SEARCH

SEARCH BY CITATION

Keywords:

  • potato-late blight;
  • co-dominant markers;
  • population genetics;
  • simple sequence repeats

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Co-dominant microsatellite molecular markers for Phytophthora infestans were developed and their potential for monitoring the genetic variation in populations was demonstrated in the UK, across Europe and worldwide. Markers were developed according to two strategies. First, several thousand P. infestans expressed sequence tag (EST) and bacterial artificial chromosome (BAC) sequences were screened for the presence of simple sequence repeat (SSR) motifs, and, of these, 100 candidate loci were selected for further investigation. Primer pairs developed to these loci were tested against a panel of 10 P. infestans isolates and approximately 10% were shown to be polymorphic and therefore appropriate for further testing. Secondly, the construction and screening of a partial genomic library resulted in the development of one additional polymorphic marker. The resulting 12 SSR markers were converted to higher-throughput fluorescence-based assays and used in combination with two previously published markers to characterize a wider collection of 90 P. infestans isolates from the UK and six other countries. Several isolates from the closely related species P. mirabilis, P. ipomoea and P. phaseoli collected from around the world were also genotyped using these markers. Amongst the 90 isolates of P. infestans examined, considerable SSR diversity was observed, with 68 different genotypes and an average of 3·9 (range 2–9) alleles per locus. When other Phytophthora species were genotyped, all loci were successfully amplified and the majority were polymorphic, indicating their transferability for the potential study of other closely related taxa.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Phytophthora infestans, the cause of late blight of potato and tomato, is a worldwide problem made worse by recent introductions of exotic strains originating in Mexico and disseminated internationally by trade (Smart & Fry, 2001; Shattock, 2002; Cooke et al., 2003). Despite the importance of P. infestans and the fact that much survey work on mating type and fungicide resistance has been carried out, studies of its molecular diversity have been limited by the power of the genetic markers and difficulties in comparing results between laboratories. Work has revealed the presence of both clonal and genetically diverse populations (Knapova & Gisi, 2002; Cooke et al., 2003), but the mechanisms responsible for this diversity have not been studied in detail. To understand the biology and ecology of P. infestans and the mechanisms and tempo of variation in late-blight populations requires fully characterized powerful markers, e.g. microsatellites, also known as simple sequence repeats (SSRs) (Cooke & Lees, 2004).

SSRs are tandemly repeated motifs of one to six bases found in the nuclear genomes of all eukaryotes tested and are often abundant and evenly dispersed (Tautz & Renz, 1984; Lagercrantz et al., 1993). Microsatellite sequences are usually characterized by a high degree of length polymorphism, and are ideal single-locus co-dominant markers for genetical studies. Co-dominance offers a greater resolving power and the data can be used to determine population genetic structure, kinship, reproductive mode and the extent of genetic isolation (Queller et al., 1993; Ashley & Dow, 1994; Schlötterer & Pemberton, 1994; Jarne & Lagoda, 1996). Microsatellites have not, until relatively recently, been used for analysis of plant pathogens (e.g. Kaye et al., 2003; Guérin et al., 2004). SSRs have been characterized for the oomycetes Plasmopara viticola (Gobbin et al., 2003), Phytophthora cinnamomi (Dobrowolski et al., 2002), P. ramorum (Prospero et al., 2004) and polymorphic loci have recently been reported by Knapova & Gisi (2002) for the analysis of P. infestans populations on potato and tomato in France. A review of a range of markers used for the characterization of P. infestans is given by Cooke & Lees (2004).

The aim of the work described here was to design and validate a set of polymorphic SSR markers for genetic analysis of P. infestans and to employ combinations of those markers to assess their potential for assessing genetic variation on a European and global scale. Reliable and rapid molecular marker technology will allow fingerprinting of isolates and their tracking in experimental work, aid population monitoring to investigate short- (field to field) and long-range (country to country) spread of the pathogen and will help to quantify the relative importance of sexual vs. asexual reproduction.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Phytophthora isolates

The panel of P. infestans isolates used for marker development and made available to other researchers to allow comparison of results across laboratories is listed in Table 1. The 90 isolates used for population analysis were obtained from a range of sources: 38 Scottish isolates were collected in 1995–97, and formed a subset of a collection of 500 isolates obtained previously from commercial crops and allotment gardens; these were selected from across three clades defined previously on the basis of scores from 15 AFLP markers. These isolates were previously characterized for mating type, metalaxyl sensitivity, virulence and AFLP as described by Cooke et al. (2003). In addition, 30 isolates from England and Wales and nine from Ireland were obtained from disease outbreaks in 2000 and 2002. Thirteen isolates from other countries – Sweden (five), Bolivia (four), Argentina (one), Ecuador (one), Vietnam (one), USA (one) – and four isolates of P. ipomoeae, five of P. mirabilis, and one isolate of P. phaseoli were also included. P. infestans cultures were obtained by isolation from late-blight lesions on potato leaves onto rye A agar supplemented with pimaricin (10 µg mL−1) and rifamcin (30 µg mL−1) and were then transferred to, and maintained on, unamended rye A medium at 15°C. Isolates were grown in pea broth medium at 20°C for 1 week prior to DNA extraction (Raeder & Broda, 1985).

