SEARCH

SEARCH BY CITATION

Keywords:

  • Brassicaceae;
  • clubroot pathogenesis;
  • differential gene expression;
  • root and hypocotyl galls

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The expression of 12 cDNAs from Plasmodiophora brassicae, among them two novel sequences, was determined during clubroot development on Arabidopsis thaliana. The aim was to find cDNAs expressed at distinct stages of pathogenesis. The relative amount of infection with active plasmodia could be estimated using PbActin cDNA as an internal standard. Two cDNAs, PbBrip9 and PbCC249, were strongly expressed at stages of disease development corresponding to the occurrence of sporulating plasmodia. Therefore, it should be possible in the future to find more cDNAs which could be used as markers for certain stages of clubroot development.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The clubroot disease of the Brassicaceae, caused by the obligate biotroph Plasmodiophora brassicae, is one of the most damaging diseases within this plant family and its partial control is possible with integrated methods (Donald et al., 2006). Despite their agricultural importance, the plasmodiophorids remain poorly understood, especially at the molecular level. Recent advances in understanding the biology of the organism could lead to improvement in cultural control methods in the near future. The growth of clubroot-infected plants is normally stunted compared to that of healthy plants and the root system of affected plants shows typical gall formation. The developing clubs form a strong metabolic sink on the host (for recent review see Ludwig-Müller & Schuller, 2008). It was shown that plant hormones, i.e. auxins and cytokinins, are involved in the development of root galls (Dekhuijzen & Overeem, 1971; Grsic-Rausch et al., 2000; Devos et al., 2005; Siemens et al., 2006). The life cycle of the obligate pathogen consists of two phases: the primary phase which is restricted to root hairs of the infected plant, and the secondary phase which occurs in the cortex and stele of the hypocotyl and roots (Ingram & Tommerup, 1972). During this secondary phase, plasmodia are developing, which later sporulate and form resting spores (Ludwig-Müller et al., 1999; Kobelt et al., 2000). Since virulent P. brassicae has never been cultivated outside of a host (Arnold et al., 1996), studies regarding the biology, genome and gene expression of the pathogen are hampered.

While field isolates are a heterogeneous mixture of different pathotypes, selective propagation on resistant host plants or inoculation with single spores can lead to selected and defined P. brassicae isolates (Jones et al., 1982; Fähling et al., 2003). Pathogenicity of P. brassicae has been tested using the European Differential Clubroot set, including different hosts, which to date have been standard in defining pathotypes (Jones et al., 1982; Toxopeus et al., 1986). Molecular approaches could help to understand variations in the physiological race of P. brassicae when the pathogen was isolated from differing parts of an infected root or from different roots (Toxopeus et al., 1986).

In earlier studies single genes of the pathogen were analysed. Ito et al. (1999) discovered a gene that was exclusively expressed in a susceptible interaction in clubroot tissue where P. brassicae was shown to be at a vegetative growth stage. A different strategy to isolate pathogen-derived genes was a targeted approach to identifiy sequences with known function that could be involved in pathogenesis. Brodmann et al. (2002) isolated a trehalose-phosphate synthase (PbTPS) gene from clubbed roots (trehalose is produced in clubbed roots) which was shown to be of pathogen origin. This gene was exclusively expressed in clubbed roots during disease development, and possibly also involved in trehalose accumulation within the resting spores of the pathogen, since it was shown that these spores also contained trehalose (Brodmann et al., 2002). The protein-coding sequences of actin and ubiquitin genes of P. brassicae were described (Archibald & Keeling, 2004). Recently, Bulman et al. (2006) isolated more than 70 full-length cDNA clones of the pathogen. Using a subset of these genes and the corresponding genomic sequences Bulman et al. (2007) characterized the intron and exon structure, as well as the transcription start site of these genes.

Arabidopsis thaliana is a host of P. brassicae and the small size of the roots facilitates the observation of disease development. Furthermore, the development of a gall in A. thaliana was well documented by Kobelt (2000), Kobelt et al. (2000) and Siemens et al. (2002). In this study, the expression of several P. brassicae genes over the time course of the host-pathogen interaction in A. thaliana was analysed in order to find molecular markers for the actively growing pathogen and also for distinct developmental stages of P. brassicae.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Plant material

Ecotypes Columbia (Col-0) and Cape Verde Island (Cvi-0) of A. thaliana were originally provided by the Arabidopsis Seed Stock Centre (NASC, Nottingham, UK). Brassica rapa cv. Granaat (ECD05) plants were used for propagation of the P. brassicae isolate.

