SEARCH

SEARCH BY CITATION

Keywords:

  • basidiomycetous yeasts;
  • fungal communities;
  • forestry;
  • Phytophthora;
  • T-RFLP;
  • tree diseases

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

A study was carried out to clarify the role of the fungus Chalara fraxinea in decline of Fraxinus excelsior, which is observed on a large scale in central and northern Europe with high incidence of tree mortality. The aims of this work were: (i) to check for the presence of C. fraxinea in various tissues of declining F. excelsior by agar culture isolations and by direct analysis of plant tissues using molecular techniques (DNA extraction, ITS-PCR, cloning, ITS sequencing and T-RFLP); (ii) to study fungal communities inhabiting tissues with symptoms; and (iii) to test the pathogenicity of C. fraxinea to F. excelsior. Chalara fraxinea was isolated from 93% of stem cankers, 91% of necrotic leaf stalks, 27–28% of bark wounds and 30% of visually healthy leaf stalks. Molecular analyses of necrotic leaves, leaf stalks and bark revealed the presence of 25 different fungal taxa, 14 of which were detected in all three types of tissue sample. Chalara fraxinea was the second most common species (61% of samples), and only Cryptococcus foliicola occurred more often (70%). All eight of the tested C. fraxinea isolates induced necroses in bark and cambium on each of 86 inoculated trees, and all controls remained healthy. Average length of necroses caused by different C. fraxinea strains varied from 4·2 to 8·9 cm, but the differences were statistically insignificant. Instead, differences in resistance of individual trees to C. fraxinea were observed.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Since the early 1990s, large-scale decline of Fraxinus excelsior has been increasingly observed in central and northern Europe, resulting in massive dieback of trees over the Baltic States, Poland, southeast Scandinavia, Germany and Austria (Juodvalkis & Vasiliauskas, 2002; Przybyl, 2002a; Barklund, 2005; Heydeck et al., 2005; Cech, 2006; Thomsen & Skovsgaard, 2006; Vasiliauskas et al., 2006). Trees are subject to dieback at various ages, in forest stands, as landscape trees and in nurseries (Kowalski & Lukomska, 2005; Schumacher et al., 2007; Kirisits & Halmschlager, 2008). The crowns of declining F. excelsior trees exhibit a wide range of symptoms: (i) wilting and premature shedding of leaves; (ii) necroses of leaves, buds, leaf stalks and bark; (iii) top and shoot dieback; (iv) cankers on shoots, branches and stems (Przybyl, 2002b,c; Barklund, 2005; Kowalski & Lukomska, 2005; Cech, 2006; Thomsen & Skovsgaard, 2006; Schumacher et al., 2007; Thomsen et al., 2007; Kirisits & Halmschlager, 2008; Skovsgaard et al., 2009).

A fungus from the genus Chalara was reported as the cause of F. excelsior decline (Kowalski & Lukomska, 2005; Kowalski, 2006). It was recently described as a new species Chalara fraxinea (Kowalski, 2006). However, the experimental evidence for pathogenicity of C. fraxinea to F. excelsior has not yet been provided, although in some cases the fungus was found to be one of the dominating species, isolated from up to 70% of examined shoots with dieback symptoms (Kowalski & Lukomska, 2005; Kowalski, 2006). In other studies only sporadic and occasional isolation of C. fraxinea from declining F. excelsior was noted [Lygis et al., 2005 (as Hymenoscyphus sp.970); Schumacher et al., 2007; Kirisits & Halmschlager, 2008; Skovsgaard et al., 2009]. Different factors could have contributed to the variable success of reported isolations, for example sampling season, phase of pathological process, symptom characteristics and isolation media. Moreover, as a slow grower in culture, the fungus may have been overgrown by other species during isolation (Kirisits & Halmschlager, 2008).

A DNA-based identification method was suggested to study fungal communities directly from tissue or environmental samples that are likely to contain some fungi that are difficult to culture (Lindahl et al., 2007). Here, polymerase chain reaction (PCR) amplification of the internal transcribed spacer (ITS) region of the ribosomal genes was combined with the community fingerprinting technique defined as terminal restriction fragment length polymorphism (T-RFLP) (Dickie et al., 2002). In order to identify taxa in the T-RFLP profiles, PCR products from representative samples were cloned, enabling sequencing of the ITS region of the ribosomal DNA (rDNA) genes for individual taxa within mixed samples (Landeweert et al., 2003; O’Brien et al., 2005) and subsequent identification by database comparisons (Lindahl et al., 2007).