Table 1.  Isolates of Phytophthora infestans used for simple sequence repeat screening with associated phenotypic data for mating type (A1/A2) and metalaxyl phenotype
CodeIsolateSourceOriginMating typeMetalaxyl phenotypeYear isolated
  • S, sensitive; I, intermediate; R, resistant.

  • a

    SCRI isolates are from Scotland.

  • b

    Isolates obtained from G. A. Forbes, CIP, Lima, Peru.

  • c

    Isolates obtained from W. E. Fry, Cornell University, NY, USA.

C196.17.5.3SCRIaAyrA1I1996
C295.17.3.2SCRIEdinburghA1S1995
C397.38.2.2SCRIDunkeldA1R1997
C496.9.5.1SCRICononsythA1R1996
C596.13.1.3SCRIGlasgowA1R1996
C6US467USAA2R1998
C7EC1CIPbEcuadorA1S1998
C8AG4CornellcArgentinaA2R1997
C995.16.3.1SCRIEdinburghA1S1995
C1097.28.1.2SCRIMeadowbankA2I1997

Microsatellite marker development

Microsatellite markers were developed according to two strategies: using previously published sequences and through the specific construction and screening of a partial genomic library.

First, the sequence data screened for SSR motifs were obtained from three sources: the P. infestans expressed sequence tag (EST) sequences held in the Phytophthora Genome Consortium (PGC) database (Waugh et al., 2000; http://www.ncgr.org/pgc/index.html); randomly selected genomic DNA fragments from a bacterial artificial chromosome (BAC) library constructed at SCRI (Whisson et al., 2001); and other EST sequences (Lam, 2001). The computer program Sputnik (http://espressosoftware.com/pages/sputnik.jsp) was used to identify SSR candidate sequences and 100 of these were selected for further investigation.

Secondly, a partial genomic library was constructed and screened using the approach of Rassmann et al. (1991). In brief, genomic DNA fragments 300–500 bp long (restricted with AluI, HeaIII and RsaI restriction enzymes) were inserted into Bluescript II KS vector (Stratagene) and used to produce a library of 8·3 K colonies. This library was screened with a mixture of 32P-labelled (AC)13 and (CT)13 oligonucleotide microsatellite probes. One hundred and thirty hybridizing (positive) clones (1·57%) were identified and sequenced. Only eight positive clones included at least 10 repeats, and were therefore used for primer design.

SSR primer design and PCR amplification

Primers were designed to the regions flanking the SSRs in each of the 108 sequences selected using the program Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_http://www.cgi) with parameters set for a Tm of 58°C and product sizes ranging from 150 to 250 bp. A panel of 10 P. infestans isolates from Scotland and worldwide was selected (Table 1) and their DNA was amplified with each of the 100 candidate primer sets. A negative (water only) control was included in each assay. PCR amplification of these isolates, using each of the selected primer pairs, was based on a standard set of conditions [initial denaturation at 95°C for 2 min, followed by 30 cycles of 95°C for 20 s, 58°C for 25 s and 72°C for 60 s and a final extension step of 72°C for 5 min, in a reaction volume of 25 µL using an MWG-Biotech Primus 96 Thermal cycler (MWG-Biotech)]. The master mix contained the following components: 1 × reaction buffer (16 mm[NH4]2SO4, 67 mm Tris-HCl pH 8·8, 0·1% Tween-20; Bioline), 200 µm each dNTPs (Bioline), 0·3 µm each primer (MWG-Biotech), 5·0 mm MgCl2, 250 µg mL−1 BSA (Boehringer Mannheim), 1 U Biolase Diamond Taq polymerase (Bioline) and 10–100 ng of template DNA.

PCR products obtained for the 10-isolate panel using the 100 primer pairs were screened by visualization on precast Spreadex™· EL 600 wide mini S-50 gels, in a submerged gel electrophoresis (SEA 2000) unit (Elchrom Scientific AG) according to the manufacturer's instructions. Gels were stained for 45 min with SYBR Gold (10 µL of 10 000× concentrate diluted in 100 mL 10 mm TAE) and de-stained in water for 30 min before photographing under UV light. Candidate SSRs were selected for further analysis on the basis of differences in product size and absence of secondary PCR products.

