SEARCH

SEARCH BY CITATION

Keywords:

  • Actinidia spp.;
  • argK gene;
  • bacterial canker;
  • biosecurity;
  • multilocus sequence analysis;
  • quarantine

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Several published polymerase chain reaction (PCR) primers to identify Pseudomonas syringae pv. actinidiae, the causal organism of bacterial canker of kiwifruit, were found not to be specific. Two new sets of PCR primers, PsaF1/R2 and PsaF3/R4, were designed to be complementary to a portion of the 16S–23S rDNA intertranscribed spacer (ITS) regions. These primers amplified a DNA fragment from strains of P. syringae pv. actinidiae, but not from 56 strains of bacteria from six genera and 17 species, except for a strain of the tea pathogen, P. syringae pv. theae. When tested against DNA extracted from a further 20 strains from Japan, Korea, Italy and the USA deposited in culture collections as P. syringae pv. actinidiae, all except six cultures produced the expected product of 280 bp with PsaF1/R2 and 175 bp with PsaF3/R4. Results of multilocus sequence analysis using five housekeeping genes (gyrB, acnB, rpoD, pgi and cts) showed that none of these six strains was phylogenetically similar to P. syringae pv. actinidiae. In contrast to the P. syringae pv. actinidiae type strain, these strains were positive in the determinative tests for ice nucleation and syringomycin production. It is suggested that these six strains were incorrectly identified as P. syringae pv. actinidiae. It was not possible to distinguish P. syringae pv. actinidiae from the phylogenetically similar P. syringae pv. theae using the ITS, gyrB, acnB, rpoD, pgi or cts gene regions to design PCR primers. Because P. syringae pv. theae is unlikely to be found on kiwifruit, primers PsaF1/R2 and PsaF3/R4 are recommended for screening bacteria isolated from kiwifruit tissue.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Pseudomonas syringae pv. actinidiae is a pathogen of kiwifruit (Actinidia deliciosa, A. chinensis and A. arguta) first recorded in the Shizua Prefecture of Japan in 1984 (Serizawa et al., 1989). It was subsequently found to cause bacterial canker disease of kiwifruit in South Korea (Koh & Lee, 1992) and Italy (Scortichini, 1994). Bacterial canker symptoms were also observed on kiwifruit in China (Li et al., 2004). Bacterial canker is one of the most serious kiwifruit diseases limiting production in Japan and Korea (Koh & Nou, 2002). There is also a record of “Pseudomonas canker” of kiwifruit from California (Opgenorth et al., 1983) and “bacterial canker” from Iran (Mazarei & Mostofipour, 1994). In both cases the causal agent was identified as P. syringae pv. syringae (Mazarei & Mostofipour, 1994; Koh & Nou, 2002).

Bacterial canker symptoms have not been observed on kiwifruit vines in New Zealand, and the disease is not reported to be present. A study in Kumeu, New Zealand (Everett & Henshall, 1994) found that a number of other pseudomonad species were associated with kiwifruit during flowering, including the causal organism for blossom blight (Pseudomonas viridiflava). These were identified by LOPAT tests (Lelliott et al., 1966) as P. syringae LOPAT 1a and 1b, P. viridiflava LOPAT 2, Pseudomonas marginalis LOPAT 4a and 4b and Pseudomonas fluorescens LOPAT 5a and 5b. Later studies showed that the kiwifruit blossom blight pathogen from New Zealand was more closely aligned with Pseudomonas savastanoi than with P. viridiflava, as it was originally described (Wilkie et al., 1973), but was dissimilar to P. syringae pv. actinidiae on the basis of DNA hybridization and a number of biochemical tests (Young et al., 1997; Hu et al., 1998). The pseudomonad strain from kiwifruit causing blossom blight has since been referred to as Pseudomonas sp. (Young & Fletcher, 1997; Hu et al., 1999). Elsewhere, blossom blight is caused by a strain of P. syringae pv. syringae (Koh et al., 2003).

New Zealand has a kiwifruit breeding programme for which germplasm is routinely imported. Reliable detection methods are required to allow screening of imported material to ensure that New Zealand remains free of P. syringae pv. actinidiae. PCR primer sets designed to detect this bacterium have been selected from the products of random amplification of polymorphic DNA (RAPD) PCR reactions (KNF/KNR) (Koh & Nou, 2002), or are complementary to a region of the 16S rDNA gene (PAV1/P22) (Scortichini et al., 2002), or to the argK gene (OCTF/OCTR) (Sawada et al., 2002). In this study these primer sets were tested against other bacterial genera, other pseudomonad species and pathovars found in kiwifruit orchards in New Zealand, other pathovars and species of Pseudomonas, and several strains of P. syringae pv. actinidiae from international collections. Alternative PCR primers used to amplify the argK gene (Templeton et al., 2005) were also considered. A set of primers was designed to the ITS region of the rDNA gene and tested. Six atypical strains were studied in more detail using analysis of the ITS sequence, multilocus sequence typing analysis (MLSA) and selected biochemical and biological tests.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains and plasmids

The bacterial strains used for designing and validating PCR primers in this study (listed in Tables 1 and 2) included the pathotype of P. syringae pv. actinidiae (ICMP 9617) from Japan, other strains deposited as P. syringae pv. actinidiae from the International Collection of Micro-organisms from Plants (ICMP), Manaaki Whenua Landcare Research, Auckland, New Zealand, the Korean Agricultural Culture Collection (KACC), Suwon, Republic of Korea, the National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki 305-8602, Japan, the National Collection of Plant Pathogenic Bacteria (NCPPB), Food and Environment Research Agency, Sand Hutton, York, UK and the Culture Collection of Plant Pathogenic Bacteria (PD), Plant Protection Service, Wageningen, the Netherlands. Strains of P. fluorescens, P. marginalis, Pseudomonas sp. and P. syringae, representing pseudomonads commonly isolated from kiwifruit orchards in New Zealand (Everett & Henshall, 1994), as well as representative strains of pseudomonads from other crops in New Zealand and several other bacterial genera, were also included (Table 1). Escherichia coli strains DH5α (Amersham Bio-Sciences) and ElectroMAX DH10B (Invitrogen) were used as hosts for subcloning. The pGEM-T easy vector (Promega) was used as the vector for subcloning the PCR product of the 16S rRNA gene. Escherichia coli DH5α and DH10B were grown at 37°C in Luria broth (LB) or on Luria agar. When required, ampicillin was added at 50 μg mL−1. Geotrichum candidum ICMP 5442 was used as an indicator of syringomycin production. Positive and negative controls for the ice-nucleation and syringomycin-production assays were, respectively: P. syringae pv. actinidiae ICMP 9855 and ICMP 9617 and P. syringae pv. syringae 3-76.

Table 1.   Bacterial strains used in this study for comparisons in polymerase chain reaction tests. Some strains (indicated by *) were used in biochemical tests and/or sequence analysis
SpeciesCulture numberHostCountry of origin
  1. aCulture received as Erwinia carnegieana [now considered to be a nomen dubium (Alcorn & Orum, 1988)].

  2. cRK Taylor, unpublished client reports.