Pathogen material

Plasmodiophora brassicae isolates e3 and e6 are single-spore isolates described by Fähling et al. (2003, 2004) and Graf et al. (2004). Clubroot galls were stored at –20°C until required. Resting spores were extracted by homogenizing mature clubroot galls of Chinese cabbage, followed by filtering through gauze (25-µm pore width) and two centrifugation steps (2500 g, 10 min). For propagation of P. brassicae isolate, B. rapa cv. Granaat (ECD05) plants were inoculated with 4 mL spore suspension (107 spores mL−1) 4 days after sowing and cultivated for 8 weeks in a greenhouse.

Inoculation and cultivation of plants

Fourteen-day-old A. thaliana plants cultivated under a controlled environment (21°C, 16 h light, 100 µmol photons s−1 m−2) were routinely inoculated by injecting the soil around each plant with 2 mL of a resting spore suspension of the pathogen (isolate e3) at a standard concentration of 106 spores mL−1 according to Siemens et al. (2002). Control treatments were inoculated with 2 mL water. For all experiments ecotype Cvi-0 was inoculated as the susceptible control and only tests where Cvi-0 was scored with an infection rate of 100% and a disease index above 90 were considered for analysis. Roots of control and infected plants of A. thaliana were harvested for RT-PCR analysis 7, 14, 21 and 28 days post-inoculation (d.p.i.). The interaction between A. thaliana ecotype Col-0 and single-spore isolate e3 was studied in three replicates using a minimum of 80 control and infected plants for each time point of analysis.

RT-PCR

A total-RNA extract was prepared using the RNeasy kit (Qiagen). Control or infected root material (100 mg fresh weight) from A. thaliana was harvested, washed thoroughly, dried between filter paper and homogenized in extraction buffer according to the manufacturer's instructions. To minimize contamination with genomic DNA, RNA was digested with RNase-free DNase (1 U µL−1) (Stratagene). First-strand cDNA was prepared from total RNA using M-MLV reverse transcriptase (Invitrogen). Amplification of partial P. brassicae cDNA and genomic fragments by PCR was performed using the primers listed in Table 1 and the following standard PCR protocol: initial denaturation at 95°C for 5 min; followed by 32 cycles of denaturation at 95°C for 60 s, annealing at 62°C for 40 s, elongation at 72°C for 60 s; and final elongation at 72°C for 5 min. The same programme was used for the amplification of all genes, but the specific annealing temperature for each gene-specific primer pair is given in Table 1.

Table 1.  Primer pairs and corresponding annealing temperatures used for analysis of gene expression during clubroot development. Sequences are perfect-match primers to Plasmodiophora brassicae or Arabidopsis thaliana gene sequences
Gene nameAccession no.Forward primer and reverse primerHomology toAnnealing temperature
AtHistoneAt5g54640CGGGGAAAGGTGCTAAAGGTT AAATGCCTCGGCGAGATACGTHistone 2a of A. thaliana58°C
PbActinAY452179AGCTGGCGTACGTGGCGCAG CCTTGACGCGCATCGACGACPb Actin262°C
PbBrip9EU345432AATGACGTCCACTCACACCA CAGGATGAGCAGCATGACAG53°C
PbYPTEU345433TTCTTCATCGAGACGAGTGC CTCAACGGCATCATTCGGTA’yptC6 of Chlamydomonas reinhardtii53°C
PbCC240AM180193CAAGACCAAGTCGGTCATCA TTTTCGAATGCAAGCAACTGS17 ribosomal gene53°C
PbCC243AJ605576CCGGGCAGGTACTAAGATGT GGTACGCGGGGTATATTTAATG58°C
PbCC249AF539801TACGCAGGAGTAGGGGACTC GTTGATGAGGTCGCCATTGT57°C
PbCRA-AAM180226GACTCCTCCCAAAGCCAGGT TCCGCGTACAGCATCTTGCHeat shock protein60°C
PbCRA-BAM180227CCAAGTAACGACCTACGCAGC CGGGCGTGTCGATGTAGAGHeat shock protein60°C
PbCRA-CAM180228CTGCATTGCTTGAGTTAACATGG CAGCTCCAGCGTTGACACAC60°C
PbGSTAM180232CCGTCGAACATCAAGATCAC GGAACGAAGTCTGGAACGTCGlutathione S-transferase60°C
PbPSAAM180246CTGTGGAATGCTCTTGGTGA AAAGGTATCGCGTTCACGTCPuromycin-sensitive aminopeptidase63°C
PbTPSAF334707AGATCGGGTTCTTCCTGCACACGCC CGCCATTCGGTGGGTTGTCCATACCTrehalose-6-phosphate synthase60°C