The first aim of the present work was to check the presence of C. fraxinea in different parts of declining F. excelsior, with and without symptoms, by fungal isolations on different media, and by direct analysis of plant tissues using molecular techniques (DNA extraction, ITS-PCR, cloning, ITS sequencing and T-RFLP). The second aim was to study by molecular methods fungal communities inhabiting tree tissues with the advancing dieback. The third aim was to test the pathogenicity of different C. fraxinea strains to young F. excelsior trees. Moreover, as the involvement of Phytophthora spp. was implied as a possible cause of F. excelsior decline (Przybyl, 2002c), plant tissues with advancing dieback symptoms were checked for the presence of oomycetes.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Study sites and sampling

Field sampling was done in September 2005 at two locations in southern-central Sweden: Örebro (59°16′N, 15°13′E) and Gnesta (59°02′N, 17°18′E), the geographic distance between which is about 200 km. Each locality comprised 20- to 30-year-old mixed natural stands dominated by F. excelsior showing symptoms of crown decline (Barklund, 2005; Thomsen & Skovsgaard, 2006). In both stands, branches with dieback symptoms on leaves and bark were cut and individually packed into plastic bags. In Örebro, the sampling also included portions of necrotic bark from stem cankers. In the laboratory, the collected material was sorted into the following symptom categories: (1) necrotic leaves (Fig. 1a); (2) necrotic leaf stalks (Fig. 1a); (3) necrotic shoot bark (Fig. 1b); (4) small bark wounds (≤5 mm) (Fig. 1c); (5) larger bark wounds with necroses (10–15 mm) (Fig. 1d); and (6) necrotic bark from stem cankers (Fig. 1e). Symptom categories 4, 5 and 6 included samples only from Örebro.

image

Figure 1. Dieback symptoms of Fraxinus excelsior and pathogenicity tests with Chalara fraxinea; (a) necrotic leaves and leaf stalk with necrotic and visually healthy sections; (b) necrotic shoot bark; (c) small bark wounds; (d) bark wound with necrosis; (e) stem canker; (f) artificial inoculation with C. fraxinea showing bark necrosis below sealed inoculum; (g) cambium necrosis following inoculation with C. fraxinea; (h) occluded scar following inoculation with sterile control; (i) visually healthy cambium beyond the same control inoculation.

Download figure to PowerPoint

Isolation of fungi

Isolation of fungi to pure culture was carried out within 24 h after the collection of samples in the field, from healthy-looking leaf stalks, necrotic leaf stalks (Fig. 1a) and the bark from small wounds (Fig. 1c), larger wounds with necrosis (Fig. 1d) and stem cankers (Fig. 1e). Table 1 shows the number of isolations attempted from each symptom category. The samples for isolation from leaf stalks were prepared by cutting off 3- to 5-mm-long sections, which in the case of necrotic leaf stalks included parts with and without symptoms. Bark samples from wounds and cankers were cut off as pieces approx. 3 × 3 mm in size, and also included both necrotic and healthy-looking bark tissue. Surface-sterilization of all samples was done as in a previous study (Barklund & Kowalski, 1996). Pieces of stalk and bark were washed under running water, then soaked in 96% ethanol for 1 min, soaked in sodium hypochlorite (4% active chlorine) for 5 min, again soaked in 96% ethanol for 30 s, and then left to dry on sterile filter paper. For isolation, prepared samples were placed onto 9-cm Petri dishes, containing either 2% malt agar, vegetable juice agar or water agar. The Petri dishes were incubated at room temperature for 2 weeks and observed daily for the presence of fungal mycelia for subsequent subculturing into a pure culture. Mycelia were investigated using a light microscope, and the fungus C. fraxinea was identified according to morphological characters of its mycelium (Kowalski, 2006; Schumacher et al., 2007; Halmschlager & Kirisits, 2008) and by comparison of the cultures of the fungus to strains provided by Professor Tadeusz Kowalski. No attempt was made to identify other isolated fungi.

Table 1.  Occurrence of Chalara fraxinea and other fungi in isolations from leaf and bark tissues of dieback-affected Fraxinus excelsior
Symptom categoryAttempted isolations (no.)Frequency of C. fraxinea isolation (%)Other fungi isolated (no.)a
  • a

    Numbers in this column do not reflect fungal diversity, as they represent a total of isolated strains, including possible representatives of the same taxon.