Agrobacterium rhizogenesICMP 3379soilAustralia
Agrobacterium rhizogenesICMP 8304soilNew Zealand
Agrobacterium rhizogenesICMP 8308soilNew Zealand
Clavibacter michiganensis subsp. michiganensisICMP 2551Solanum lycopersicumBrazil
Clavibacter michiganensis subsp. michiganensisICMP 2354Solanum lycopersicumNew Zealand
Erwinia amylovoraICMP 8865Malus domesticaNew Zealand
Erwinia amylovoraICMP 12365Stranvaesia sp.New Zealand
Klebsiella pneumoniaeaICMP 5701Carnegiea giganteaUSA
Erwinia carotovora subsp. carotovoraICMP 11523Zantedeschia elliotianaNew Zealand
Erwinia carotovora subsp. carotovoraICMP 11524Zantedeschia elliotianaNew Zealand
Erwinia chrysanthemiICMP 6926Apium graveolens var. dulceNew Zealand
Erwinia chrysanthemiICMP 6928Apium graveolens var. dulceNew Zealand
Pantoea agglomeransEh252bMalus domesticaNew Zealand
Pantoea agglomeransD4cPrunus persica var. nucipersicaNew Zealand
Escherichia coliJM 109  
Pseudomonas cichoriiICMP 3521Apium graveolens var. dulceNew Zealand
Pseudomonas cichoriiICMP 5707Cichorium endiviaGermany
Pseudomonas corrugataICMP 5819Solanum lycopersicumUK
Pseudomonas corrugataICMP 8898Solanum lycopersicumNew Zealand
Pseudomonas fluorescens526dActinidia deliciosaNew Zealand
Pseudomonas fluorescens599dActinidia deliciosaNew Zealand
Pseudomonas marginalisICMP 8127Allium cepaNew Zealand
Pseudomonas marginalisICMP 9503Actinidia deliciosaNew Zealand
Pseudomonas marginalis754dActinidia deliciosaNew Zealand
Pseudomonas syringae pv. papulansICMP 4043Malus domesticaUSA
Pseudomonas syringae pv. papulansICMP 4055Malus domesticaCanada
Pseudomonas syringae pv. phaseolicolaICMP 4612Phaseolus vulgarisNew Zealand
Pseudomonas syringae pv. phaseolicolaICMP 6796Phaseolus vulgarisNew Zealand
Pseudomonas syringae pv. phaseolicolaICMP 6797Phaseolus vulgarisNew Zealand
Pseudomonas syringae pv. phaseolicolaICMP 6831Phaseolus vulgarisNew Zealand
Pseudomonas syringae pv. actinidiae*ICMP 9617Actinidia deliciosaJapan
Pseudomonas syringae pv. actinidiae*ICMP 9855Actinidia deliciosaJapan
Pseudomonas syringae415dActinidia deliciosaNew Zealand
Pseudomonas syringae pv. syringaeICMP 2443Cucurbita maximaNew Zealand
Pseudomonas syringae pv. syringaeICMP 3676Prunus aviumNew Zealand
Pseudomonas syringae pv. syringaeICMP 3938Cucurbita maximaNew Zealand
Pseudomonas syringae pv. syringaeICMP 4268Solanum lycopersicumNew Zealand
Pseudomonas syringae pv. syringaeICMP 4610Solanum lycopersicumNew Zealand
Pseudomonas syringae pv. syringaeICMP 5823Cucumis sativusNew Zealand
Pseudomonas syringae pv. theaeICMP 3923Camellia sinensisJapan
Pseudomonas syringae pv. syringae*3-76ewaterNew Zealand
Pseudomonas syringae pv. tomatoICMP 3449Solanum mauritianumNew Zealand
Pseudomonas syringae pv. tomatoICMP 4259Solanum lycopersicumNew Zealand
Pseudomonas syringae pv. tomatoICMP 4608Solanum lycopersicumNew Zealand
Pseudomonas syringae pv. tomatoICMP 9501Solanum muricatumNew Zealand
Pseudomonas sp.ICMP 8934Actinidia deliciosaNew Zealand
Pseudomonas sp.ICMP 8952Actinidia deliciosaNew Zealand
Pseudomonas sp.*ICMP 3272Actinidia deliciosaNew Zealand
Pseudomonas viridiflavaICMP 11126Brassica chinensisChina
Xanthomonas campestris pv. phaseoliICMP 2722Phaseolus vulgarisNew Zealand
Xanthomonas campestris pv. phaseoliICMP 3403Phaseolus vulgarisNew Zealand
Xanthomonas campestris pv. populiICMP 9367Populus × generosaNew Zealand
Xanthomonas campestris pv. populiICMP 9369Populus × generosaNew Zealand
Xanthomonas campestris pv. pruni96·08cPrunus armeniacaNew Zealand
Xanthomonas campestris pv. pruni2·40cPrunus persica var. nucipersicaNew Zealand
Xanthomonas campestris pv. vesicatoriaICMP 7383Solanum lycopersicumNew Zealand
Xanthomonas campestris pv. vesicatoria18gcSolanum lycopersicumNew Zealand
Xanthomonas sp.36AfOlea europaeaNew Zealand
Xanthomonas sp.36BfOlea europaeaNew Zealand
Table 2.   Strains described as Pseudomonas syringae pv. actinidiae tested in polymerase chain reactions with primers PsaF1/R2, PsaF3/R4 and ArgKF3/ArgKR. Strains that produced product are marked with a + sign. Some strains (indicated by *) were also used in biochemical tests and/or sequence analysis
StrainAlternative nameIsolated byHostCountry of originReferenceArgKF3/ArgKRPsaF1/R2, PsaF3/R4
  1. aICMP, International Collection of Micro-organisms from Plants, Manaaki Whenua Landcare Research, Auckland, New Zealand.

  2. bKACC, Korean Agricultural Culture Collection, Suwon, Republic of Korea.

  3. cNIAS, National Institute of Agrobiological Sciences, 2-1-2 Kannondai, Tsukuba Ibaraki 305-8602, Japan.

  4. dNCPPB, National Collection of Plant Pathogenic Bacteria, Food and Environment Research Agency, Sand Hutton, York, UK.

  5. ePD, Culture Collection of Plant Pathogenic Bacteria, Plant Protection Service, Wageningen, the Netherlands.

ICMPa 9617*Kw-11Y. TakikawaActinidia deliciosaJapanTakikawa et al. (1989)++
ICMP 9853Kw-1Y. TakikawaA. deliciosaJapanTakikawa et al. (1989)++
ICMP 9854Kw-30Y. TakikawaA. deliciosaJapanTakikawa et al. (1989)++
ICMP 9855Kw-41Y. TakikawaA. deliciosaJapanTakikawa et al. (1989)++
KACCb 10582*  A. chinensisKorea 
KACC 10584  A. chinensisKorea +
KACC 10594  A. chinensisKorea +
KACC 10659 Y. TakikawaA. chinensisJapanTakikawa et al. (1989)++
KACC 10660*  A. chinensisKorea 
KACC 10754  A. chinensisKorea +
NIASc 302091*FTRS-L1 A. deliciosaJapan ++
NIAS 302133Sar1 A. arguta Japan ++
NIAS 302134Sar2 A. argutaJapan ++
NIAS 302143Kiw 4 A. deliciosaJapan ++
NIAS 302145Wa1 A. deliciosaJapan ++
NIAS 302146Wa2 A. deliciosaJapan ++
NCPPBd 3871*ISPAVE-B-020M. ScortichiniA. deliciosaItalyScortichini (1994)
NCPPB 3873*ISPAVE-B-019M. ScortichiniA. deliciosaItalyScortichini (1994)
PDe 2766* E. LittleA. chinensisUSA 
PD 2774* E. LittleA. chinensisUSA 

