fatty acids is involved in production of lactones in peach fruit, then this needs further study.

The present study showed that accumulated lactone production, increased PpACX1 transcripts and enzyme activity accompanied the climacteric rise in ethylene during ripening at ambient temperature and cold storage plus subsequent shelf life. The stony hard peach fruit is characterized by the lack of ethylene production at ripening due to a reduced expression of Pp-ACS1, a member of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family (Tatsuki, Haji & Yamaguchi 2006). Results from stony hard peach fruit showed that treatment with exogenous ethylene induced the synthesis of volatiles that contribute to the fruit aroma, indicating that formation of aroma volatiles may be ethylene-dependent ripening events in peach (Hayama et al. 2006). However, more definitive experiments such as treatment with ethylene, ethylene substrates or inhibitors are required to confirm that ethylene induces ACX gene expression, enzyme activity and formation of lactones.

In conclusion, ripening of melting peach fruit at ambient temperature was characterized by accumulated lactone production after harvest. The fruit treated with a chilling temperature showed loss of peach-like lactones during shelf life after removal, which could be considered as a CI symptom of peach fruit. PpACX1 expression and ACX enzyme activity had a positive correlation with lactone formation in peach fruit during ripening or in response to low-temperature storage. Future work with isolated peach ACX proteins will confirm their relative activities and substrate specificities (Li et al. 2005; Arent et al. 2008).

ACKNOWLEDGMENTS

This work was supported by the National Basic Research Program of China (2011CB100602), the Special Scientific Research Fund of Agricultural Public Welfare Profession of China (200903044), the Program for Key Innovative Research Team of Zhejiang Province (2009R50036) and the Natural Science Foundation of Zhejiang Province (Y113140).

Ancillary

Advertisement