Healthy-looking leaf stalks 403010
Necrotic leaf stalks 4591 5
Small bark wounds (≤5 mm) on shoots and branches 602712
Larger bark wounds with necrosis (10–15 mm) on shoots and branches 4528 5
Necrotic bark from stem cankers 309310
All categories2204942

DNA extraction from plant tissue

Analyses of fungal DNA directly from plant tissue with symptoms followed the protocol previously used in the study by Lindahl et al. (2007) and included 32 necrotic leaves, 32 necrotic leaf stalks and 32 discrete bark necroses on shoots (Fig. 1a,b). Each symptom category included 16 samples from Örebro and 16 from Gnesta (50:50 ratio). For extraction of fungal DNA, the tissues were prepared as follows: (i) from each leaf, a section approx. 1 cm2 in size was cut using sterilized scissors; (ii) from each leaf stalk, a 7- to 10-mm-long portion was cut using a sterilized scalpel; and (iii) from each bark sample, a section approx. 5 × 5 mm in size was cut using a scalpel. All samples were taken from the zone of advancing necroses and included both necrotic and healthy-looking tissue. The samples were individually placed into Eppendorf tubes, freeze-dried and ground in a FastPrep homogenizer (MP Biomedicals) with one screw and one nut per tube without any liquid. DNA was extracted in a CTAB-buffer (3% cetyltrimetylammoniumbromide, 2 mm EDTA, 150 mm Tris-HCl, 2·6 m NaCl, pH 8) at 65°C for 1 h. After centrifugation the supernatant was extracted with chloroform and the DNA was precipitated from the upper phase with 2-propanol.

PCR, cloning, sequencing and sequence analysis

PCR was carried out using the primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) with an annealing temperature of 55°C. The thermal cycling was carried out in an Applied Biosystems GeneAmp PCR System 2700 thermal cycler. An initial denaturation step at 95°C for 5 min was followed by 35 amplification cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 30 s. The thermal cycling was ended by a final extension step at 72°C for 7 min. The PCR reaction contained 200 µm dNTPs, 0·2 µm primers, 0·03 units µL−1 ThermoRed Taq polymerase with reaction buffer Y (SaveenWerner) and a final MgCl2 concentration of 2·75 mm. PCR products were size-separated on 1% agarose gels (D-1, Hispanlab), stained with ethidium bromide and visualized under UV light. PCR products were cloned with the TOPO TA Cloning Kit with pCR®2·1-TOPO vector and One Shot TOP10 chemically competent E. coli (Invitrogen). Small amounts of bacteria were used directly for PCR, which was carried out us above, but with primers M13 Forward (GTAAAACGACGGCCAG) and M13 Reverse (CAGGAAACAGCTATGAC). The PCR products were purified with AMPure (Agencourt) and sequenced with a CEQ 8000 Genetic Analysis System with the CEQ DTCS Quick Start Kit (Beckman Coulter). Sequences from cloned fragments were compared to those of known fungi, available in the databases. Two databases – one at GenBank (Altschul et al., 1997) and another at the Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences – were used to define the identity of sequences. The latter is an as yet unpublished database containing about 2000 ITS sequences of well documented fungal isolates (tree pathogenic, saprotrophic and endophytic), the majority of which (in particular microfungi) were isolated to pure cultures during previous studies here, and morphologically identified at the Central Bureau of Fungal Cultures, Utrecht, Netherlands. The ITS sequence homology for delimiting a fungal taxon (presumed species) was set at 98–100%, and for delimiting at genus level it was 94–97%.

T-RFLP

The cloning approach was combined with T-RFLP (terminal restriction fragment length polymorphism) analysis in order to enable processing of a large set of samples. All samples were used for T-RFLP analysis. In addition, all clones that were sequenced were also subjected to T-RFLP analysis, to enable matching of T-RFLP patterns with sequences. PCR was carried out as above, but the primers were labelled with WellRED fluorescent dyes, ITS1-F with D3-PA and ITS4 with D4-PA (Proligo). The PCR amplicons were digested with restriction endonucleases according to the manufacturers’ instructions. The library clones were digested with CfoI (Promega) and TaqI (Fermentas) separately. PCR products from samples were also digested with TaqI and CfoI separately. The T-RFLP patterns were analysed with a Beckman Coulter CEQ 8000 Genetic Analysis System, using CEQ DNA Size Standard Kit-600. Sample T-RFLP patterns were compared with the reference database constituted by T-RFLP patterns from the clones using the program tramp (Dickie et al., 2002). To account for base calling during analysis on the Beckman Coulter CEQ 8000 Genetic Analysis System and for within-taxa variation of the ITS region, a threshold level for fragment size in tramp was set to ±2 base pairs. Out of a total of 96 samples subjected to analysis, 89 (93%) were successfully analysed: 28 (88%) from leaves, 32 (100%) from leaf stalks and 29 (91%) from bark (Table 2).