The strains P. syringae pv. actinidiae ICMP 9617 and ICMP 9855 were used in all PCR tests with primer pairs PAV1/P22, OCTF/OCTR, KNF/KNR, ArgKF3/ArgKR, Psa F1/R2 and Psa F3/R4. The 20 strains deposited as P. syringae pv. actinidiae in international collections, including the six unusual strains that were not detected by primers Psa F1/R2 or Psa F3/R4 (Table 2), and strains ICMP 9617 and ICMP 9855, were tested in separate reactions by PCR primers Psa F1/R2, Psa F3/R4 and ArgKF3/ArgKR. The six unusual strains were also used in reactions with primer pairs P.s. ITSF1/R2 and KNF/KNR. Pseudomonas syringae pv. theae ICMP 3923 was used in PCR tests with primers Psa F1/R2, Psa F3/R4 and KNF/KNR. Four strains of P. syringae pv. phaseolicola: ICMP 4612, ICMP 6796, ICMP 6797 and ICMP 6831, were tested with primers ArgKF3/ArgKR, Psa F1/R2 and Psa F3/R4.

DNA extraction

Cultures for DNA extraction were grown overnight in LB at 26°C on a rotating shaker at a speed of 250 r.p.m. DNA was extracted using the DNeasy® Tissue Kit (Qiagen). DNA concentration and quality were determined using a NanoDrop® ND-1000 (NanoDrop Technologies) spectrophotometer and by gel electrophoresis on agarose (10 g L−1).

DNA sequence analysis and primer design

Multiple alignments from 16S–23S rRNA gene sequences of P. fluorescensEF198908, P. syringae pv. actinidiaeAY342165 and D86357, P. syringae pv. papulansAY342176 and AY342175, P. syringae pv. phaseolicola D86378 and D86379, P. syringae pv. pisiAY342177 and AY342178, P. syringae pv. syringaeAY342179, AY342181 and CP000075.1 and P. syringaeAY850196 were constructed with the program align x of vector nti version 9 (Invitrogen). Regions of variability were selected from the 16S–23S rRNA ITS region and three primer sets (P.s. ITSF1/R2, PsaF1/R2 and PsaF3/R4) were designed using primer3 (Whitehead Institute for Biomedical Research). The primers ArgKF3/ArgKR (Templeton et al., 2005), KNF/KNR (Koh & Nou, 2002), OCTF/OCTR (Sawada et al., 1997) and PAV1/P22 (Scortichini et al., 2002) were also tested. PCR primers used are listed in Table 3.

Table 3.   Primer sequence, genes utilized in design, expected product size and source
Primer pairSenseGeneProduct sizeSequence (5′–3′)Reference
PsaF1ForwardITS280 bpTTTTGCTTTGCACACCCGATTTTThis study
PsaR2ReverseCACGCACCCTTCAATCAGGATG
PsaF3ForwardITS175 bpACCTGGTGAAGTTGGTCAGAGCThis study
PsaR4ReverseCGCACCCTTCAATCAGGATG
P.s. ITSF1Forward16S-23S880 bpGTGATTCATGACTGGGGTGAThis study
P.s. ITSR2ReverseATAACCCCAAGCAATCTGGT
ArgKF3ForwardargK800 bpTCCCCCCGGGAGGAAATTCAATGAAGATTATempleton et al. (2005)
ArgKRReverseAACTGCAGTCAGGGGACGACTGTCTC
KNFForwardPutative lipoprotein492 bpCACGATACATGGGCTTATGCKoh & Nou (2002)
KNRReverseCTTTTCATCCACACACTCCG
OCTFForwardargK1098 bpTATTACCCTGATGAGCTCGASawada et al. (1997)
OCTRReverseGATGATCGACCTTGTTGACCTCCCG
PAV1Forward16S rRNA762 bpGGCGACGATCCGTAACTGGTCTGAGAScortichini et al. (2002)
P22ReverseTTCCCGAAGGCACTCCTCTATCTCTAAAG
16F27Forward16S rRNA1500 bpAGAGTTTGATCMTGGCTCAGLane (1991)
16R1525ReverseTTCTGCAGTCTAGAAGGAGGTGWTCCAGCC

PCR conditions for detection

All extracted bacterial DNA was tested for quality using universal 16S primers 16F27 and 16R1525 (Lane, 1991). The PCR reaction mixture (25 μL final volume) contained either 1 ng or 10 ng template DNA (both concentrations were used for every bacterial strain except for detection in the presence of plant tissue), primers at 0·5 μm each, dNTPs at 200 μm each, 0·31 U platinum Taq DNA polymerase (Invitrogen), Taq DNA polymerase buffer and 1·5 mm MgCl2. The 16S rRNA gene was amplified by placing the reaction mixture in a thermocycler (Techne) for an initial denaturation of 95°C for 2 min, followed by 30 cycles at 95°C for 15 s (denaturing), 55°C for 30 s (annealing) and 72°C for 1 min 30 s (elongation). Final elongation was 5 min at 72°C. The reaction conditions as described (Lane, 1991; Sawada et al., 1997; Koh & Nou, 2002; Scortichini et al., 2002; Sarkar & Guttman, 2004; Templeton et al., 2005) were used for published primers. Some lowering of annealing temperatures was required to obtain product following PCR using the primers of Sarkar & Guttman (2004). All other PCR products were amplified by an initial denaturation of 95°C for 2 min, followed by 30 cycles at 95°C for 30 s (denaturing), 65°C for 30 s (annealing) and 72°C for 30 s (elongation). Final elongation was at 72°C for 5 min.

PCR amplification and sequencing

The ITS region was amplified using the primer set P.s. ITSF1/R2 (Table 3). The PCR products were resolved by gel electrophoresis (10 g agarose L−1) and purified using a Molecular Biochemicals High Pure PCR Product Purification Kit (Roche Diagnostics). PCR products from P.s. ITSF1/R2 for six strains (NCPPB 3871, NCPPB 3873, PD 2766, PD 2774, KACC 10582 and KACC 10660) which did not produce a product with primers PsaF1/R2 or PsaF3/R4 were sequenced directly. PCR amplicons from strains NCPPB 3871, NCPPB 3873, PD 2766, PD 2774 and KACC 10582 were also cloned in pGEM T-Easy vectors (Promega) in DH5α. Purified plasmid DNA with ITS rRNA inserts was sequenced by the University of Waikato (Hamilton, New Zealand). Five housekeeping genes were sequenced for five of the six unusual strains using the methods described by Sarkar & Guttman (2004). KACC 10660 did not produce any product with the primers for these housekeeping genes. The genes sequenced were those encoding sigma factor 70 (rpoD), aconitate hydratase B (acnB), citrate synthase (cts), phosphoglucoisomerase (pgi) and gyrase (gyrB). Sequences from the gene regions rpoD, acnB, cts, pgi and gyrB were determined directly from PCR products and deposited in GenBank as GU058929GU058961.

