SEARCH

SEARCH BY CITATION

Keywords:

  • Gibberella zeae;
  • methyl benzimidazole carbamates (MBC);
  • molecular detection;
  • single nucleotide mutation;
  • wheat scab;
  • β2-tubulin

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

PIRA-PCR (primer-introduced restriction analysis PCR) was developed to detect isolates of Fusarium graminearum with moderate resistance to carbendazim, a methyl benzimidazole carbamate (MBC)-group fungicide. Two primer pairs were designed and synthesized according to the nucleotide sequence of the β2-tubulin gene from F. graminearum. Fragments of 164 bp were amplified by nested PCR from isolates differing in carbendazim sensitivity. A HindIII restriction enzyme recognition site was introduced artificially by inner primers to detect a mutation at codon 167, and TaaI (Tsp4CI) restriction enzyme was used to detect a mutation at codon 200. The sensitivity of isolates to carbendazim was determined by analyzing electrophoresis patterns of the resulting PCR products after simultaneous digestion with both HindIII and TaaI. Results from PIRA-PCR and a conventional method (mycelial growth on agar) were identical but PIRA-PCR required only 7–8 h while the conventional method required 5–7 days. This study demonstrates that PIRA-PCR not only monitors the appearance of moderately resistant isolates, but can be useful for detecting genotypes of F. graminearum with moderate resistance to carbendazim.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fusarium head blight (FHB) or scab caused by Fusarium graminearum (sexual stage, Gibberella zeae) is an economically important disease on small grain cereal crops worldwide and is especially serious in China. Over the past three decades, methyl benzimidazole carbamate (MBC) fungicides, particularly carbendazim, have been relied on to control FHB in China. However, in recent years epidemics of FHB in China have become more severe and frequent (Bai & Shaner, 1994; Yao & Lu, 2000; Lu et al., 2001). The resistance of F. graminearum to carbendazim fungicides often develops under high pressure of FHB and fungicide use, leading to serious economic loss (Wang et al., 2002).

Resistance to MBC fungicides has been detected in many fungal species. In most cases, resistance is correlated with point mutations in the β-tubulin gene, which results in altered amino acid sequences at the benzimidazole-binding site (Ma et al., 2005). However, the mechanism of resistance to carbendazim in F. graminearum is different (Li et al., 2003; Chung et al., 2008). Previous studies show that resistance of F. graminearum to carbendazim is mainly caused by point mutations in the β2-tubulin gene (FGSG_06611·3) (Chen, 2004; Chen et al., 2008). The results reveal that alterations either at amino acid codons 167 or 200 in β2-tubulin (phenylalanine converted to tyrosine at both codons; TTT[RIGHTWARDS ARROW]TAT at codon 167, TTC[RIGHTWARDS ARROW]TAC at codon 200; F167Y, F200Y) are linked to moderate carbendazim resistance.

To predict the increase of fungicide resistance and to use fungicide and other disease control tactics effectively, researchers must develop methods to detect resistance early. Because of single nucleotide polymorphisms (SNPs) associated with resistance to the MBC-group fungicides in F. graminearum, a method for SNPs analysis is needed to detect mutations related to resistance. There are several common techniques for SNPs analysis, such as DNA direct sequencing, allele-specific PCR (AS-PCR; Ma et al., 2003), denaturing high performance liquid chromatography (DHPLC; Baumler et al., 2003), PCR-restriction fragment length polymorphism (PCR-RFLP; Ma et al., 2005), and TaqMan-MGB (Saito et al., 2003). PCR-RFLP, which is based on the alteration of a restriction enzyme site caused by a point mutation, is a rapid, easy, and cost-effective technique to detect point mutations. However, some target DNA fragments may lack a restriction enzyme recognition sequence. In these cases, primer-introduced restriction analysis PCR (PIRA-PCR) becomes a useful method to detect single nucleotide mutations (Haliassos et al., 1989; Kanae et al., 2005; Sakamoto et al., 2008). PIRA-PCR first introduces an artificial restriction site in any gene lacking a restriction site near the mutation nucleotide (using primers containing mismatches) and then uses restriction fragment length polymorphism (RFLP) analysis (Haliassos et al., 1989; Ke et al., 2001).