Table 2.  Frequencies of detection of fungal ITS clones (%) in necrotic tissues of dieback-affected Fraxinus excelsior
Fungal taxonGenBankAnalysed tissues (no.) from
accession no.Leaves (28)Leaf stalks (32)Shoot bark (29)All (89)
Cryptococcus foliicolaEU852351100634870
Chalara fraxineaEU852352 39974161
Phoma glomerataEU852353 71137652
Phoma exiguaEU852354 68136647
Cladosporium cladosporioidesEU852355 79283847
Cryptococcus sp.22BEU852356 54283137
Bullera coprosmaensisEU852357 54341735
Unidentified sp.26AEU852358 14562834
Cryptococcus victoriaeEU852359 50132428
Venturia fraxiniEU852360 32 61417
Ramularia sp.13AEU852361 39 – –12
Leptosphaeria sp.21AEU852362 18 –1711
Unidentified sp.9BEU852363 11 61711
Cryptococcus dimennaeEU852364 25 – 710
Unidentified sp.20AEU852365 14 –1710
Taphrina carpiniEU852366 21 3 3 9
Coniothyrium sp.8AEU852367  7 9 7 8
Unidentified sp.23AEU852368  4 414 7
Phaeosphaeria caricicolaEU852369  7 –10 6
Unidentified sp.16AEU852370 11 – 3 4
Taphrina sp.11AEU852371  4 – 7 3
Unidentified sp.18BEU852372  – 3 7 3
Unidentified sp.24AEU852373  – –10 3
Cryptococcus hungaricusEU852374  7 – – 2
Leptosphaerulina sp.3EU852375  – – 3 1

Test for presence of oomycetes

Available DNA extractions from leaves (32), leaf stalks (32) and bark samples (30) were tested for the presence of oomycetes. PCR was carried out using the primers P1 (GAAGGATCATTACCACAC) (Geraats, 2003) and ITS4 (TCCTCCGCTTATTGATATGC) with an annealing temperature of 55°C. The thermal cycling was carried out in an Applied Biosystems GeneAmp PCR System 2700 thermal cycler. An initial denaturation step at 95°C for 5 min was followed by 35 amplification cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 30 s. The programme was completed by a final extension step at 72°C for 7 min. The PCR reaction contained 200 µm dNTPs, 0·2 µm primers, 0·03 units µL−1 ThermoRed Taq polymerase with reaction buffer Y (SaveenWerner) and a final MgCl2 concentration of 2·75 mm. In all PCR runs a sample of Phytophthora infestans was included as a control and only if the control was positive was the run considered successful. PCR products were size-separated on 1% agarose gels (D-1), stained with ethidium bromide and visualized under UV light.

Pathogenicity tests

The experiment was set up in November 2005. Pathogenicity tests included 96 1-year-old 20- to 29-cm-high F. excelsior trees of seed origin from a bare-root nursery. A total of eight isolates of C. fraxinea were used for artificial inoculations of 86 of the trees, and 10 trees were used as controls. The isolates 10B and 12A originated from necrotic leaf stalks collected in Gnesta, while the other six strains were collected in Örebro: isolate 16BO from a healthy-looking leaf stalk, isolates 22A and 23A from necrotic leaf stalks, 32A from a small bark wound, and 36A and 38C from stem cankers (Table 3).

Table 3.  Results of artificial inoculations of 1-year-old Fraxinus excelsior stems with Chalara fraxinea
IsolateInoculated treesLength of necroses (cm)
No.Without necrosis (%)With necrosis (%)Dead (%)Min.Max.Mean ± SDa
  • a

    Differences between means in this column are statistically insignificant (one-way anova, P = 0·80).

32A11  0100 01·1 7·84·2 ± 2·5
12A11  0100181·115·96·4 ± 6·1
16BO11  0100361·314·07·1 ± 4·2
10B11  0100181·219·37·2 ± 7·5
23A10  0100301·415·27·4 ± 5·1
22A11  0100361·116·87·7 ± 5·5
38C10  0100201·222·38·6 ± 6·5
36A11  0100271·528·78·9 ± 10·9
All86  0100231·128·77·2 ± 6·5
Control10100  0 0