Sequencing of polymorphic regions

To confirm that the PCR products matched the predicted amplicon size and that inter-isolate product size differences (bp) were due to polymorphisms in the SSR region rather than insertions/deletions in the flanking sequences, all polymorphic PCR products were sequenced. Direct sequencing of PCR products was initiated using the relevant SSR primers in a dye-terminator cycle-sequencing reaction (FS sequencing kit, Applied Biosystems) and run on an ABI377 automated sequencer (Applied Biosystems).

High-throughput SSR assay and multiplexing

For automated analysis, forward primers of the 14 polymorphic markers, including Pi4B (TET) and PiG11 (HEX) (Knapova & Gisi, 2002), (Table 2) were labelled at the 5′ end with one of the fluorescent dyes FAM (6-carboxy-fluorescein), TET (4,7,2′,7′-tetrachloro-6-carboxyfluorescein) or HEX (4,7,2′,4′,5′,7′-hexachloro-6-carboxyfluorescein). PCR reactions were carried out as described previously (Loci Pi02, Pi04, Pi16, Pi33, Pi56, Pi63, Pi66, Pi70, Pi89) but substituting the fluorescently labelled forward primer for the unlabelled primer. Markers Pi4B, PiG11 and D13 were amplified using the conditions described by Knapova & Gisi (2002), using an annealing temperature of 50°C for marker D13. Combinations of three markers of varying size and with different fluorescent dyes were tested in a multiplex reaction to allow higher sample throughput. Multiplex reactions were carried out using Qiagen Multiplex PCR master mix according to the manufacturer's instructions (Qiagen).

Table 2.  Details of simple sequence repeat loci from Phytophthora infestans based on 90 individuals
MarkerSSR primer sequenceAnnealing temperature (°C)Size range (bp)Expected size (bp)RepeatNumber of allelesTransferability to other species
  • a

    Phytophthora Genome Initiative database (Waugh et al., 2000).

  • b

    F, forward primer; R, reverse primer.

  • c

    Bacterial artificial chromosome library (Whisson et al., 2001).

  • d

    Expressed sequence tag (Lam, 2001).

  • e
  • f

    Specific genomic library.

  • g

    1, Phytophthora ipomoea; 2, P. mirabilis; 3, P. phaseoli.

  • h

    Loci with two to four alleles found, only interpretable as multiallelic phenotype.

  • NT, not tested.

Pi02aF:CAGCCTCCGTGCAAGAb R:AAGGTGCGCGAAGACC58142–166154(TG)1181,2,3g
Pi04cF:AGCGGCTTACCGATGG R:CAGCGGCTGTTTCGAC58162–170170(GT)641,2,3
Pi16aF:CACAGCACGCGGAATC R:ACGCCGAGTGTCCTGA58174–178177(GA)731,2,3
Pi26a,hF:GCAGTAGCCGTAGTCCTCAG R:GTTCCAAATCGTCAACCAAC58172172(GT)9NT1,2,3
Pi33aF:TGCCGACGACAAGGAA R:CGGTCTGCTGCTGCTC58203–209203(CAG)531,2,3
Pi56dF:ACAACTATCTATCGGCGTGC R:AGTAGGCTTCACGACCAGC58174–176176(AT)1021,2,3
Pi63dF:ATGACGAAGATGAAAGTGAGG R:ATTCATTATTGGCAATGTTGG58148–160157(GAG)841,2,3
Pi65d,hF:AGGAAGAGGAGGAAGAAGAGG R:TCTTTCGTAACGGTTCTTTCC58145–151145(AAG)931,2,3
Pi66dF:ACCGACAGCTTCTGAAACC R:AAAATAAGAAGAGATTCGTGCC58153–155153(GT)721,2,3
Pi70dF:ATGAAAATACGTCAATGCTCG R:CGTTGGATATTTCTATTTCTTCG58189–195195(AAG)831,2,3
Pi89dF:GAGAACGCACAATGTAAGGC R:ACATAAATACACGCTGAACGG58179–185181(AT)931,2,3
4BeF:AAAATAAAGCCTTTGGTTCA R:GCAAGCGAGGTTTGTAGATT58205–217218(TC)3431,2,3
G11eF:TGCTATTTATCAAGCGTGGG R:TACAATCTGCAGCCGTAAGA56142–166156(TC)2681,2,3
D13fF:TGCCCCCTGCTCACTC R:GCTCGAATTCATTTTACAGA50108–142136(CT)2791,2,3

Genotyping of Phytophthora isolates

The 90 P. infestans and 10 isolates of other Phytophthora species were amplified in a Thermo Fast 96-well nonskirted PCR microplate (AB gene) using each of the primer pairs Pi02, Pi04, Pi16, Pi 26, Pi33, Pi56, Pi63, Pi65, Pi66, Pi70, Pi89, Pi4B, PiG11 and D13, and PCR conditions as described previously. A 3 µL sample, comprising 0·3 µL TAMRA 350 size standard (4 nm), 1 µL 25 µm EDTA with blue dextran (50 mg mL−1), 0·75 µL PCR product and 0·95 µL deionized formamide (99·5%), was denatured at 95°C for 5 min, snap-cooled on ice and loaded into the ABI Prism 377 DNA sequencer and run according to manufacturer's instructions (Applied Biosystems). Peak size and quantitation data generated using Genescan Analysis Software were analysed using Genotyper software for the estimation of allele sizes (both Applied Biosystems).