The point mutation at codon 167 in the β2-tubulin gene of F. graminearum lacks a nearby restriction enzyme recognition site. To increase the sensitivity and efficiency of PCR, the current study combined PIRA-PCR and nested PCR to detect carbendazim-resistant isolates of F. graminearum. This method successfully differentiated between moderately resistant and sensitive isolates. In addition, the genotypes were obtained by analyzing the electrophoresis patterns.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fungal isolates

A total of 26 isolates of F. graminearum were collected from infected wheat spikelets originating from different fields in Jiangsu and Zhejiang Provinces of China (Table 1). The isolates were incubated on potato dextrose agar (PDA) plates at 25°C. Single-spore isolates were obtained and maintained at 4°C on PDA.

Table 1.   The origin and phenotype (sensitivity to carbendazim) of Fusarium graminearum, and the correlation between phenotype and the mutant of β2-tubulina in this paper
PhenotypebNumber of isolatesNames of isolatesOriginCodon numberc
167200
  • a

    The correlation between phenotype and the mutant of β2-tubulin is according to Chen et al. (2008) and sequence of β2-tubulin gene.

  • b

    CS and CMR indicate sensitivity and moderate resistance to carbendazim, respectively.

  • c

    Location of amino acid with mutant nucleotide in β2-tubulin. Characters in frames are mutant nucleotide.

CS 2ZF-43, ZF-21Haining City, Zhejiang ProvinceTTTTTC
CS10S1–S10Tongzhou City, Jiangsu Province
CMR 2ZF-52, ZF-54Haining City, Zhejiang ProvinceT A TTTC
CMR10R1–R10Jiangsu Province
CMR 2NT-7, t1Jiangsu ProvinceTTTT A C

Carbendazim susceptibility assay

Carbendazim was provided by the Shenyang Academy of Chemistry and Industry (China). The fungicide was dissolved in 0·1 m hydrochloric acid (HCl) and adjusted to 10 mg mL−1. Carbendazim was added to the PDA medium after sterilization to produce concentrations of 0, 1·4, 50 or 100 µg mL−1 medium. To determine the sensitivity of F. graminearum to carbendazim, one 5-mm mycelial plug taken from the edge of a 3-day-old colony of each single-spore isolate was placed on PDA plates amended with carbendazim at each of the above concentrations. There were three replicate plates for each concentration, and the experiment was performed twice. After the plates had been incubated at 25°C for 5 days, radial growth was assessed. According to previous studies (Yuan & Zhou, 2005; Chen et al., 2007), the isolates were classified into three phenotypes: sensitive isolates (CS, which could grow on PDA medium without carbendazim but which were completely inhibited by 1·4 µg mL−1 carbendazim); moderately resistant isolates (CMR, which could grow quickly at 1·4 µg mL−1 and slowly at 50 µg mL−1 but which were completely inhibited at 100 µg mL−1); and highly resistant isolates (CHR, which could grow at 100 µg mL−1).

DNA extraction

The 26 isolates were grown at 25°C on PDA for 5 days. Mycelia were harvested and ground to a fine powder in the presence of liquid nitrogen for DNA extraction. DNA was extracted and purified according to the CTAB method of Nicholson & Parry (1996). Using the methods described by Edwards et al. (2001), 50 samples of DNA were also extracted from the diseased wheat spikelets that had been collected for isolation of F. graminearum.

Design of inner and outer primers

The outer primers were created based on F. graminearum DNA for β2-tubulin (FGSG_06 611·3) according to the position of point mutations in resistant isolates. The forward primer NoF anneals to nucleotide positions 657 to 675 (19 bp) of β2-tubulin, and the reverse primer NoR anneals to nucleotide positions 991 to 1012 (22 bp); the resulting PCR product is 356 bp (Table 2).

Table 2.   Nucleotide sequence of primers used in PCR amplification of fragments of the β2-tubulin gene from Fusarium graminearum
Name of primerNucleotide sequence of primerPCR product
  • a

    Primer Hind3F was designed from nucleotides of β2-tubulin in positions 793–812 (20 bp); nucleotide A substituted for nucleotide C at position 808 and G substituted for C at position 810.

NoF5′ AAGCCATTGATGTTGTTCG 3′356 bp
NoR5′ CATGACGGTAGAAATCAGGTAG 3′ 
Hind3Fa5′ CGATCGCATAATGGCAAGCT 3′164 bp
Hind3R5′ GGGTCCTCTCGTAGATATCGTACA 3′ 

For nested PCR amplification, a pair of inner primers was designed. The forward primer Hind3F anneals to nucleotide positions 793 to 812 (20 bp) of β2-tubulin, in which nucleotide A substituted for nucleotide C at position 808, and nucleotide G substituted for nucleotide C at position 810. The mismatched primer creates an artificial restriction site (AAGCTT) for restriction enzyme HindIII in isolates non-mutated at codon 167 in β2-tubulin. The reverse primer Hind3R anneals to nucleotide position 933 to 956 (24 bp). The resulting PCR product is 164 bp (Table 2).