Prior to inoculations, autoclaved pieces of Populus tremula wood 1·0 × 0·2 × 0·2 cm in size were kept for 2 weeks on top of pure cultures of each C. fraxinea isolate to be inoculated. The wood pieces were successfully pre-colonized with each respective strain, and were used as inocula. For the inoculation, wounds exposing green living cambium and wood (e.g. Fig. 1i) approx. 1·0 × 0·2 cm in size were cut using a sterile scalpel on tree stems approximately 15 cm above the soil. The pre-colonized wood pieces were applied to the wounds with forceps and sealed with ParafilmTM sealing tape. Before every inoculation, scalpel and forceps were sterilized using 70% ethanol and an open flame. For controls, sterile pieces of wood of the same size were similarly applied and sealed to similar wounds on stems of 10 F. excelsior trees. At the beginning of the experiment all trees were dormant. They were individually planted into pots, placed into a greenhouse, and after 2 weeks subjected to artificial inoculations. The inoculations with different isolates of the fungus and the controls were mixed in randomized blocks. The plants were kept in a greenhouse under a 12:12-h light:dark regime, at 20°C, and periodically watered.

The pathogenicity tests were scored after 6 weeks, in January 2006. At that time, leaves were emerging from about 20% of the trees. All trees were cut at the soil level, transported to the laboratory and washed with tap water. Bark at the inoculation site was removed with a sterile scalpel, and the longitudinal spread of cambium necrosis (upwards and downwards beyond the borders of the 1-cm-long inoculation site) was measured. Fungal isolations were attempted from 3- × 3-mm bark sections bordering necrotic/visually healthy tissue, as described above. The identity of isolated strains was tested against the inoculated strain by a vegetative compatibility test, thus fulfilling Koch's postulates.

Statistical analyses

Qualitative Sorensen similarity indices (Magguran, 1998) were used to analyse similarity between fungal communities from different geographic locations and symptom categories. The lengths of cambium necroses caused by each inoculated C. fraxinea strain were compared by one-way analysis of variance (anova) and the Tukey's test for multiple comparisons between all pairs of means. The analyses were performed using the Minitab™ statistical software package.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Pure-culture isolations of Chalara fraxinea

Growth of C. fraxinea mycelium was recorded in each symptom category investigated, and, depending on the type of tissue, the fungus was isolated from 27–93% of samples (Table 1). Most commonly, it was found in necrotic leaf stalks (91%) and necrotic bark from stem cankers (93%), but was less often isolated from small and larger bark wounds (27–28%). The fungus was also isolated from 30% of healthy-looking (symptomless) leaf stalks. Chalara fraxinea was detected in 35–100% of all samples collected in Örebro, and in 25–87% of all samples collected in Gnesta. The frequencies of its isolation on malt, vegetable juice agar and water agar media were 90, 63 and 86%, respectively. Along with C. fraxinea, the isolations revealed the presence of 42 other fungal strains (Table 1). On average, 0·7 isolates were obtained per attempted isolation (150 strains from 220 samples): 0·6 isolates per symptomless leaf stalk, 1·0 per necrotic leaf stalk, 0·5 per small bark wound, 0·4 per larger bark wound and 1·3 per stem canker.

Molecular analyses of plant tissue

PCR and T-RFLP analyses of necrotic leaves, leaf stalks and bark revealed the presence of 25 different fungal taxa, 18 of which where identified at least to a genus level (Table 2). For the most part, the same fungi were found in samples collected in Örebro and Gnesta. There were three occasional taxa found only in Örebro and one taxon only in Gnesta, while the other 21 taxa were consistently recorded from both localities. As a result, the Sorensen qualitative index of similarity was 0·91. The amount of taxa detected per sample positively correlated with the physical size of the analysed tissue. Thus, in leaf samples (approx. 1 cm2 in size) the method revealed the presence of 1–16 fungal taxa per sample (7·3 ± 3·5 on average), in shoot bark samples (approx. 0·25 cm2 in size) there were 1–12 taxa per sample (5·8 ± 2·7 on average) and in leaf stalk samples (7–10 mm long) there were 1–9 taxa per sample (4·1 ± 2·1 on average). According to t-tests, the differences between the numbers of detected taxa in leaves and leaf stalks, and in shoot bark and in leaf stalks, were statistically significant (P < 0·0001 and P < 0·025, respectively). A total of 23 taxa were found in shoot bark, 22 in leaves and 15 in leaf stalks. Fourteen of those taxa were consistently detected in all three types of analysed tissue, most commonly Cryptococcus foliicola and C. fraxinea, recorded in 70 and 61% of all samples, respectively. They were followed by Phoma glomerata, Phoma exigua and Cladosporium cladosporioides, each of which was found in about a half of analysed samples (47–52%) (Table 2). None of the samples tested for presence of oomycetes gave any PCR product with the specific primer, while in all runs the Phytophthora infestans sample resulted in a PCR product.