Marker analysis

The 90 P. infestans isolates from the UK and Ireland were grouped into three populations according to geographic origin (England & Wales, Scotland and Ireland). Isolates from other parts of the world were grouped together as a fourth population and isolates from other species were grouped as a fifth. Genotypes were assigned by combining the allelic compositions across 12 loci. Results with markers Pi26 and Pi65 were omitted from the analysis. The total possible number of genotypes generated at each locus and the expected frequencies of the most common and rarest genotypes at the locus were estimated according to allele number and frequency. The likelihood of finding identical, independently generated, multilocus genotypes (nonclonal) when using all 12 loci was estimated for each locus. Gene diversity was estimated according to Nei (1973) and was performed in Popgen (http://cc.oulu.fi/~jaspi/popgen/popgen.htm), and genotype diversity was estimated with a standardized Shannon index as described by Goodwin (1997).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Development of SSR markers

Analysis of the DNA sequences from the sources listed above yielded several thousand sequences containing microsatellite repeats. After a preliminary screening on the basis of sequence quality and the position of the SSR repeat being sufficiently distant from the end of the sequence to allow the design of primers, 100 candidate sequences representing different classes and lengths of primarily di- or trinucleotide repeats were selected. In parallel, the construction and screening of a partial genomic library yielded 140 positive clones, but sequencing revealed only eight clones containing microsatellites with more than 10 repeats.

Subsequent PCR amplification of the P. infestans panel of 10 isolates with each of the 108 primer pairs described above resulted in the selection of 12 pairs that yielded a single clear PCR product and revealed polymorphisms amongst the isolates. An example of the polymorphisms seen with the Pi56 marker set is given in Fig. 1, a summary of the properties of the 12 loci and the two existing loci is given in Table 2 and, for reference, the alleles recorded for each of the 10 isolates amplified with each of the markers are given in Table 3.

image

Figure 1. Amplification of DNA from 10 isolates of Phytophthora infestans (C1–C10, see Table 1) using marker Pi56. –VE, no DNA control; M, M3 marker (Elchrom Scientific).

Download figure to PowerPoint

Table 3.  Observed allele sizes (bp) for each control isolate of Phytophthora infestans (C1–C10) amplified with each of the 14 SSR markers
IsolateAllele sizes (bp)
Marker
Pi02Pi04Pi16Pi26Pi33Pi56Pi63Pi65Pi66Pi70Pi894BG11D13
C1152166176177203176148148153192179217162136
162170178179203176151151155195181217162136
   185   157      
C2162166176179203176151145153192179205162118
164170178181206176157151153192181217162136
   183          
   187          
C3162166176179203176151145153192179205162118
162170178181203176157151155192181217162136
   183          
   187          
C4162166176177203176157145155192179205156136
162170178181203176157145155192181217162136
C5162166176177203176157145155192179205156136
162170178181203176157145155192181217162136
C6160166174171203176157142155192179213156108
162170178183203176157145155192181225156112
       151      
C7162166178177203174157145155192179205158136
162170178181203176157145155192181213160136
   183       215  
   187          
C8162170176177203174148145155192179205160136
162170178179206176157145155192179213160136
C9162166176179203176151145155192179205162118
162170178183206176157145155192181213162136
   187          
C10162168178177203176157145155192179205162136
162168178177203176157145155192179213162136

Analysis of the sequences of the polymorphic PCR products of markers Pi02, Pi04, Pi16, Pi33, Pi56, Pi63, Pi65, Pi66, Pi70, Pi89 confirmed the fragment identity and that the polymorphisms were due to SSR repeat number variation in each case. In a limited number of cases, more than two alleles were consistently identified. Primer set Pi26 (Table 2) generated three to four bands and was therefore not considered suitable for use in population genetic analysis and was not analysed further. Similarly, marker Pi65 generated three bands in some cases and was therefore not included in the final analysis. However, information relating to these markers is included, as multiallelic phenotypes can be useful for isolate tracking studies. In addition, it should be noted that markers Pi63 and 4B generated three bands when used to amplify one of the control isolates (Table 3), but these occurrences were found to be rare in the 90 P. infestans isolates tested, and these markers were therefore included in the analysis.

Reproducibility of results was demonstrated on approximately 50 occasions (data not shown) by amplification of DNA from control isolates belonging to the groups C1–C10 (Table 1), using the SSR markers developed, resulting in products of the expected size range. In addition, these control isolates were sent to four European laboratories for testing and the results were comparable.