PCR assay

The outer PCR primer pair NoF + NoR (Table 2) was used to amplify a fragment of the β2-tubulin gene from the genomic DNA of F. graminearum. The PCR reactions were conducted in a 50-µL volume containing 0·4 mm of each dNTP, 1·5 mm magnesium chloride, 0·2 µm of each primer, 1 × PCR buffer and 1·25 U Taq Polymerase.

The PCR amplifications were carried out in a PTC 200 thermocycler (MJ Research, Inc.) using the following parameters: initial denaturation at 94°C for 5 min; followed by 35 cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 30 s; and a final extension at 72°C for 5 min. PCR products were electrophoresed through a 2% agarose gel in 0·5 × TBE buffer. The gels were stained with ethidium bromide and photographed under ultra-violet light in a Gel Documentation System (Bio-Rad, Inc.).

After being diluted 50 times, the resulting PCR product was used as template DNA for nested PCR amplification using the inner primer pair Hind3F + Hind3R (Table 2). The PCR reaction mixtures were the same as for the first PCR amplification. The thermocycling conditions for the nested PCR were 94°C for 5 min; followed by 35 cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 30 s; and a final extension at 72°C for 5 min. PCR products were electrophoresed through a 2% agarose gel in 0·5 × TBE buffer and purified by the AxyPrep PCR Cleanup Kit (Axygen, Inc.).

Molecular detection of carbendazim-resistant isolates

Molecular diagnostic assays were based on the fact that the PCR products from different alleles could be digested to produce different patterns (different fragment lengths) by a restriction enzyme. The purified PCR products obtained by the second round of PCR amplification were digested by restriction enzymes HindIII (MBI Fermentas) and TaaI (Tsp4CI; MBI Fermentas). Eight microlitres of PCR product was digested with 1 µL endonuclease (10 U µL−1) in 2 µL 10 × buffer R and 9 µL H2O for 1–3 h at 37°C for HindIII and in 2 µL 10 × buffer Tango and 9 µL H2O for 1–3 h at 65°C for TaaI. Digests were analyzed on 3% agarose gels in 0·5 × TBE buffer.

Comparison of two methods for detecting carbendazim-resistant isolates of F. graminearum

A total of 50 random samples of infected kernels were collected from Jiangsu Province. One isolate of F. graminearum was obtained from each sample, and its sensitivity to carbendazim was tested by the conventional method (growth on carbendazim-amended PDA, as described earlier) and by PIRA-PCR. According to the results of PIRA-PCR, three samples per genotype were randomly selected and then sequenced to validate that the selected isolates had the expected genotypes.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Susceptibility of Fusarium graminearum isolates to carbendazim

Based on radial growth on PDA amended with 0, 1·4, 50 or 100 µg mL−1 of carbendazim, 12 of the 26 isolates were classified as sensitive (CS) and 14 were classified as moderately resistant (CMR) (Table 1). None of the isolates were highly resistant.

PCR analysis

As expected, the outer primer pair NoF + NoR amplified a 356 bp DNA fragment from genomic DNA of F. graminearum in the first round of PCR. The first-round PCR product then served as template for the PIRA-PCR. An expected 164 bp DNA fragment was obtained by PCR with the inner primer pair Hind3F + Hind3R.

Restriction analysis

The final PCR product amplified by primer pair Hind3F + Hind3R was digested by restriction enzyme HindIII and TaaI. The mismatched primer Hind3F introduced a HindIII recognition site into the PIRA-PCR product of isolates non-mutated at codon 167 (Fig. 1). The HindIII digested the 164 bp PCR product from isolates non-mutated at codon 167 into two fragments of 16 and 148 bp, but the 16 bp fragment was too short to show on agarose gels. In contrast, the enzyme did not digest the PCR product of isolates with a mutation at codon 167 (Fig. 2a). A TaaI recognition site exists in the 164 bp fragment from all isolates, but one more recognition site (ACTGT) exists in the isolates with a mutation at codon 200 (TTC[RIGHTWARDS ARROW]TAC) (Fig. 1). With TaaI, the 164-bp PCR product of isolates with a mutation at codon 200 was digested into 42, 55, and 67 bp fragments, while the PCR products of other isolates were digested into 55 and 109 bp fragments (Fig. 2b).

image

Figure 1.  Schematic presentation of primer-introduced restriction analysis (PIRA)-PCR method to detect moderate resistance to carbendazim in Fusarium graminearum. The underlined sequence is the primer Hind3F, which introduces an artificial HindIII recognition site. Primer characters in bold are mismatched nucleotides. Characters in frames are the SNP position. The distance between restriction sites is not to scale.