DNA templates for sequencing were prepared using DYEnamicET dye terminator chemistry and M13 forward and reverse primers. DNA sequences were resolved using a MegaBACE 500 DNA Analysis System fitted with 40-cm capillary arrays (GE Healthcare) loaded with linear polyacrylamide Long Read Matrix.

ITS sequence analysis and multilocus sequence typing analysis

ITS sequences were analysed using Basic Local Alignment Search Tool (blast) from the National Center for Biotechnology Information (NCBI). Multiple alignments were perfomed with vector nti 9 (Invitrogen) including representative ITS sequences from GenBank (NCBI) for P. syringae pv. actinidiae (AY342165 and D86357).

Multilocus sequence typing analysis (MLSA) was conducted to study in more detail those strains from which PCR primers PsaF1/R2 and PsaF3/R4 did not amplify product. Three housekeeping genes (rpoD, cts and pgi) were amplified from all strains and were included in a concatenated phylogenetic analysis. Two housekeeping genes (acnB and gyrB) could not be amplified from all strains and were analysed separately. A further two housekeeping genes (gapA and pfk) could not be amplified from any of these six unusual strains.

Phylogenetic analysis

Analyses were performed on individual gene sequences as well as on the concatenated dataset using neighbour joining and maximum parsimony. Phylogenetic trees were generated by the DNA neighbour-joining algorithm using the phylip (Phylogeny Inference Package) program, version 3.65; branch robustness was evaluated using 1000 bootstrap replicates (Felsenstein, 1989). The consensus phylogenetic tree generated was visualized using the program treeview, version 1.6.6. (Page, 1996). Sequences for reference were downloaded from NCBI and were those included in the phylogeny of Sarkar & Guttman (2004), except for the outgroup. Pseudomonas fluorescens Pf-5 was used as the outgroup instead of P. fluorescens K756 (Sarkar & Guttman, 2004) for which sequence was not available. At least one representative strain from each of four phylogenetic groups was included (group 1, P. syringae pv. actinidiae FRTS L1, P. syringae pv. theae K93001, P. syringae pv. tomato KN10, P. syringae pv. maculicola M4; group 2, P. syringae pv. syringae B728A; group 3, P. syringae pv. brussonetiaeKOZ8101, P. syringae pv. savastanoi 4352; group 4, P. syringae pv. syringae Ps9220) to replicate the phylogenies generated by Sarkar & Guttman (2004). Also included was the sequence of Pseudomonas sp. ICMP 3272, the cause of bacterial blight of kiwifruit (Everett & Henshall, 1994).

Phaseolotoxin production

Primers ArgKF3/ArgKR specific to the ArgK gene (Templeton et al., 2005) were used to detect strains of P. syringae pv. actinidiae that produced phaseolotoxin. Pseudomonas syringae pv. phaseolicola strains ICMP 4612, ICMP 6796, ICMP 6797 and ICMP 6831 were used as positive controls.

Syringomycin production

Production of syringomycin was determined according to Gross & DeVay (1977) with the following modifications. The bacterial strains were grown at 28°C for 48 h in the centre of a plate of potato dextrose agar (PDA) (Difco; Becton, Dickinson and Company) before a plug of G. candidum was placed 50 mm away from the edge of the bacterial growth. After 48 h of incubation at room temperature, inhibition of 1 mm or more around the bacterial colonies indicated syringomycin production.

Ice nucleation

Strains were tested for ice nucleation activity as described by Lindow et al. (1978). Also tested was P. syringae pv. actinidiae NIAS 302091, which yielded an atypical positive result in another study (Hwang et al., 2005).

Detection in the presence of plant tissue

To determine if compounds present in kiwifruit tissue would interfere with a PCR reaction, buds were excised from dormant kiwifruit (A. deliciosa cv. Hayward) canes and ca. 30 mg tissue were macerated in 450 μL extraction buffer (Taylor et al., 2001a) using a stainless steel rod which had been milled to fit a microcentrifuge tube. Aliquots of 50 μL of 10-fold dilutions from 101 to 109 CFU of P. syringae pv. actinidiae (ICMP 9617) were added to the plant extract. Cell concentrations were determined spectrophotometrically based on an OD of 0·1 = 6·95 × 107 CFU mL−1. This value was calculated from a calibration curve produced from colony counts on King’s medium B compared with spectrophotometer readings. A 5-μL aliquot was used in a 25-μL PCR reaction. Dilutions of bacterial cells were also extracted using 15 μL Gene Releaser™ (Bioventures Inc.) according to the method of Taylor et al. (2001a).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Following PCR reactions using primers PAV1/P22, 762-bp products were amplified from DNA extracted from Pantoea agglomerans Eh252, P. fluorescens 526 and 599, P. marginalis 754, ICMP 8127 and ICMP 9503, P. syringae pv. papulans ICMP 4043 and ICMP 4055, P. syringae pv. syringae ICMP 3676, ICMP 4268 and ICMP 4610, P. syringae pv. tomato ICMP 3449, ICMP 4259, ICMP 4608 and ICMP 9501, Pseudomonas sp. ICMP 8952 and ICMP 11126 and P. syringae pv. actinidiae ICMP 9617 and ICMP 9855 (Fig. 1a).

image

Figure 1.  PCR reactions using five sets of primers to identify Pseudomonas syringae pv. actinidiae. Two representative strains of P. syringae pv. actinidiae (ICMP 9617, lanes 27 and 57; ICMP 9855, lanes 28 and 58) were included in these reactions. (a) PAV1/P22, (b) OCTF/OCTR, (c) PsaF1/R2, (d) PsaF3/R4, (e) KNF/KNR. Bacterial DNA was extracted from cultures described in full in Table 1; lanes 2–4, Agrobacterium rhizogenes 3379, 8304 and 8308, respectively; lanes 5–6, Clavibacter michiganensis subsp. michiganensis 2551 and 2354; lanes 7–8, Erwinia amylovora 8865 and 12365; lane 9, Klebsiella pneumoniae (culture received as E. carnegieana) 5701; lanes 10–11, E. carotovora subsp. carotovora 11523 and 11524; lanes 12–13, E. chrysanthemi 6926 and 6928; lanes 14–15, Pantoea agglomerans Eh252 and D4; lane 16, Escherichia coli JM 109; lanes 17–18, Pseudomonas cichorii 3521 and 5707; lanes 19–20, Pseudomonas corrugata 5819 and 8898; lanes 21–22, Pseudomonas fluorescens 526 and 599; lanes 23–25, Pseudomonas marginalis 8127, 9503 and 754; lanes 26 and 32, P. syringae pv. papulans 4043 and 4055; lane 33, P. syringae 415; lanes 34–39 P. syringae pv. syringae 2443, 3676, 3938, 4268, 4610 and 5823; lanes 40–43, P. syringae pv. tomato 3449, 4259, 4608 and 9501; lanes 44–45, Pseudomonas sp. 8934 and 8952; lane 46, Pseudomonas viridiflava 11126; lanes 47–48, Xanthomonas campestris pv. pruni 2·40 and 96·08; lanes 49–50, X.c. pv. phaseoli 2722 and 3403; lanes 51–52, X.c. pv. populi 9367 and 9369; lanes 53–54, X.c. pv. vesicatoria 7383 and 18 g; lanes 55–56, Xanthomonas sp. 36A and 36B. Lanes 1, 30, 31 and 60, 1-kb Plus DNA marker (Invitrogen). Lanes 29 and 59, water controls.