Pathogenicity tests

All eight (100%) of the tested C. fraxinea isolates induced necroses in bark and cambium on each (100%) of the inoculated trees (Table 3; Fig. 1f,g). By contrast, no necroses were observed on bark or cambium on any of the control inoculations (Table 3; Fig. 1h,i). The length of the necroses on individual trees varied from 1·1 to 28·7 cm (on average, 7·2 cm), and comprised 4–99% of the total stem length. On 16 (19%) of the trees inoculated with the fungus, necrosis did not exceed 1·5 cm. Average length of necroses caused by individual isolates of C. fraxinea varied from 4·2 to 8·9 cm, but the differences between means were statistically insignificant (Table 3). The pathogenicity tests resulted in mortality of 20 (23%) of C. fraxinea-inoculated trees, while all controls remained alive. The mortality of two to four trees (18–30%) was observed in each set of 10–11 trees, subjected to individual inoculations with seven (out of eight tested) isolates. The exception was strain 32A, where all 11 trees remained alive, and which also caused the least extensive necroses (Table 3). When the proportions of dead trees were compared between the isolate sets with the highest and the lowest mortality rates (e.g. strain 16BO or 22A, four dead out of 11 inoculated, vs. strain 32A, none dead out of 11 inoculated), the chi-squared test was statistically significant at P = 0·027. After scoring the pathogenicity tests, the respective strain of C. fraxinea was re-isolated from 6–9 trees in each set (40–82%).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

By pure-culture isolations, mycelia of C. fraxinea were consistently detected in all investigated symptom categories, and on all three types of agar media used. As all samples for the isolations were taken either from healthy-looking tissue or at the zone of advancing necrosis, the results indicated that the fungus was active and perhaps even dominating other microbial species at the early stages of symptom development. The isolation data were largely consistent with the results of molecular analyses. Thus, isolation and molecular analysis of necrotic leaf stalks revealed the presence of C. fraxinea in 91 and 97% of samples, respectively, while in necrotic shoot bark respective detection frequencies were 27–28% and 41%. In general, molecular techniques appeared to be more powerful in exploring fungal diversity than pure-culture isolations. For example, the isolations from necrotic leaf stalks yielded an average of 1·0 strain per sample (including possible representatives of the same taxon), while the molecular analyses of the similar tissues revealed, on average, the presence of 4·1 distinct fungal taxa.

The present work consistently demonstrated frequent occurrence of C. fraxinea in various parts of declining F. excelsior trees: necrotic leaves, healthy-looking and necrotic leaf stalks, necrotic shoot bark, and wounds on shoots and stems. In previous studies this fungus was isolated at varying frequencies from leaves, buds, shoots, tree stems and roots (Kowalski & Lukomska, 2005; Lygis et al., 2005; Kowalski, 2006; Schumacher et al., 2007; Halmschlager & Kirisits, 2008). This demonstrates a broad capacity of the species to colonize a wide spectrum of physically and physiologically different niches, so that studies of its infection biology, enzymatic activity and metabolism might be rewarding.

In the present work, C. fraxinea was the second most commonly detected species. The data also showed that apart from C. fraxinea, the fungal community in necrotic leaves, leaf stalks and shoots of F. excelsior was largely composed of basidiomycetous yeasts from the genera Cryptococcus and Bullera, and that the species C. foliicola was the most common. However, neither of the yeasts detected in the present study are known as plant pathogens. In nature, they have a worldwide distribution reaching from the tropics to the Antarctic regions and are known as inhabitants of phylloplane and rhizosphere (Nakase, 2000; Renker et al., 2004; Arenz et al., 2006; Aldrich-Wolfe, 2007; Renouf et al., 2007), and thus in leaves and bark of declining F. excelsior are likely to represent saprotrophic and/or endophytic organisms. On the other hand, some other commonly detected fungi (47–52% of samples), such as P. glomerata, P. exigua and C. cladosporioides, were reported as causes of leaf spots on trees and agricultural plants (Agrios, 2005; Sinclair & Lyon, 2005). Therefore, the possibility cannot be excluded that, along with C. fraxinea, they to some extent contribute to the observed dieback, and this needs to be evaluated in future studies. For example, experiments by Przybyl (2002b,c, 2003) demonstrated certain pathogenicity to F. excelsior of Diplodia mutila (anamorph of Botryosphaeria stevensii) and Fusarium oxysporum. However, those studies did not provide straightforward explanations of the roles of any of the fungi in tree dieback, indicating that the situation might be more complex than an attack by a single fungal species, although the present work also showed the absence of Phytophthora spp. from investigated samples, implying that the latter are unlikely to be involved in the decline of F. excelsior.