Download figure to PowerPoint

image

Figure 2.  Restriction patterns of β2-tubulin fragments from Fusarium graminearum digested by restriction enzymes. M, 20 bp marker. Lanes 1–3, isolates ZF43, ZF52 and NT-7, respectively. a), HindIII digest: fragments in lanes 1 and 3 are 16 and 148 bp, but the 16-bp fragment is too short to show on 3% agarose gel; lane 2 is 164 bp. b), TaaI digest: fragments in lanes 1 and 2 are 55 and 109 bp, and fragments in lane 3 are 42, 55 and 67 bp.

Download figure to PowerPoint

The results of restriction analysis by PIRA-PCR showed that the PCR product of carbendazim-sensitive isolates can be digested by HindIII and into two fragments (55 and 109 bp) by TaaI, while the product of carbendazim-resistant isolates mutated at codon 167 (CMR) can only be digested by TaaI. The PCR products of resistant isolates mutated at codon 200 (CMR) can be digested into three fragments (42, 55 and 67 bp) by TaaI (Fig. 2).

Comparison of two methods for detecting carbendazim-resistant isolates of F. graminearum

Fifty randomly selected F. graminearum isolates from Jiangsu Province were tested for carbendazim resistance by the conventional method (growth on fungicide-amended agar) and by PIRA-PCR. As indicated in Table 3, the two methods produced identical results. Out of 50 isolates, 14 were classified as moderately resistant (CMR). Whilst the conventional method required more than 5 days, PIRA-PCR required less than half a day. Moreover, the genotypes of the isolates were obtained from the PIRA-PCR (Table 4). Ten moderately carbendazim-resistant isolates were identified as the β2-tubulin variant F167Y and four as F200Y. Three samples randomly selected from each genotype were sequenced. The sequence results agreed with the restriction analysis (Table 4).

Table 3.   Comparison of two methods for detecting carbendazim resistance in Fusarium graminearum isolates
MethodNumber of isolates testedNumber of CMRaNumber of CSDetection Period
  • a

    CS and CMR are sensitive and moderately resistant to carbendazim, respectively.

  • b

    Primer-introduced restriction analysis PCR.

Mycelial growth test5014365–7 days
PIRA-PCRb5014367–8 hours
Table 4.   The genotype of Fusarium graminearum as determined by primer-introduced restriction analysis (PIRA)-PCR
PhenotypeaNumber of isolatesCodon numberb
167200
  • a

    CS and CMR are sensitive and moderately resistant to carbendazim, respectively.

  • b

    Location of amino acid with mutant nucleotide in β2-tubulin. Characters in frames are mutant nucleotide.

CS36TTTTTC
CMR10T A  TTTC
CMR 4TTTT A C

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

In this study, the level of resistance to carbendazim by F. graminearum isolates was determined by a conventional method and by the PIRA-PCR method. The results clearly demonstrate that PIRA-PCR is rapid and effective in detecting moderate resistance of the fusarium head blight fungus to carbendazim. The results also demonstrate that PIRA-PCR correctly genotypes the mutation codons in the β2-tubulin gene.

The most commonly used method for monitoring resistance of F. graminearum to MBC fungicides is based on the measurement of mycelial growth on PDA plates amended with the fungicide (Zhou et al., 1994). This conventional method is relatively labour-intensive and time-consuming. Results from the conventional method cannot be obtained rapidly enough to guide growers on selection of fungicides, especially when large numbers of isolates require testing. Thus, a method like PIRA-PCR that can rapidly detect point mutations is advantageous.

Compared with other available methods, PIRA-PCR has considerable advantages. It is based on simple techniques of molecular biology and requires only basic PCR and enzymatic restriction reagents, a thermocycler, and an electrophoresis apparatus. The equipment is relatively low priced, easy to acquire, and inexpensive to maintain. Additionally, PIRA-PCR assays are robust, requiring little optimization. Although the techniques of DNA direct sequencing, DHPLC and TaqMan-MGB are more sensitive or accurate, they cannot be routinely used because of their high cost. AS-PCR is relatively simple and rapid, but it is difficult to standardize the assay protocol and not completely specific, and can even lead to misidentification of alleles (Newton et al., 1989; Pinto et al., 2006).