Genotyping of Phytophthora isolates

Ninety isolates of P. infestans and 10 isolates of other Phytophthora species with a full data set (results from all 12 markers tested) were analysed. When the data were analysed using multilocus genotype tests, 68 genotypes were identified from the 90 P. infestans isolates. Novel alleles were found amongst isolates of the other related Phytophthora species and none of these isolates had genotypes common with P. infestans. As expected, the resolving power of the genotyping increased with marker number: maximum resolution was achieved with 10 loci and the use of more than 11 did not reveal additional genotypes. The relationship between the number of markers used and the number of genotypes identified is given in Fig. 2. The number of possible allelic combinations detected at each locus ranged from three to 45 for P. infestans isolates (Table 4), with the total possible number of genotypes being 9·18 × 1010 when all 12 loci were considered together. The upper and lower probabilities of finding an identical, nonclonal, multilocus genotype in P. infestans were 1·59 × 10−4 and 8·0 × 10−35, respectively. The most common genotype of P. infestans was found six times (once in England in 1999 and five times in Scotland, once in 1995 and four times in 1997). However, three of the Scottish 1997 isolates with this genotype were obtained from the same disease outbreak. Two genotypes were found on five occasions, the first only in England from diverse sites in 1999 (four isolates) and 2002 (one isolate) and the second only in Ireland in isolates taken from diverse sites in 1995 (one), 1996 (two) and 2002 (two).

image

Figure 2. The relationship between number of simple sequence repeat markers used (see Table 2) and ability to distinguish genotypes of Phytophthora infestans based on an analysis of 90 isolates.

Download figure to PowerPoint

Table 4.  Number of alleles observed (NA), number of potential genotypes and expected frequencies of most common and rarest genotypes for each simple sequence repeat locus in Phytophthora infestans, based on a set of 90 isolates
SSR locusNANo. of potential genotypesExpected frequency of most common genotypeExpected frequency of rarest genotype
Pi024100·720·0025
Pi044100·390·0004
Pi163 60·480·0025
Pi333 60·690·0004
G119450·250·000025
D136210·640·000025
4B4100·410·2401
Pi562 30·560·0841
Pi662 30·360·0004
Pi892 30·500·0001
Pi634100·420·0036
Pi704100·610·0441

Gene diversity as calculated by Nei (1973), and averaged across the 12 loci ranged from 0·38 in the Irish isolates (Table 5) to 0·56 in isolates of other species. The average diversity in isolates from England and Wales (0·46) was the same as that found in isolates from across the world.

Table 5.  Genetic variation of Phytophthora infestans isolates estimated with 12 simple sequence repeat loci
LocusEngland/Wales (n= 30)Ireland (n = 9)Scotland (n = 38)World isolates (n = 13)
NAGene diversityNAGene diversityNAGene diversityNAGene diversity
  1. NA, number of alleles observed for each marker.

Pi0220·4020·2030·0830·36
Pi0440·6120·5040·6040·54
Pi1620·5120·5020·5030·58
Pi3330·2820·4420·1720·38
Pi5620·4010·0020·3320·40
PI6340·5930·5140·5130·49
Pi6620·4920·3520·4420·50
Pi7020·4420·2820·3540·34
Pi8920·3520·4920·4620·26
G1170·7530·2950·6170·78
D1320·3520·4820·2450·35
4B30·3920·5030·3640·54
Mean2·90·462·10·382·80·393·40·46

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Information regarding the current P. infestans population and its evolutionary potential, in terms of increased threats from a rapidly changing population, is useful for informing late blight disease-control strategies. As commented upon by Cooke & Lees (2004), this means that a greater emphasis must be put on studies of P. infestans biology. These studies should include improvements in our understanding of the relative contributions and rates of mutation, recombination, natural selection, gene flow, random genetic drift and migration (Burdon & Silk, 1997) to the generation and maintenance of variation in populations (relative importance of asexual vs. sexual reproduction). Suitable genetic markers are therefore needed to facilitate such work.

Previously, genotyping of P. infestans has largely been carried out using dominant markers. These are generally characterized by the presence or absence of a specific band on a gel and do not allow discrimination between the homozygous dominant or heterozygous state of a particular locus. Furthermore, it is not clear whether the absence of a band (i.e. a null allele) is always due to the same mutation. However, the development of co-dominant markers allows the discrimination of homozygotes and heterozygotes, since a single allele at a particular locus is amplified in homozygotes, whereas in heterozygotes both alleles are clearly resolved (Duncan et al., 1998). Such discriminatory power makes co-dominant markers useful for studying gene flow within populations (Powell et al., 1996), as well as linkage analysis (Meksem et al., 1995) and mapping studies of specific traits (Raeder et al., 1989).