The pathogenicity tests demonstrated that each of the eight tested strains of C. fraxinea induced cambium necrosis on each inoculated F. excelsior stem. Although in one-way anova the differences between average lengths of necroses caused by individual strains were not significant, the average lesion lengths of some isolates were double those of others. Moreover, the incidences of mortality following inoculation with different strains were statistically significant in certain cases. This indicates that different isolates of C. fraxinea might differ in aggressiveness. However, in order to elucidate this, pathogenicity tests must be carried out on clonal material of F. excelsior, which was not done in this work. The results of the present study explicitly demonstrated sharp differences in resistance of individual trees to inoculations of C. fraxinea, as differences between the lengths of necroses among trees inoculated with the same strain varied within a wide range, from 1·1 to 7·8 cm in the case of strain 32A (lowest variation), and from 1·5 to 28·7 cm in the case of strain 36A (highest variation). This is in good agreement with the results of available field inventories in clonal plantations in Sweden and Denmark, in which different severities of the disease were observed among the representatives of different F. excelsior clones (Stener, 2006; Olrik et al., 2007).

Frequent isolations of C. fraxinea and its consistent detection by molecular methods in various dieback symptoms, together with the results of pathogenicity tests, clearly demonstrated the involvement of the fungus in the decline of F. excelsior. In addition, the results of the present study indicate some possible directions for future research. To date, nothing is known regarding the infection biology C. fraxinea. Moreover, studies on population genetics could be of interest, as the fungus has been only recently described, and so far no teleomorph of this species has been observed, either in pure culture or in nature (Kowalski, 2006). Therefore, C. fraxinea might be a previously undetected native species in a community of microfungi on F. excelsior, the pathogenicity of which is triggered by changing environmental conditions. On the other hand, the fungus might be an invasive species gradually spreading over new geographic areas, its origin and mode(s) of spread remaining completely unknown. Although the pathogenicity tests in this study showed the susceptibility of F. excelsior to C. fraxinea during dormancy and early stages of seasonal growth, seasonal patterns of infection need to be clarified. The possible involvement of other fungi in F. excelsior decline also needs to be investigated in more detail. Of particular interest could be studies on the selection of decline-resistant F. excelsior clones, as this could result in recommendations to practical forestry on minimizing the damage caused by this catastrophic phenomenon.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The study was financially supported by Stiftelsen Oscar och Lilli Lamms Minne, Carl Tryggers Stiftelse för Vetenskaplig Forskning and the Swedish Research Council for Environment, Agricultural Sciences and Spatial Planning (FORMAS). The technical assistance of Audrius Menkis is gratefully acknowledged.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Agrios GN, 2005. Plant Pathology, 5th edn. Oxford, UK: Elsevier Academic Press.
  • Aldrich-Wolfe L, 2007. Distinct mycorrhizal communities on new and established hosts in a transitional tropical plant community. Ecology 88, 55966.
  • Altschul SF, Madden TL, Schäffer AA et al ., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389402.
  • Arenz BE, Held BW, Jurgens JA, Farell RL, Blanchette RA, 2006. Fungal diversity in soils and historic wood from the Ross Sea Region of Antarctica. Soil Biology and Biochemistry 38, 305764.
  • Barklund P, 2005. Ash dieback takes over south and mid-Sweden. SkogsEko Nr.3, 113 (in Swedish).
  • Barklund P, Kowalski T, 1996. Endophytic fungi in branches of Norway spruce with particular reference to Tryblidiopsis pinastri. Canadian Journal of Botany 74, 6738.
  • Cech T, 2006. Eschenschäden in Österreich. Forstschutz Aktuell 37, 1820.
  • Dickie IA, Xu B, Koide RT, 2002. Vertical niche differentiation of ectomycorrhizal hyphae in soil as shown by T-RFLP analysis. New Phytologist 156, 52735.