Download figure to PowerPoint

PCR reactions with primers OCTF/OCTR amplified products from DNA extracted from Agrobacterium rhizogenes ICMP 3379, Clavibacter michiganensis subsp. michiganensis ICMP 2551, Pa. agglomerans D4, Pseudomonas cichorii ICMP 3521, Pseudomonas corrugata ICMP 5819, P. syringae 415, P. syringae pv. syringae ICMP 2443, ICMP 3676, ICMP 3938, ICMP 4268, ICMP 4610 and ICMP 5823, P. syringae pv. tomato ICMP 3449, ICMP 4259, ICMP 4608 and ICMP 9501, Xanthomonas campestris pv. vesicatoria ICMP 7383, 18 g, Xanthomonas sp. 36A and P. syringae pv. actinidiae ICMP 9617 and ICMP 9855. Of these, the products from P. syringae pv. actinidiae ICMP 9617 and ICMP 9855 were of the expected size of 1098 bp. Products from Pa. agglomerans D4, P. syringae 415, ICMP 2443, ICMP 3938 and ICMP 5823, and P. syringae pv. tomato ICMP 3449 and ICMP 4608, were about the same size. Other products of c. 450 bp, 600 bp, 850 bp, 1650 bp and 2000 bp were produced from the other positive samples (Fig. 1b).

PCR reactions with primers KNF/KNR amplified products from DNA extracted from P. syringae pv. papulans ICMP 4043 and ICMP 4055, P. syringae pv. actinidiae ICMP 9617 and ICMP 9855, P. syringae pv. syringae ICMP 4268 and ICMP 4610, and P. syringae pv. tomato ICMP 3449, ICMP 4259, ICMP 4608 and ICMP 9501. Products from P. syringae pv. papulans ICMP 4043, ICMP 4055 were c. 600 bp, all other products were ca. 490 bp (Fig. 1e). In a separate experiment, primers KNF/KNR produced a ca. 520-bp product from DNA extracted from P. syringae pv. actinidiae PD 2766 and NCPPB 3871, but no product from DNA extracted from P. syringae pv. actinidiae PD 2774, NCPPB 3873, KACC 10582 or KACC 10660.

The primer pairs PAV1/P22 and OCTF/OCTR could not distinguish between P. syringae pv. actinidiae and other closely related pseudomonads, including those commonly found in New Zealand kiwifruit orchards (Fig. 1a,b). The primer pair KNF/KNR could not distinguish P. syringae pv. actinidiae from strains of P. syringae pv. syringae from tomato. These primers did not amplify product from pseudomonads isolated from kiwifruit orchards in New Zealand (Fig. 1e). In a separate reaction, primers KNF/KNR could not distinguish P. syringae pv. theae ICMP 3923 from P. syringae pv. actinidiae ICMP 9617 and 9855, as reported previously by Vanneste et al. (2009).

When the primer pair PsaF1/R2 was used in PCR reactions, a product of 280 bp was amplified from DNA of P. syringae pv. actinidiae, and a product of 175 bp was amplified from P. syringae pv. actinidiae with primer pair PsaF3/R4 (Fig. 1c,d). Use of the PCR primers PsaF1/R2 and PsaF3/R4 resulted in products from DNA of both included strains of P. syringae pv. actinidiae (ICMP 9617 and ICMP 9855) but not from any other bacteria tested (Fig. 1c,d; Table 1). In separate reactions, primers PsaF1/R2 and PsaF3/R4 were tested against DNA extracted from four strains of P. syringae pv. phaseolicola (ICMP 4612, ICMP 6796, ICMP 6797 and ICMP 6831) and P. syringae pv. theae ICMP 3923. The expected product resulted when P. syringae pv. actinidiae was included as a control, but no product resulted with any of the strains of P. syringae pv. phaseolicola. These primers were not able to distinguish P. syringae pv. theae ICMP 3923 from P. syringae pv. actinidiae and produced a product of the same size in PCR reactions (data not shown).

Amplification of DNA extracted from 20 strains from four countries deposited in culture collections as P. syringae pv. actinidiae in PCR reactions with the primer pairs PsaF1/R2 and PsaF3/R4 resulted in the expected product for both primer sets for 14 strains. Reactions with six strains (KACC 10582, KACC 10660, NCPPB 3871, NCPPB 3873, PD 2766 and PD 2774) deposited in culture collections as P. syringae pv. actinidiae resulted in no product (Table 2).

Primers ArgKF3/ArgKR (Templeton et al., 2005) amplified the expected 800-bp product from DNA extracted from P. syringae pv. phaseolicola strains ICMP 4612, ICMP 6796, ICMP 6797 and ICMP 6831 and from P. syringae pv. actinidiae strains ICMP 9617, ICMP 9853, ICMP 9854, ICMP 9855, KACC 10659, NIAS 302091, NIAS 302133, NIAS 302134, NIAS 302143, NIAS 302145 and NIAS 302146, but not from those six strains that did not produce product when amplified with primers PsaF1/F2 or PsaF3/R4. There was no product from DNA extracted from P. syringae pv. actinidiae strains KACC 10584, KACC 10594 and KACC 10754 when using the ArgKF3/ArgKR primer set (Table 2).

When the ITS region of the six strains not amplified by primer pairs PsaF1/R2 and PsaF3/R4 was sequenced, it was apparent that these strains were not similar to the pathotype strain of P. syringae pv. actinidiae. NCPPB 3871, NCPPB 3873, KACC 10582, PD 2766 and PD 2774 were 80·6, 89·5, 89·9, 87·8 and 87·3% homologous to the type strain, respectively. Following blast analysis of the NCBI sequence database, the sequences of NCPPB 3871, PD 2766 and PD 2774 were 100%, NCPPB 3873 99% and KACC 10582 98% similar to strains of P. syringae or P. syringae pv. syringae isolated from hosts other than kiwifruit (Table 4). Regions of polymorphisms in the ITS region for these five strains showed clear differences from the pathotype strain of P. syringae pv. actinidiae (Fig. 2). From blast analysis KACC 10660 was 98% similar (1448/1463 bases) to Rahnella aquatilis m 46 (AY253921.1).

Table 4. blast analysis of 16S–23S rDNA intertranscribed spacer region sequence from the National Center of Biological Information database with six unusual strains deposited as Pseudomonas syringae pv. actinidiae (indicated by *) and strain ICMP 9617 (GenBank Accession No. D86357)
StrainBasesMatchesHomology (%)GenBank accession numberProposed identity
NCPPB 3871*469420/420 49/49100AY342179.1P. syringae pv. syringae strain 61
NCPPB 3873*602600/60299CP000075.1P. syringae pv. syringae B728a
KACC 10582*600596/60398CP000075.1P. syringae pv. syringae B728a
KACC 10660*14631448/146398AY253921.1Rahnella aquatilis m 46
PD 2774*547547/547100AY850196P. syringae CT99B016C
PD 2766*619619/619100CP000075.1P. syringae pv. syringae B728a
D86357564564/564100D86357P. syringae pv. actinidiae Kw-11
image

Figure 2.  Regions of polymorphisms in sequence alignment of the 16S-ITS1-tRNA-Ile-ITS2-tRNA-Ala-ITS-23S gene of the pathotype culture of Pseudomonas syringae pv. actinidiae (AY342165, D86357), and strains of Pseudomonas spp. that did not produce product with PCR primers PsaF1/R2 and PsaF3/R4.