Several co-dominant markers have been used to examine P. infestans in the past, but have shown certain limitations. Isozymes are co-dominant (Tooley et al., 1985) but there are problems with throughput, band nomination and level of polymorphism (Elansky et al., 2001). Single-locus RFLPs are co-dominant and have been used in linkage studies (Carter et al., 1999), whilst the moderately repetitive multilocus RFLP probe RG57 (Goodwin et al., 1992a) has been useful in investigating genetic diversity of P. infestans populations with varying success (Goodwin et al., 1992b; Forbes et al., 1998; Purvis et al., 2001; Cooke et al., 2003; Day et al., 2004). AFLPs have been scored as co-dominant, but scoring relies on band intensities and is challenging and therefore unreliable. However, they have been used in various studies such as mapping (van der Lee et al., 2001a) and diversity (Purvis et al., 2001; Cooke et al., 2003). These molecular techniques, however, require large quantities of DNA, and often the use of radioactivity (Rosendahl & Taylor, 1997), and can be laborious.

Knapova & Gisi (2002) developed three polymorphic SSR markers with which to analyse P. infestans isolates originating from potato and tomato in France and Switzerland. Their work showed that at two loci (including locus Pi4B also used in this study), a total of 10 different alleles were observed in field populations of P. infestans. They suggested that sexual recombination and selection rather than long-distance migrations may explain this diversity. These authors found no strong associations between SSR genotype, AFLP pattern, mating type or metalaxyl. As Knapova & Gisi (2002) recorded null alleles with one SSR locus, and some markers show limited allele diversity, it was necessary to expand the existing marker set to allow a more comprehensive analysis of P. infestans populations and isolate collections on a European or wider intercontinental scale. In this study, EST and BAC sequences were exploited for the successful development of an additional 11 SSR markers, the construction and screening of a genomic library yielded an additional marker, and these were used in conjunction with two of the existing markers developed by Knapova & Gisi (2002), bringing the total to 14 markers. The number of markers required for population analysis can vary according to pathogen diversity and the number of alleles per locus. For example, Atallah et al. (2004) reported the use of 25 SSR markers for studying the pathogen Sclerotinia sclerotiorum, Guérin et al. (2004) used 21 markers to examine diversity within Venturia inaequalis, whilst Gobbin et al. (2003, 2005) reported the use of four or five SSR markers as being sufficient for the analysis of populations of the oomycete Plasmopara viticola.

Previous work (Knapova & Gisi, 2002) described the identification of 28 genotypes amongst 176 isolates of P. infestans isolated in 1996 and 1997. In this study, 68 genotypes of P. infestans were detected from 90 isolates, and confirmed that the panel of SSR markers developed was sufficient for discrimination within UK populations and those on a wider geographic scale. Marker Pi26 consistently amplified more than two alleles and was not considered suitable for population analysis (similarly with marker Pi65). Information regarding these markers was included as it has proved useful in isolate tracking studies (data not shown). In addition, for some isolates, three alleles were amplified at other loci (e.g. Pi63, 4B). These occurrences were rare, and for analysis purposes the genotype was recorded as that occurring most frequently amongst other isolates. This may result in a slight underestimation of diversity in the population, but is unlikely to have a large effect where all markers are used in combination. The presence of one or three alleles at a locus has been previously reported in P. infestans (van der Lee et al., 2001b) and P. cinnamomi (Dobrowolski et al., 2002), and van der Lee et al. (2004) demonstrated the presence of trisomic linkage groups in 10–16% of progeny from two individual crosses of P. infestans. These authors suggest that, as these trisomic progeny were pathogenic on potato, trisomy in P. infestans can occur in nature. It is therefore speculated that trisomy could account for the presence of three alleles at some of the loci reported here.

The markers also amplified fragments from closely related Phytophthora species, thus demonstrating transferability, although these were not examined further. Fragment length variation in other species may not only relate to sequence changes in the SSR region itself, and will therefore need to be validated by sequencing. However, the fact that the amplified fragment sizes were broadly similar to those of P. infestans, and that intraspecific size variation was demonstrated in P. phaeseoli and P. mirabilis, suggests that the amplified regions also contained polymorphic SSRs. Further work (unpublished data) has also shown that diversity is increased when isolates from a range of other European collections of P. infestans are included in the analysis. This enhanced marker set will therefore form the basis of a pan-European analysis of P. infestans under the auspices of the EU concerted action project ‘EUCABLIGHT’ (http://www.eucablight.org) in which phenotypic and genotypic information relating to over 12 000 isolates of P. infestans has been collated to date. As additional alleles are described by groups across Europe or worldwide, they will be reported to the authors and this information will become publicly available on the project website. In addition, protocols for the use of these markers and their development for use in capillary (ABI3730) systems will shortly become available. For improved throughput and for genotypic testing of large numbers of lesions occurring during an epidemic, DNA from foliar lesions has been stored successfully on FTA cards (Whatman). Recovery and genotyping at a later date without the need for fungal isolation has proved effective (data not shown).