  • Geraats BPJ, 2003. The Role of Ethylene Perception in Plant Disease Resistance. Utrecht, the Netherlands: University of Utrecht, PhD thesis.
  • Halmschlager E, Kirisits T, 2008. First report of the ash dieback pathogen Chalara fraxinea on Fraxinus excelsior in Austria. Plant Pathology 57, 1177.
  • Heydeck P, Bemmann M, Kontzog H-G, 2005. Triebsterben an Gemeiner Esche (Fraxinus excelsior) im nordostdeutschen Tiefland. Forst und Holz 60, 5056.
  • Juodvalkis A, Vasiliauskas A, 2002. The extent and possible causes of dieback of ash stands in Lithuania. LZUU Mokslo Darbai, Biomedicinos Mokslai 56, 1722 (in Lithuanian with English summary).
  • Kirisits T, Halmschlager E, 2008. Eschenpilz nachgewiesen. Forstzeitung Nr.2, 323.
  • Kowalski T, 2006. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in Poland. Forest Pathology 36, 26470.
  • Kowalski T, Lukomska A, 2005. The studies on ash dying Fraxinus excelsior L. in the Woszczowa Forest Unit stands. Acta Agrobotanica 59, 42940 (in Polish with English summary).
  • Landeweert R, Leeflang P, Kuyper TW et al ., 2003. Molecular identification of ectomycorrhizal mycelium in soil horizons. Applied and Environmental Microbiology 69, 32733.
  • Lindahl BD, Ihrmark K, Boberg J et al ., 2007. Spatial separation of litter decomposition and mycorrhizal nitrogen uptake in a boreal forest. New Phytologist 173, 61120.
  • Lygis V, Vasiliauskas R, Larsson K, Stenlid J, 2005. Wood-inhabiting fungi in stems of Fraxinus excelsior in declining ash stands of northern Lithuania, with particular reference to Armillaria cepistipes. Scandinavian Journal of Forest Research 20, 33746.
  • Magguran AM, 1998. Ecological Diversity and Its Measurement. Princeton, NJ, USA: Princeton University Press.
  • Nakase T, 2000. Expanding world of ballistosporous yeasts: distribution in the phyllosphere, systematics and phylogeny. Journal of General and Applied Microbiology 46, 189216.
  • O’Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R, 2005. Fungal community analysis by large-scale sequencing of environmental samples. Applied and Environmental Microbiology 71, 554450.
  • Olrik DC, Kjaer ED, Ditlevsen B, 2007. Clonal differences in attacks by ash shoot dieback. Skoven 39, 5225 (in Danish).
  • Przybyl K, 2002a. Causes of Decline of Young Ash Trees and Stands. Warsaw, Poland: Central Board of State Forests (in Polish).
  • Przybyl K, 2002b. Fungi associated with necrotic apical parts of Fraxinus excelsior shoots. Forest Pathology 32, 38794.
  • Przybyl K, 2002c. Mycobiota of thin roots showing decay of Fraxinus excelsior young trees. Dendrobiology 48, 659.
  • Przybyl K, 2003. Effect of Pseudomonas spp. on inoculation of young plants of Fraxinus excelsior stem with Diplodia mutila. Dendrobiology 50, 2932.
  • Renker C, Blanke V, Börstler B, Heinrichs J, Buscot F, 2004. Diversity of Cryptococcus and Dioszegia yeasts (Basidiomycota) inhabiting arbuscular mycorrhizal roots or spores. FEMS Yeast Research 4, 597603.
  • Renouf V, Claisse O, Lonvaud-Funel A, 2007. Inventory and monitoring of wine microbial consortia. Applied Microbiology and Biotechnology 75, 14964.
  • Schumacher J, Wulf A, Leonhard S, 2007. Erster Nachweis von Chalara fraxinea T. Kowalski sp. nov. in Deutschland – ein Verursacher neuartiger Schäden an Eschen. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 59, 1213.
  • Sinclair WA, Lyon HH, 2005. Diseases of Trees and Shrubs, 2nd edn. Ithaca, NY, USA: Cornell University Press.
  • Skovsgaard JP, Thomsen IM, Skovgaard IM, Martinussen T, 2008. Associations between symptoms of crown dieback in even-aged stands of ash (Fraxinus excelsior L.) in Denmark. Forest Pathology 39 (in press).
  • Stener L-G, 2006. A Study on Susceptibility of Ash Trees to Shoot Dieback. Rapport 3. SkogForsk, Sweden: SkogForsk (in Swedish).
  • Thomsen IM, Skovsgaard JP, 2006. Ash dieback: climatic damage or fungal attack. Skoven 38, 40811 (in Danish).
  • Thomsen IM, Skovsgaard JP, Barklund P, Vasaitis R, 2007. Fungal disease is the cause of ash dieback. Skoven 39, 2346 (in Danish).
  • Vasiliauskas R, Bakys R, Lygis V, Barklund P, Ihrmark K, Stenlid J, 2006. Fungi associated with crown dieback of Fraxinus excelsior. In: OszakoT, WoodwardS, eds. Possible Limitation of Dieback Phenomena in Broadleaved Stands. Warsaw, Poland: Forest Research Institute, 4553.