The P. brassicae sequences analysed were taken from Graf et al. (2004) (PbCC240, PbCC243 and PbCC249), Bulman et al. (2006) (PbCRA-A, PbCRA-B, PbCRA-C, PbGST and PbPSA), Brodmann et al. (2002) (PbTPS), Archibald & Keeling (2004) (PbActin), or were isolated by two different approaches: PCR with random primers (Mühlenberg et al., 2002) (PbYPT) and a subtractive cDNA library from control and infected B. rapa roots 28 d.p.i. (In & Ludwig-Müller, unpublished data) (PbBrip9).

Preparation of genomic DNA and Southern blot analysis

Extraction of genomic DNA from plant material was performed according to Fähling et al. (2003). Genomic DNA was digested with EcoRV and BamHI and separated on a 0·8% agarose gel. Plasmodiophora-specific repetitive fragments H4 (GenBank number AF296444), and E7 (AF537105) and the cDNA-fragment PbBrip9 (GenBank EU 345432) were used as probes according to Fähling et al. (2003). The repetitive fragments were selected from a partial genomic library of P. brassicae and localized on 14 and five chromosomal bands, respectively (Graf et al., 2001; Klewer et al., 2001). Detection was performed using digoxigenin-labelled probe prepared with the DIG-system using the Random Primed Oligolabeling kit and the DIG-detection kit (Roche Diagnostics) according to the manufacturer's instructions. For re-probing the blots were washed twice for 5 min in 2 × SSC (1 × 150 mm NaCl, 15 mm sodium citrate, pH 7·0) and 0·1% SDS at room temperature, and twice for 15 min in 0·1 × SSC and 0·1% SDS at 68°C.

CHEF electrophoresis

Gene fragments of P. brassicae were located on chromosomes of P. brassicae using contour-clamped homogeneous electric field (CHEF) gel electrophoresis and subsequent blotting according to Graf et al. (2001). Detection and re-probing of blots were performed as described above for Southern hybridization using PbBrip9 and the repetitive fragment H4 (Graf et al., 2001) from P. brassicae as probes.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Under controlled environmental conditions A. thaliana ecotype Col-0 infected by P. brassicae single-spore isolate e3 developed root and hypocotyl galls in sequential periods of time (Siemens et al., 2002, 2006). In this investigation four time points (7, 14, 21 and 28 d.p.i.) were chosen to study the expression of pathogen genes in order to find markers for clubroot development and/or defined stages of the pathogen, such as young and vegetative secondary plasmodia, or sporulating plasmodia. In this specific interaction between ecotype Col-0 and single-spore isolate e3 the analysed time points covered the whole life cycle of the pathogen after secondary infection. There might have been a small overlap with primary infection, because primary plasmodia in the root hairs could be observed in the first week after inoculation (up to 7 d.p.i.). Young secondary plasmodia in the root cortex were detected at 7 d.p.i. using immunostaining (Kobelt, 2000) and at 9 d.p.i. by DAPI staining (Fig. 1c). Accompanied by a reduction of fine roots the first gall symptoms become macroscopically visible around 14 d.p.i., and large vegetative (secondary) plasmodia had colonized the root cortex (Fig. 1b), whereas the first mature spores in a gall were detectable after 3 weeks, which could therefore be considered the onset of sporulating plasmodia (Fig. 1d,h). Four weeks after infection most cells within a gall of A. thaliana ecotype Col-0 infected with single spore isolate e3 were filled with sporulating plasmodia or resting spores. Only a minor part of the gall at 28 d.p.i. was still heavily infected by vegetative plasmodia (Fig. 1e,f). Conventionally, galls of P. brassicae are described as cataplastic (Karling, 1968), but in roots of A. thaliana ecotype Col-0 infected with single-spore isolate e3 gradients could be observed in the distribution of vegetative and sporulating plasmodia; vertically from the basal part of the root to the hypocotyl and horizontally from the epidermis to the central cylinder the number of vegetative plasmodia increased. Consequently young and vegetative secondary plasmodia were predominant in the first 2 weeks after inoculation, but later all developmental stages of the pathogen could be found with a constantly increasing amount of sporulating plasmodia (Fig. 1e). Furthermore, separation of distinct developmental stages of the pathogen simply by cutting the gall appeared impossible, especially with the small roots of the host A. thaliana.