Download figure to PowerPoint

Results of multilocus sequence typing of three concatenated housekeeping genes and subsequent phylogenetic analysis confirmed and further clarified the results from the ITS sequence (Fig. 3). The P. syringae pv. actinidiae ICMP 9617 sequence from this study aligned exactly with the sequence in GenBank (FTRS-L1) and closely with P. syringae pv. theae in group 1 of Sarkar & Guttman (2004). Also in group 1 and included in the phylogeny in this study were P. syringae pv. maculicola and P. syringae pv. tomato. NCPPB 3871, NCPPB 3873 and PD 2774 clustered with group 2 along with P. syringae pv. syringae from soyabean. Pseudomonas sp. ICMP 3272 and KACC 10582 clustered with group 3, which included P. syringae pv. savastanoi. PD 2766 clustered with P. syringae pv. syringae from spring onion. DNA from strain PD 2766 was not amplified by the primers for the acnB gene region, and DNA from Pseudomonas sp. ICMP 3272 was not amplified by primers for the gyrB gene region. For this reason, these gene regions were not included in the concatenated analysis. Individual neighbour-joining trees of these gene regions supported the results of the concatenated analysis, except that KACC 10582 was more closely aligned with group 2 than with group 3 in the gyrB gene analysis. DNA extracted from strain KACC 10660 was not amplified by any of the primers used in this multilocus sequence typing analysis.

image

Figure 3.  Phylogenetic tree of linearized neighbour-joining analyses of combined rpoD, cts and pgi gene data. Numbers at nodes are percentage bootstrap values based on 1000 replicates for values over 60%. The genetic distance scale is presented below the tree. Four major groups are indicated to the left of the tree. The known strains are identified on the right of the tree. Pseudomonas fluorescens strain PfPf5 was used as the outgroup.

Download figure to PowerPoint

Pseudomonas syringae pv. actinidiae strains ICMP 9855, NIAS 302091, ICMP 9617 and KACC 10660 did not induce ice nucleation, but strains NCPPB 3871, NCPPB 3873, KACC 10582, PD 2766, PD 2774 and P. syringae pv. syringae 3-76 did induce it (Table 5). Likewise, strains NCPPB 3871, NCPPB 3873, KACC 10582, PD 2766 and PD 2774 and P. syringae pv. syringae 3-76 inhibited G. candidum and most probably produced syringomycin, whilst strains P. syringae pv. actinidiae ICMP 9855, ICMP 9617 and KACC 10660 did not inhibit G. candidum (Table 6).

Table 5.   Results of polymerase chain reactions (PCR), syringomycin production, ice nucleation and multilocus sequence typing analysis (MLSA) of the six unusual strains deposited as Pseudomonas syringae pv. actinidiae (indicated by *) and three ICMP strains
StrainProposed identityPCRaSyringomycinIce nucleationMLSA (Sarkar & Guttman, 2004)
  1. aPCR with primer pairs PsaF1/R2 and PsaF3/R4.

  2. bn.t. not tested.

NCPPB 3871*P. syringae pv. syringae++Group 2
NCPPB 3873*P. syringae pv. syringae++Group 2
KACC 10582*Pseudomonas sp.++Group 3
KACC 10660*Rahnella aquatilisn.t.b
PD 2774*P. syringae pv. syringae++Group 2
PD 2766*P. syringae pv. syringae++Group 4
ICMP 9617P. syringae pv. actinidiae+Group 1
ICMP 9855P. syringae pv. actinidiae+Group 1
ICMP 3272Pseudomonas sp.++Group 3

When PCR reactions were conducted in the presence of kiwifruit plant tissue, the primers PsaF1/R2 and PsaF3/R4 were able to detect as few as 7·5 × 103 CFU of P. syringae pv. actinidiae per PCR reaction (Fig. 4).

image

Figure 4.  Products of polymerase chain reaction (PCR) with decreasing amounts of template to determine if reactions were inhibited in the presence of kiwifruit tissue, and to ascertain the limit of detection. PCR primers (a) PsaF1/R2 and (b) PsaF3/R4. Lanes 1 and 11, 1-kb Plus DNA marker (Invitrogen); lanes 2–8, 10-fold dilutions of Pseudomonas syringae pv. actinidiae ICMP 9617, from 7·5 × 107 CFU, in lane 2 to 7·5 × 101 CFU in lane 8. Lane 10, water control.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

PCR primers from the literature (Sawada et al., 1997; Koh & Nou, 2002; Scortichini et al., 2002) were not specific to P. syringae pv. actinidiae. The present study showed that two of these primer pairs (PAV1/P22 and OCTF/OCTR) detected other pseudomonads common in kiwifruit orchards in New Zealand as well as P. syringae pv. actinidiae. The primers of Koh & Nou (2002) detected other pathovars of P. syringae, including one that was isolated from an Italian kiwifruit orchard, tentatively identified as P. syringae pv. syringae on the basis of MLSA and blast analysis of the ITS region. In contrast, primers PsaF1/R2 and PsaF3/R4 were able to distinguish P. syringae pv. actinidiae from other pseudomonads from kiwifruit orchards, and from a number of other bacteria. However, these primers, and those of Koh & Nou (2002), were not able to distinguish P. syringae pv. actinidiae from P. syringae pv. theae.

A product was amplified by primer pair OCTF/OCTR from DNA extracted from a number of bacteria that do not produce phaseolotoxin and products not of the expected size were obtained from other phaseolotoxin-producing bacteria. These results suggest that non-specific binding was taking place between these primers and the bacterial DNA. The primer pair ArgKF3/ArgKR was designed to be complementary to the 3′ and 5′ ends of the ArgK gene, but OCTF/OCTR were complementary to the 3′ and 5′ flanking regions. In this study these flanking regions were proven not to be specific to all of the bacteria expressing the ArgK gene.

The primer set designed to detect the argK gene, ArgKF3/ArgKR, produced the expected product from all phaseolotoxin-producing strains of P. syringae pv. phaseolicola, but not from all strains deposited as P. syringae pv. actinidiae, and is thus not useful for detecting this pathovar. Shim Han et al. (2003) showed that Japanese strains of P. syringae pv. actinidiae produced phaseolotoxin, but Korean strains did not, and this was confirmed by primers ArgKF3/ArgKR in this study. There are pathogenic non-toxin-producing strains of P. syringae pv. phaseolicola (Gonzalez et al., 2003), and this gene region has been shown to be unreliable for identification of this bacterium. This characteristic has also been shown in this study to be unreliable for identifying P. syringae pv. actinidiae. These results do not necessarily affect the accuracy of these primers for detecting toxin production.