In addition to allowing studies of populations of P. infestans on a large scale for the first time, these markers have proved useful in epidemiological studies where isolates with distinct genotypes can be monitored throughout the growth of a crop, and the effects of management practices, such as host resistance and chemical control, on the predominance of isolates throughout an epidemic can be studied.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was funded by the Scottish Executive Environment and Rural Affairs Department (SEERAD). EUCABLIGHT is a concerted action project funded by the European Union (project QLRT-2001-00971). The authors thank Dr Steven Whisson for supply of BAC sequences, Dr Linda Milne for in silico SSR discovery and Dr Jiasui Zhan for help with data analysis (all SCRI). Thanks are also due to numerous colleagues, in particular Dr Louise Cooke (Queen's University, Belfast) and Dr Wilbert Flier (PRI, Wageningen) for provision of isolates.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Ashley MV, Dow BD, 1994. The use of microsatellite analysis in population biology: background, methods, and potential applications. In: SherwaterB, StreitB, WagnerGP, DeSalleR, eds. Molecular Ecology and Evolution: Approaches and Applications. Basel, Switzerland: Birkhauser, 185201.
  • Atallah ZK, Larget B, Chen X, Johnson DA, 2004. High genetic diversity, phenotypic uniformity, and evidence of outcrossing in Sclerotinia sclerotiorum in the Columbia basin of Washington state. Phytopathology 94, 73742.
  • Burdon JJ, Silk J, 1997. Sources and patterns of diversity in plant pathogenic fungi. Phytopathology 87, 6649.
  • Carter DA, Buck KW, Archer SA, Van Der Lee T, Shattock RC, Shaw DS, 1999. The detection of nonhybrid, trisomic, and triploid offspring in sexual progeny of a mating of Phytophthora infestans. Fungal Genetics and Biology 26, 198208.
  • Cooke DEL, Lees AK, 2004. Markers, old and new, for examining Phytophthora infestans diversity. Plant Pathology 53, 692704.
  • Cooke DEL, Young V, Birch PRJ, Toth R, Gourlay F, Day JP, Carnegie S, Duncan JM, 2003. Phenotypic and genotypic diversity of Phytophthora infestans populations in Scotland (1995–97). Plant Pathology 52, 18192.
  • Day JP, Wattier RAM, Shaw DS, Shattock RC, 2004. Phenotypic and genotypic diversity in Phytophthora infestans on potato in Great Britain, 1995–98. Plant Pathology 53, 30315.
  • Dobrowolski MP, Tommerup IC, Blakeman HD, O’Brien PA, 2002. Non-Mendelian inheritance revealed in a genetic analysis of sexual progeny of Phytophthora cinnamomi with microsatellite markers. Fungal Genetics and Biology 35, 197212.
  • Duncan JM, Cooke DEL, Birch P, Toth R, 1998. Molecular variability in sexually reproducing fungal pathogens. In: BridgeP, CouteaudierY, ClarksonJ, eds. Molecular Variability of Fungal Pathogens. Wallingford, UK: CAB International, 1939.
  • Elansky S, Simronov A, Dyakov Y, Dolgova A, Filippov A, Kozlovsky B, Kozlovskaya I, Russo P, Smart C, Fry WE, 2001. Genotypic analysis of Russian isolates of Phytophthora infestans from the Moscow region, Siberia and the Far East. Journal of Phytopathology 149, 60511.
  • Forbes GA, Goodwin SB, Drenth A, Oyarzun P, Ordoñez ME, Fry WE, 1998. A global marker database for Phytophthora infestans. Plant Disease 82, 8118.
  • Gobbin D, Jermini M, Loskill B, Pertot I, Raynal M, Gessler C, 2005. Importance of secondary inoculum of Plasmopara viticola to epidemics of grapevine downy mildew. Plant Pathology 54, 52234.
  • Gobbin D, Pertot I, Gessler C, 2003. Identification of microsatellite markers for Plasmopara viticola and establishment of high throughput method for SSR analysis. European Journal of Plant Pathology 109, 15364.
  • Goodwin SB, 1997. The population genetics of Phytophthora. Phytopathology 87, 46273.
  • Goodwin SB, Drenth A, Fry WE, 1992a. Cloning and genetic analyses of two highly polymorphic, moderately repetitive nuclear DNAs from Phytophthora infestans. Current Genetics 22, 10715.
  • Goodwin SB, Spielman LJ, Matuszak JM, Bergerson SN, Fry WE, 1992b. Clonal diversity and genetic differentiation of Phytophthora infestans populations in Northern and Central Mexico. Phytopathology 82, 95561.
  • Guérin F, Franck P, Loiseau A, Devaux M, Le Cam B, 2004. Isolation of 21 new polymorphic microsatellite loci in the phytopathogenic fungus Venturia inaequalis. Molecular Ecology Notes 4, 26870.