image

Figure 1. (a–h) Cross-sections of Arabidopsis thaliana ecotype Col-0 roots stained with DAPI. (a) Control roots 28 days post-germination. (b–h) Roots infected with Plasmodiophora brassicae (b) 14 days post-inoculation (d.p.i.); (c) 9 d.p.i., young plasmodia in epidermal cell marked by stars; (d) 21 d.p.i.; (e) 28 d.p.i.; (f) vegetative plasmodia surrounding a host nucleus in hypertrophic cell at 14 d.p.i.; (g) black holes indicating starch granules, old vegetative plasmodia and spore-forming plasmodia in hypertrophic cells at 21 d.p.i.; (h) mature plasmodia filled with spores. (i) Corresponding roots at 14, 21 and 28 d.p.i. Bars 100 µm (a, b, d, e), 20 µm (c, f, g, h) or 1 cm (i).

Download figure to PowerPoint

Several transcripts were analysed by RT-PCR over the time course of disease development in A. thaliana using the histone 2a (At5g54640) gene of A. thaliana (AtHistone) as internal standard (Fig. 2). Most analysed P. brassicae genes were detected in correlation to the increasing number of secondary plasmodia colonizing the root, starting at 14 d.p.i. At earlier stages, where either primary plasmodia were still present in root hairs or young secondary plasmodia had already colonized the cortex (7 d.p.i.), for most of the transcripts no or extremely low expression was found. PbActin und PbCC243 were strongly expressed and easily detectable over the whole infection cycle and could therefore be used as markers for the presence of the pathogen (Fig. 2). PbBrip9 und PbCC249 appeared as genes which were expressed during late disease stages correlating with the increase of sporulating plasmodia (Fig. 2). In particular, PbBrip9 was strongly expressed at 21 d.p.i., when many plasmodia in A. thaliana galls switched from vegetative growth to sporulation (Fig. 2). However, it was not possible to identify cDNAs of P. brassicae specifically expressed in young secondary (and perhaps also primary) plasmodia at 7 d.p.i. The fact that the results were repeatedly obtained with different plant material independently inoculated demonstrated the reliability of the selected genes.

image

Figure 2. Comparison of expression of AtHistone and several Plasmodiophora brassicae (Pb) genes by RT-PCR in control roots (21, 28, 35 and 42 days post-germination) and inoculated roots (7, 14, 21 and 28 d.p.i.) of Arabidopsis thaliana ecotype Col-0. The inoculated roots were from plants of the same age as the control roots as inoculation took place 14 days after germination.

Download figure to PowerPoint

The P. brassicae cDNA PbCC249 was previously characterized as a single-copy gene localized on chromosome VII by Graf et al. (2004). This study confirmed the origin of PbBrip9, and characterized it as a single-copy gene by Southern analysis (Fig. 3c) and localized it on chromosome VIII (Fig. 4b), one of the 16 chromosomes recently identified for P. brassicae (Graf et al., 2001, 2004). The P. brassicae repetitive elements H4 and E7 (Figs 3a,b and 4a) were used to confirm the origin of the new sequence as pathogen-derived.

image

Figure 3. Southern analysis of PbBrip9 on restricted DNA of Plasmodiophora brassicae isolates. DNA of Brassica rapa and P. brassicae isolates e3 and e6 were digested with restriction enzyme combination EcoRV/BamHI, separated and blotted. The blots were sequentially hybridized with P. brassicae repetitive element H4 (a), E7 (b) and cDNA Brip9 (c). Dig-labelled λ-DNA was used as a size marker.