Pseudomonas syringae pv. theae was almost completely indistinguishable from P. syringae pv. actinidiae based on the core genome according to phylogenetic analysis of concatenated sequence data, both in this study and elsewhere (Sarkar & Guttman, 2004). For pathovar-specific primer design, pathogenicity genes may need to be targeted, as the taxonomy of P. syringae is based on the results of plant source and cross-pathogenicity tests (Gardan et al., 1999). The gelatin liquification test and utilization of trigonelline were shown to distinguish P. syringae pv. actinidiae from P. syringae pv. theae (Scortichini et al., 2002) and these tests could be used in combination with PCR primers PsaF1/R2 and PsaF3/R4 if required. However, for routine detection of bacteria isolated from diseased kiwifruit tissue, the primers PsaF1/R2 and PsaF3/R4 are sufficiently specific, because P. syringae pv. theae has only ever been isolated from tea plants (Scortichini et al., 2002).

Of the six strains labelled as P. syringae pv. actinidiae that were not detected by PsaF1/R2 and PsaF3/R4, all were dissimilar to the type strain of P. syringae pv. actinidiae in the determinative tests of syringomycin production (Hu et al., 1998) and ice nucleation. The ice-nucleation test has been proposed as determinative for resolving Pseudomonas sp. from P. syringae pv. actinidiae based on results with four strains from Japan (Young et al., 1997), but subsequently Hwang et al. (2005) showed that another strain from Japan (FTRS-L1) was ice-nucleation-positive. These authors used an unusually low temperature for ice-nucleation tests (−10°C); in the tests in the present study at −5°C this strain was ice-nucleation-negative.

On the basis of these determinative tests and DNA sequence analysis it is suggested that these six strains were misidentified as P. syringae pv. actinidiae. KACC 10660 was a clear misidentification as it is most similar to R. aquaticus, a species that has been found as an epiphyte in pear orchards (Lindow et al., 1998) and possibly is present as an epiphyte in kiwifruit orchards. Both KACC 10582 and Pseudomonas sp. ICMP 3272 clustered with P. syringae pv. savastanoi in group 3 by MLSA. By ITS analysis, KACC 10582 was most similar to Pseudomonas sp. ICMP 3272. Young et al. (1997) proposed that Pseudomonas sp. causing bacterial blight of kiwifruit should be aligned with P. syringae pv. savastanoi based on the results of genotypic and phenotypic methods. It is proposed that KACC 10582 is a strain of Pseudomonas sp. (bacterial blight).

Of the remaining four strains that were not detected, PD 2766 clustered with P. syringae pv. syringae group 4 following MLSA and the other three strains (PD 2774, NCPPB 3871 and NCPPB 3873) aligned with group 2. These strains could not be reliably detected by any of the primers discussed here. There were significant differences between these and the type strain of P. syringae pv. actinidiae in group 1. Based on these results, it is suggested that these strains are more closely related to P. syringae pv. syringae than to P. syringae pv. actinidiae.

Of these strains, two (NCPPB 3871 and NCPPB 3873) were deposited as representative strains when the first record of this disease in Italy was reported (Scortichini, 1994). The description of symptoms on kiwifruit vines in Italy was identical to those described in Japan by Serizawa et al. (1989). Based on biochemical, pathogenicity and nutritional tests, as well as whole-cell protein profiles, Scortichini (1994) concluded that the disease reported in Italy was caused by P. syringae pv. actinidiae. As these two strains were representative of those isolated from diseased vines it is possible that they were not those used in these tests. In later work, strain NCPPB 3873 was inoculated onto kiwifruit leaves and produced spots and wilting (Scortichini et al., 2002). Neither of these symptoms is diagnostic for bacterial canker of kiwifruit (Serizawa et al., 1989; Takikawa et al., 1989).

In a recent publication Balestra et al. (2009) stated that a strain of P. syringae pv. actinidiae from Italy was 100% homologous with P. syringae pv. actinidiae by 16SrDNA and 16S–23S ITS rDNA sequence, in contrast to the strains from Italy studied here. The primers of Koh & Nou (2002) led to the amplification of a DNA fragment of the expected size, also in contrast to the strains from Italy studied here. It is suggested that strains NCPPB 3871 and NCPPB 3873 were misidentified and are present as saprotrophs, or associated with bacterial blight, similarly to strains of P. syringae isolated from kiwifruit orchards in New Zealand and Korea (Everett & Henshall, 1994; Koh et al., 2003).

As there is some evidence that phylogenetically distinct Pseudomonas lineages may sometimes be able to cause disease in the same host as a result of either horizontal acquisition of effectors or by convergent evolution (Sarkar et al., 2006), the possibility cannot be dismissed that one or more of the six strains not detected by primer pairs PsaF1/R2 and PsaF3/R4 are able to cause bacterial canker. However, until the pathogenicity of these unusual strains is tested on kiwifruit, it is more likely that they are not causative agents of this disease. On the basis of these interpretations and the above results, primers PsaF1/R2 and PsaF3/R4 detected all genuine strains of P. syringae pv. actinidiae from Korea and Japan.