  • Jarne P, Lagoda PJL, 1996. Microsatellites, from molecules to populations and back. Trends in Ecology and Evolution 10, 4249.
  • Kaye C, Milazzo J, Rozenfeld S, Lebrun M, Tharreau D, 2003. The development of simple sequence repeat markers for Magnaporthe grisea and their integration into an established genetic linkage map. Fungal Genetics and Biology 40, 20714.
  • Knapova G, Gisi U, 2002. Phenotypic and genotypic structure of Phytophthora infestans populations on potato and tomato in France and Switzerland. Plant Pathology 51, 64153.
  • Lagercrantz U, Ellegren H, Andersson L, 1993. The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Research 21, 11115.
  • Lam ST, 2001. Phytophthora genomics consortium. Phytopathology 91(Suppl.), S158.
  • Van Der Lee T, Testa A, Robold A, Van‘T Klooster JW, Govers F, 2004. High-density genetic linkage maps of Phytophthora infestans reveal trisomic progeny and chromosomal rearrangements. Genetics 167, 164361.
  • Van Der Lee T, Robold A, Van′T Klooster JW, Govers F, 2001a. Mapping of avirulence genes in Phytophthora infestans with amplified fragment length polymorphism markers selected by bulked segregant analysis. Genetics 157, 94956.
  • Van Der Lee T, Testa A, Van‘T Klooster JW, Van Den Berg-Velthuis G, Govers F, 2001b. Chromosomal deletion in isolates of Phytophthora infestans correlates with virulence on R3, R10 and R11 potato lines. Molecular Plant–Microbe Interactions 14, 144452.
  • Meksem K, Leister D, Peleman J, Zabeau M, Salamini F, Gebhardt C, 1995. A high resolution map of the vicinity of the R1 locus on chromosome V of potato based on RFLP and AFLP markers. Molecular and General Genetics 249, 7481.
  • Nei M, 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences, USA 70, 33213.
  • Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S, Rafalski A, 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2, 22538.
  • Prospero S, Black JA, Winton LM, 2004. Isolation and characterization of microsatellite markers in Phytophthora ramorum, the causal agent of sudden oak death. Molecular Ecology Notes 4, 6724.
  • Purvis AL, Pipe ND, Day JP, Shattock RC, Shaw DS, Assinder SJ, 2001. AFLP and RFLP (RG57) fingerprints can give conflicting evidence about the relatedness of isolates of Phytophthora infestans. Mycological Research 105, 132130.
  • Queller DC, Strassman JE, Hughes CR, 1993. Microsatellites and kinship. Trends in Ecology and Evolution 8, 285.
  • Raeder UA, Broda P, 1985. Rapid preparation of DNA from filamentous fungi. Letters in Applied Microbiology 1, 1720.
  • Raeder U, Thompson W, Broda P, 1989. RFLP-based map of Phanerochaete chrysosporium ME446: lignin peroxidase genes occur in clusters. Molecular Microbiology 1, 1720.
  • Rassmann K, Schlötterer C, Tautz D, 1991. Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting. Electrophoresis 12, 1138.
  • Rosendahl S, Taylor JW, 1997. Development of multiple genetic markers for studies of genetic variation in arbuscular mycorrhizal fungi using AFLP. Molecular Ecology 6, 8219.
  • Schlötterer C, Pemberton J, 1994. The use of microsatellites for genetic analysis of natural populations. In: SchierwaterB, StreitB, WagnerGP, DeSalleR, eds. Molecular Ecology and Evolution: Approaches and Applications. Basel, Switzerland: Birkhäuser-Verlag, 20313.
  • Shattock RC, 2002. Phytophthora infestans: populations, pathogenicity and phenylamides. Pest Management Science 58, 94450.
  • Smart CD, Fry WE, 2001. Invasions by the late blight pathogen: renewed sex and enhanced fitness. Biological Invasions 3, 23543.
  • Tautz D, Renz M, 1984. Simple sequence repeats are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acid Research 12, 412738.
  • Tooley PW, Fry WE, Villarreal Gonzalez MJ, 1985. Isozyme characterization of sexual and asexual Phytophthora infestans populations. Journal of Heredity 76, 4315.
  • Waugh M, Hraber P, Weller J, Wu Y, Chen G, Inman J, Kiphart D, Sobral B, 2000. The Phytophthora Genome Inititative database: informatics and analysis for distributed pathogenomic research. Nucleic Acids Research 28, 8790.
  • Whisson SC, Van Der Lee T, Bryan GJ, Waugh R, Govers F, Birch PRJ, 2001. Physical mapping across an avirulence locus of Phytophthora infestans using a highly representative, large-insert bacterial artificial chromosome library. Molecular Genetics and Genomics 266, 28995.