Because there is no restriction enzyme recognition site around the point mutation at codon 167 of the β2-tubulin gene, an artificial restriction site is introduced by designing a mismatched primer. Primer-template mismatches are known to reduce binding energy and the efficiency of product amplification. Some primer-template mismatches at the 3′-end of the primer, such as G-A, G-G, and C-C, are more refractory to extend and may even completely inhibit extension and abolish amplification (Kwok et al., 1990; Little, 1997). An adjacent mismatched base near the 3′-end will also increase the refractory effect (Kwok et al., 1990; Cha et al., 1992). To introduce an appropriate restriction enzyme recognition site, the primer Hind3F was designed with two mismatches, which can strongly reduce the efficiency of amplification. However, a nested PCR step such as that used by Jacobson & Moskovits (1991) and Kaku et al. (2003) was used to ensure the reliability of acquiring the PCR product with the primer-introduced HindIII recognition site.

Primer design is critical for successful PIRA-PCR. The mismatched bases should be near the 3′-end of the primer, and the base amount should be limited. For analysis of the profiles with agar electrophoresis, the length of PCR products should be 100–200 bp. Primers for PIRA-PCR can be designed on a web site (Ke et al., 2001). Another requirement is that only Taq polymerase lacking proof reading activity can be used for PIRA-PCR (Newton et al., 1989; Kanae et al., 2005).

According to Chen et al. (2008), isolates of F. graminearum mutated at amino-acid codons 167, 198 or 200 in the β2-tubulin gene have different phenotype sensitivities. A point mutation (F167Y or F200Y) leads to a moderate resistance level to carbendazim, and another mutation (GAG[RIGHTWARDS ARROW]CTG, E198 L) results in a high resistance level. PIRA-PCR can only identify moderately carbendazim-resistant isolates with β2-tubulin variants F167Y or F200Y in this study. However, among field carbendazim-resistance isolates, moderate resistance (F167Y and F200Y) is dominant and the mutation at codon 198 is rare (unpublished data).