This study achieved amplification of bacterial DNA using PCR in the presence of kiwifruit tissue. However, the limit of detection may not be sufficiently low to allow PCR analysis of kiwifruit tissue to be the sole test used for screening. Inoculation studies will be required to test if this level is sufficiently sensitive to always detect the disease. Further refinement of the PCR technique, such as including an enrichment step as used elsewhere (Taylor et al., 2001a), could be used to enhance the sensitivity of detection if required. The PCR primers PsaF1/R2 and PsaF3/R4 can be reliably used to identify bacteria isolated from kiwifruit tissue, and an isolation step is recommended for routine screening.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Funding for this project was provided by The Foundation for Research, Science and Technology contract no. C06X0217 and MAF Biosecurity New Zealand Project 1045/2007. The authors thank Dr Lia Liefting, MAF Biosecurity New Zealand, for obtaining and extracting DNA of P. syringae pv. actinidiae. We also thank the Korean Agricultural Culture Collection (KACC, Republic of Korea), the National Institute of Agrobiological Sciences (NIAS, Japan), the National Collection of Plant Pathogenic Bacteria (NCPPB, UK) and the Culture Collection of Plant Pathogenic Bacteria (PD, Netherlands), for permission to use this DNA. We are also grateful to Dr Richard Newcomb for advice on phylogenetic analysis, and to Dr John Young for advice on determinative tests.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Alcorn SM, Orum TV, 1988. Rejection of the names Erwinia carnegieana Standring 1942 and Pectobacterium carnegieana (Standring 1942) Brenner, Steigerwalt, Miklos and Fanning 1973: request for an opinion. International Journal of Systematic Bacteriology 38, 1324.
  • Balestra GM, Mazzaglia A, Quattrucci A, Renzi M, Rossetti A, 2009. Current status of bacterial canker spread on kiwifruit in Italy. Australasian Plant Disease Notes 4, 346.
  • Everett KR, Henshall WR, 1994. Epidemiology and population ecology of kiwifruit blossom blight. Plant Pathology 43, 82430.
  • Felsenstein J, 1989. PHYLIP – phylogeny inference package (version 3.2). Cladistics 5, 1646.
  • Gardan L, Shafik H, Belouin S, Broch R, Grimont F, Grimont PAD, 1999. DNA relatedness among the pathovars of Pseudomonas syringae and description of Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic and Dowson 1959). International Journal of Systematic Bacteriology 49, 46978.
  • Gonzalez AI, Pérez de la Vega M, Ruiz ML, Polanco C, 2003. Analysis of the argK-tox gene cluster in nontoxigenic strains of Pseudomonas syringae pv. phaseolicola. Applied and Environmental Microbiology 69, 497982.
  • Gross DC, DeVay JE, 1977. Population dynamics and pathogenesis of Pseudomonas syringae in maize and cowpea in relation to the in vitro production of syringomycin. Phytopathology 67, 47583.
  • Hu FP, Young JM, Fletcher MJ, 1998. Preliminary description of biocidal (syringomycin) activity in fluorescent plant pathogenic Pseudomonas species. Journal of Applied Microbiology 85, 36571.
  • Hu FP, Young JM, Jones DS, 1999. Evidence that bacterial blight of kiwifruit, caused by a Pseudomonas sp., was introduced into New Zealand from China. Journal of Phytopathology 147, 8997.
  • Hwang MSH, Morgan RL, Sarkar SF, Wang PW, Guttman DS, 2005. Phylogenetic characterization of virulence and resistance phenotypes of Pseudomonas syringae. Applied and Environmental Microbiology 71, 518291.
  • Koh Y, Lee D, 1992. Canker of kiwifruit by Pseudomonas syringae pv. morsprunorum. Korean Journal of Plant Pathology 8, 11922.
  • Koh Y, Nou I, 2002. DNA markers for identification of Pseudomonas syringae pv. actinidiae. Molecules and Cells 13, 30914.
  • Koh YJ, Jung JS, Hur JS, 2003. Current status of occurrence of major diseases on kiwifruits and their control in Korea. Acta Horticulturae 610, 43741.
  • Lane DJ, 1991. 16S/23S rRNA sequencing. In: StackebrandtE, GoodfellowM, eds. Nucleic Acid Techniques in Bacterial Systematics. Chichester, UK: Wiley, 11576.
  • Lelliott RA, Billing E, Hayward AC, 1966. A determinative scheme for the fluorescent plant pathogenic pseudomonads. Journal of Applied Bacteriology 29, 47089.
  • Li M, Tan G, Li Y et al. , 2004. Resistance of different Chinese gooseberry cultivars to Chinese gooseberry bacterial canker caused by Pseudomonas syringae pv. actinidiae and their cluster analysis. Plant Protection 30, 514.
  • Lindow SE, Arny DC, Upper CD, 1978. Erwinia herbicola: a bacterial ice nucleus active in increasing frost injury to corn. Phytopathology 68, 5237.
  • Lindow SE, Desurmont C, Elkins R, McGourty G, Clark E, Brandl MT, 1998. Occurrence of indole-3-acetic acid-producing bacteria on pear trees and their association with fruit russet. Phytopathology 88, 114957.
  • Mazarei M, Mostofipour P, 1994. First report of bacterial canker of kiwifruit in Iran. Plant Pathology 43, 10556.
  • Opgenorth DC, Lai M, Sorrell M, White JB, 1983. Pseudomonas canker of kiwifruit. Plant Disease 67, 12834.
  • Page RDM, 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 3578.
  • Sarkar SF, Guttman DS, 2004. Evolution of the core genome of Pseudomonas syringae, a highly clonal, endemic plant pathogen. Applied and Environmental Microbiology 70, 19992012.
  • Sarkar SF, Gordon JS, Martin GB, Guttman DS, 2006. Comparative genomics of host-specific virulence in Pseudomonas syringae. Genetics 174, 104156.
  • Sawada H, Takeuchi T, Matsuda I, 1997. Comparative analysis of Pseudomonas syringae pv. actinidiae and pv. phaseolicola based on phaseolotoxin-resistant ornithine carbamoyltransferase gene (argK) and 16S-23S rRNA intergenic spacer sequences. Applied and Environmental Microbiology 63, 2828.
  • Sawada H, Kanaya S, Tsuda M, Suzuki F, Azegami K, Saitou N, 2002. A phylogenomic study of the OCTase genes in Pseudomonas syringae pathovars: the horizontal transfer of the argK-tox cluster and the evolutionary history of OCTase genes on their genomes. Journal of Molecular Evolution 54, 43757.
  • Scortichini M, 1994. Occurrence of Pseudomonas syringae pv. actinidiae on kiwifruit in Italy. Plant Pathology 43, 10358.
  • Scortichini M, Marchesi U, Di Prospero P, 2002. Genetic relatedness among Pseudomonas avellanae, P. syringae pv. theae and P.s. pv. actinidiae, and their identification. European Journal of Plant Pathology 108, 26978.
  • Serizawa S, Ichikawa T, Takikawa Y, Tsuyumu S, Goto M, 1989. Occurrence of bacterial canker of kiwifruit in Japan: description of symptoms, isolation of the pathogen and screening of bactericides. Annals of the Phytopathological Society of Japan 55, 42736.
  • Shim Han H, Jung Oak E, Jin Koh Y, Hur J-S, Sung Jung J, 2003. Characterization of Pseudomonas syringae pv. actinidiae isolated in Korea and genetic relationship among coronatine-producing pathovars based on cmaU sequences. Acta Horticulturae 610, 4038.
  • Takikawa Y, Serizawa S, Ichikawa T, Tsuyumu S, Goto M, 1989. Pseudomonas syringae pv. actinidiae pv. nov.: the causal bacterium of canker of kiwifruit in Japan. Annals of the Phytopathological Society of Japan 55, 43744.
  • Taylor RK, Guilford PJ, Clark RG, Hale CN, Forster RLS, 2001a. Detection of Erwinia amylovora in plant material using novel polymerase chain reaction (PCR) primers. New Zealand Journal of Crop and Horticultural Science 29, 3543.
  • Taylor RK, Hale CN, Hartill WFT, 2001b. A stem canker disease of olive (Olea europaea) in New Zealand. New Zealand Journal of Crop and Horticultural Science 29, 21928.
  • Templeton MD, Reinhardt LA, Collyer CA, Mitchell RE, Cleland WW, 2005. Kinetic analysis of the L-ornithine transcarbamoylase from Pseudomonas savastanoi pv. phaseolicola that is resistant to the transition state analogue (R)-N delta -(N′-Sulfodiaminophosphinyl)-L-ornithine. Biochemistry (Washington) 44, 440815.
  • Vanneste JL, Yu J, Beer SV, 1992. Role of antibiotic production by Erwinia herbicola Eh252 in biological control of Erwinia amylovora. Journal of Bacteriology 174, 278596.
  • Vanneste JL, Cornish DA, Yu J, Morris CE, 2009. The application of polymerase chain reaction for characterising strains of Pseudomonas syringae isolated from New Zealand rivers. New Zealand Plant Protection 62, 25661.
  • Wilkie JP, Dye DW, Watson DRW, 1973. Further hosts of Pseudomonas viridiflava. New Zealand Journal of Agricultural Research 16, 31523.
  • Young JM, Fletcher MJ, 1997. International Collection of Micro-organisms from Plants: Catalogue Accessions 1-12989. Lincoln, New Zealand: Landcare Research.
  • Young JM, Gardan L, Ren XZ, Hu FP, 1997. Genomic and phenotypic characterization of the bacterium causing blight of kiwifruit in New Zealand. Plant Pathology 46, 85764.