Download figure to PowerPoint

image

Figure 4. Southern analysis of PbBrip9 on separated chromosomes of Plasmodiophora brassicae. Chromosomes of P. brassicae isolate e3 were separated under conditions for large (left side, four samples) and small chromosomes (right side, five samples) according to Graf et al. (2001). The blots were sequentially hybridized with Dig-labelled repetitive element H4 (a) and cDNA fragment of PbBrip9 (b).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Plasmodiophora brassicae, the causal agent of clubroot disease, is an obligate biotrophic pathogen. Since it cannot be grown without its host, not much is known about its biology. Such problems can be overcome by using techniques for the isolation of differentially expressed genes during the development of the disease. This approach is complicated by the fact that the infection procedure cannot be completely synchronized and usually several developmental stages of the pathogen are present within the same root tissues (Grsic-Rausch et al., 2000; Kobelt, 2000; Kobelt et al., 2000; Siemens et al., 2002). However, for the interaction of A. thaliana ecotype Col-0 infected by P. brassicae single-spore isolate e3 under controlled environmental conditions a reasonably reproducible pattern of the development of root and hypocotyl galls over time was shown (Siemens et al., 2002, 2006). Using this defined interaction two genes of P. brassicae (PbActin and PbCC243) were identified as strongly expressed genes at all time points analysed and therefore appeared as good markers of the actively growing pathogen. Most recent techniques to estimate the presence and the amount of P. brassicae in soil used PCR amplification of conserved gene fragments and DNA as template (Faggian et al., 1999; Wallenhammar & Arwidsson, 2001; Kageyama et al., 2003). In contrast to the detection of PbDNA, the detection of PbRNA of expressed genes can distinguish between active and non-active cells. Furthermore, the two genes PbBrip9 and PbCC249 appeared to be associated with late developmental stages of the pathogen and the beginning of spore production in host plants. Both genes were characterized as single-copy genes and localized on chromosomes of P. brassicae, but any speculation about a possible function of the genes is limited by the fact that the sequences generally show no significant homology to known genes. The only exception is PbTPS, where at least correlative evidence exists that the gene product could be involved in trehalose synthesis in resting spores (Brodmann et al., 2002).