In conclusion, single nucleotide changes in the β2-tubulin gene permitted the development of a PIRA-PCR method that distinguished moderately carbendazim-resistant from sensitive isolates of F. graminearum. This rapid and precise molecular diagnostic assay was standardized according to the correlation between the phenotype and genotype of isolates. PIRA-PCR can also be adapted to work with new SNPs and can be improved by combining with direct sequencing to detect unknown mutations. Thus, PIRA-PCR has a potential application in management of carbendazim resistance in F. graminearum and will help researchers and growers select the best antifungal strategy to use in the field.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was supported by the state 973 and 863 programs from the Ministry of Science and Technology of China (No. 2006CB101907 and 2008AA10Z414) and by the Natural Science Foundation of China (No. 30671384). Some work was supervised by Dr Derek Hollomon from the University of Bristol, UK.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Bai G, Shaner G, 1994. Scab of wheat: prospects for control. Plant Disease 78, 7606.
  • Baumler S, Felsenstein FG, Schwarz GS, 2003. CAPS and DHPLC analysis of a single nucleotide polymorphism in the cytochrome b gene conferring resistance to strobilurins in field isolates of Blumeria graminis f. sp. hordei. Journal of Phytopathology 151, 14952.
  • Cha RS, Zarbl H, Keohavong P, Thilly WG, 1992. Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene. Genome Research 2, 1420.
  • Chen CJ, 2004. Cloning Carbendazim-Resistance Gene of Fusarium graminearum. Nanjing, China: Nanjing Agricultural University, PhD thesis.
  • Chen CJ, Wang JX, Luo QQ, Yuan SK, Zhou MG, 2007. Characterization and fitness of carbendazim-resistant strains of Fusarium graminearum (Wheat Scab). Pest Management Science 63, 12017.
  • Chen CJ, Bi CW, Yu JJ et al ., 2008. Carbendazim-resistance and its molecular mechanism in Gibberella zeae. Journal of Plant Pathology 90 (Suppl. 2), 69.
  • Chung WH, Ishii H, Nishimura K, Ohshima M, Iwama T, Yoshimatsu H, 2008. Genetic analysis and PCR-based identification of major Fusarium species causing head blight on wheat in Japan. Journal of General Plant Pathology 74, 36474.
  • Edwards SG, Pirgozliev SR, Hare MC, Jenkinson P, 2001. Quantification of trichothecene-producing Fusarium species in harvested grain by competitive PCR to determine efficacies of fungicides against Fusarium head blight of winter wheat. Applied and Environmental Microbiology 67, 157580.
  • Haliassos A, Chomel JC, Grandjouan S, Kruh J, Kaplan JC, Kitzis A, 1989. Detection of minority point mutations by modified PCR technique: a new approach for a sensitive diagnosis of tumor-progression markers. Nucleic Acids Research 17, 80939.
  • Jacobson DR, Moskovits T, 1991. Rapid, nonradioactive screening for activating ras oncogene mutations using PCR-primer introduced restriction analysis (PCR-PIRA). Genome Research 1, 1468.
  • Kaku K, Takagaki M, Shimizu T, Nagayama K, 2003. Diagnosis of dehydratase inhibitors in melanin biosynthesis inhibitor (MBI-D) resistance by primer-introduced restriction enzyme analysis in scytalone dehydratase gene of Magnaporthe grisea. Pest Management Science 59, 8436.
  • Kanae Y, Endoh D, Nagahata H, Hayashi M, 2005. A method for detecting complex vertebral malformation in Holstein calves using polymerase chain reaction-primer introduced restriction analysis. Journal of Veterinary Diagnostic Investigation 17, 25862.
  • Ke X, Collins A, Ye S, 2001. PIRA PCR designer for restriction analysis of single nucleotide polymorphisms. Bioinformatics 17, 8389.
  • Kwok S, Kellogg DE, McKinney N et al ., 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Research 18, 9991005.
  • Li HX, Lu YJ, Wang JX, Zhou MG, 2003. Cloning of β-tubulin gene from Gibberella zeae and analysis its relationship with carbendazim resistance. Acta Microbiologica Sinica 43, 4249.
  • Little S, 1997. ARMS analysis of point mutations. In: TaylorGR, ed. Laboratory Methods for the Detection of Mutations and Polymorphisms in DNA. Boca Raton, FL, USA: CRC Press, 4551.
  • Lu YJ, Cheng SH, Wang YZ, 2001. Research on Wheat Fusarium Head Blight. Beijing, China: Scientific Press.
  • Ma ZH, Yoshimura MA, Michailides TJ, 2003. Identification and characterization of benzimidazole resistance in Monilinia fructicola from stone fruit orchards in California. Applied and Environmental Microbiology 69, 714552.
  • Ma ZH, Yoshimura MA, Holtz BA, Michailides TJ, 2005. Characterization and PCR-based detection of benzimidazole-resistant isolates of Monilinia laxa in California. Pest Management Science 61, 44957.
  • Newton CR, Graham A, Heptinstall LE et al ., 1989. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Research 17, 250316.
  • Nicholson P, Parry DW, 1996. Development and use of a PCR assay to detect Rhizoctonia cerealis, the cause of sharp eyespot of wheat. Plant Pathology 45, 87283.
  • Pinto J, Lynd A, Elissa N et al ., 2006. Co-occurrence of East and West African kdr mutations suggests high levels of resistance to pyrethroid insecticides in Anopheles gambiae from Libreville, Gabon. Medical and Veterinary Entomology 20, 2732.
  • Saito K, Miyake S, Moriya H et al ., 2003. Detection of the four sequence variations of MDR1 gene using TaqMan-MGB probe based real-time PCR and haplotype analysis in healthy Japanese subjects. Clinical Biochemistry 36, 5118.
  • Sakamoto M, Tomita R, Hamada H, Iwadate I, Munemura I, Kobayashi K, 2008. A primer-introduced restriction analysis-PCR-based method to analyse Pepper mild mottle virus populations in plants and field soil with respect to virus mutations that break L3 gene-mediated resistance of Capsicum plants. Plant Pathology 57, 82533.
  • Wang JX, Zhou MG, Lu YJ, Ye ZY, 2002. Dynamics of resistant population of Fusarium graminearum to carbendazim and substitutable fungicide screening. Journal of Nanjing Agricultural University 25, 437.
  • Yao J, Lu W, 2000. Research advances in wheat breeding for scab resistance in China. Jiangsu Journal of Agricultural Science 16, 2428.
  • Yuan SK, Zhou MG, 2005. A major gene for resistance to carbendazim, in field isolates of Gibberella zeae. Canadian Journal of Plant Pathology 27, 5863.
  • Zhou MG, Ye ZY, Liu JF, 1994. Progress of fungicide resistance research. Journal of Nanjing Agricultural University 17, 3341.