In principle, it was shown here that pathogen gene expression can be used to describe gall development and can be a useful supplement to other parameters for disease quantification, e.g. disease index or root index described by Siemens et al. (2002). It might also be helpful to compare clubroot disease development across species, i.e. A. thaliana vs. Brassica sp. The approach presented here might be used in the future to detect changes in P. brassicae development during treatment of infected field or greenhouse plots with clubroot control agents (see for example Donald et al., 2006). For the screening of potential developmental markers of P. brassicae, RT-PCR over the time course of the disease in A. thaliana proved to be a good tool. However, more genes must be analysed to find potential markers for other developmental stages of the pathogen, e.g. early developmental stages in root hairs or young vegetative plasmodia shortly after secondary infection. Furthermore, more advanced PCR techniques would increase the potential to describe disease development by estimating the quantitative relation between gene expression of specific genes and constitutively expressed genes used as internal standards, such as AtHistone of the host plant or PbActin of P. brassicae itself. Moreover, in situ PCR might be able to overcome the problem of mixed developmental stages in a gall and might help to define the specific type of plasmodia (primary plasmodia vs. young or vegetative secondary plasmodia) where certain genes are highly expressed.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We would like to thank Silvia Heinze and Jana Rieckhoff for technical assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Archibald JM, Keeling PJ, 2004. Actin and ubiquitin protein sequences support a cercozoan/foraminiferan ancestry for the plasmodiophorid plant pathogens. Journal of Eukaryotic Microbiology 51, 1138.
  • Arnold DL, Blakesley D, Clarkson JM, 1996. Evidence for the growth of Plasmodiophora brassicae in vitro. Mycological Research 100, 53540.
  • Brodmann D, Schuller A, Ludwig-Müller J et al ., 2002. Induction of trehalase in Arabidopsis plants infected with the trehalose-producing pathogen Plasmodiophora brassicae. Molecular Plant-Microbe Interactions 15, 693700.
  • Bulman S, Siemens J, Ridgway HJ, Eady C, Conner AJ, 2006. Identification of genes from the obligate intracellular plant pathogen, Plasmodiophora brassicae. FEMS Microbiology Letters 264, 198204.
  • Bulman S, Ridgway HJ, Eady C, Conner AJ, 2007. Intron-rich gene structure in the intracellular plant parasite, Plasmodiophora brassicae. Protist 158, 42333.
  • Dekhuijzen HM, Overeem JC, 1971. The role of cytokinins in clubroot formation. Physiological Plant Pathology 1, 15161.
  • Devos S, Vissenberg K, Verbelen J-P, Prinsen E, 2005. Infection of Chinese cabbage by Plasmodiophora brassicae leads to a stimulation of plant growth: impacts on cell wall metabolism and hormonal balance. New Phytologist 166, 24150.
  • Donald EC, Porter IJ, Faggian R, Lancaster RA, 2006. An integrated approach to the control of clubroot in vegetable Brassica crops. Acta Horticulturae 706, 283300.
  • Faggian R, Bulman SR, Lawrie AC, Porter IJ, 1999. Specific polymerase chain reaction primers for the detection of Plasmodiophora brassicae in soil and water. Phytopathology 89, 3927.
  • Fähling M, Graf H, Siemens J, 2003. Pathotype-separation of Plasmodiophora brassicae by the host plant. Journal of Phytopathology 151, 42530.
  • Fähling M, Graf H, Siemens J, 2004. Characterization of a single-spore isolate population of Plasmodiophora brassicae resulting from a single club. Journal of Phytopathology 152, 43844.
  • Graf H, Sokolowski F, Klewer A, Diederichsen E, Luerßen H, Siemens J, 2001. Electrophoretic karyotype of the obligate biotrophic parasite Plasmodiophora brassicae Wor. Journal of Phytopathology 149, 3138.
  • Graf H, Fähling M, Siemens J, 2004. Chromosome polymorphism of the obligate biotrophic parasite Plasmodiophora brassicae. Journal of Phytopathology 152, 8691.
  • Grsic-Rausch S, Kobelt P, Siemens J, Bischoff M, Ludwig-Müller J, 2000. Expression and localization of nitrilase during symptom development of the clubroot disease in Arabidopsis thaliana. Plant Physiology 122, 36978.
  • Ingram DS, Tommerup IC, 1972. The life history of Plasmodiophora brassicae Woron. Proceedings of the Royal Society B 180, 10312.
  • Ito S, Ichinose H, Yanagi C, Tanaka S, Kameya-Iwaki M, Kishi F, 1999. Identification of an in planta-induced mRNA of Plasmodiophora brassicae. Journal of Phytopathology 147, 7982.
  • Jones DR, Ingram DS, Dixon GR, 1982. Factors affecting tests for differential pathogenicity in populations of Plasmodiophora brassicae. Plant Pathology 31, 22938.
  • Kageyama K, Komatsu T, Suga H, 2003. Refined PCR protocol for detection of plant pathogens in soil. Journal of General Plant Pathology 69, 15360.
  • Karling JS, 1968. Control of clubroot. In: KarlingJS, ed. The Plasmodiophorales. New York, USA: Hafner Publishing Co., 15476.
  • Klewer A, Luerßen H, Graf H, Siemens J, 2001. Restriction fragment length polymorphism markers to characterize Plasmodiophora brassicae single-spore isolates with different virulence patterns. Journal of Phytopathology 149, 1217.
  • Kobelt P, 2000. Die Verbreitung von sekundären Plasmodien von Plasmodiophora brassicae (Wor.) im Wurzelgewebe von Arabidopsis thaliana nach immunhistologischer Markierung des plasmodialen Zytoskeletts. Berlin, Germany: Freie Universität Berlin, dissertation.
  • Kobelt P, Siemens J, Sacristan MD, 2000. Histological characterisation of the incompatible interaction between Arabidopsis thaliana and the obligate biotrophic pathogen Plasmodiophora brassicae. Mycological Research 104, 2205.
  • Ludwig-Müller J, Schuller A, 2008. What can we learn from clubroots: alterations in host roots and hormone homeostasis caused by Plasmodiophora brassicae. European Journal of Plant Pathology 121, 291302.
  • Ludwig-Müller J, Bennett R, Kiddle G, Ihmig S, Ruppel M, Hilgenberg W, 1999. The host range of Plasmodiophora brassicae and relationship to endogenous glucosinolate contents. New Phytologist 141, 44358.
  • Mühlenberg I, Schuller A, Siemens J, Kobelt P, Ludwig-Müller J, 2002. Plasmodiophora brassicae, the causal agent of clubroot disease, may penetrate plant cell walls via cellulase. Plant Protection Science 38, 6972.
  • Siemens J, Nagel M, Ludwig-Müller J, Sacristan MD, 2002. The interaction of Plasmodiophora brassicae and Arabidopsis thaliana: parameters for disease quantification and screening of mutant lines. Journal of Phytopathology 150, 592605.
  • Siemens J, Keller I, Sarx J et al ., 2006. Transcriptome analysis of Arabidopsis clubroots indicate a key role for cytokinins in disease development. Molecular Plant-Microbe Interactions 19, 48094.
  • Toxopeus H, Dixon GR, Mattusch P, 1986. Physiological specialization in Plasmodiophora brassicae and analysis by international experimentation. Transactions of the British Mycological Society 87, 27988.
  • Wallenhammar AC, Arwidsson O, 2001. Detection of Plasmodiophora brassicae by PCR in naturally infested soils. European Journal of Plant Pathology 107, 31321.