SEARCH

SEARCH BY CITATION

Keywords:

  • azoxystrobin;
  • conidial germination;
  • fungicide resistance;
  • Septoria tritici;
  • Triticum aestivum

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The effect of the quinone outside inhibitors (QoI) azoxystrobin and pyraclostrobin on yields of winter wheat where QoI resistant Mycosphaerella graminicola isolates were dominant was investigated in field trials in 2006 and 2007. Pyraclostrobin significantly increased yields by 1·57 t ha−1 in 2006 and 0·89 t ha−1 in 2007 when compared to the untreated controls, while azoxystrobin only provided a significant increase of 1·28 t ha−1 in 2006. These yield increases were associated with reduction in septoria tritici blotch (STB) development as determined by weekly disease assessments over a 7 week interval. The effect of pyraclostrobin on STB was studied in controlled environment experiments using wheat seedlings inoculated with individual M. graminicola isolates. Pyraclostrobin significantly reduced STB symptoms by up to 62%, whether applied 48 h pre- or post- inoculation with resistant M. graminicola isolates containing the cytochrome b mutation G143A. Extremely limited disease (<1%) was observed on similarly treated seedlings inoculated with an intermediately resistant isolate containing the cytochrome b mutation F129L, while no disease was observed on seedlings inoculated with a wild-type isolate. Germination studies of pycnidiospores of M. graminicola on water agar amended with azoxystrobin or pyraclostrobin showed that neither fungicide inhibited germination of spores of resistant isolates containing the mutation G143A. However, pyraclostrobin significantly reduced germ tube length by up to 46% when compared with the untreated controls. Although the QoIs can no longer be relied upon to provide effective M. graminicola control, this study provides an insight into why QoIs still provide limited STB disease control and yield increases even in situations of high QoI resistance.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Following their commercial release in the mid 1990s, quinone outside inhibitors (QoI) rapidly became one of the most important groups of fungicides used in cereal production systems (Bartlett et al., 2002). Specifically targeting fungal respiration, they provide a wide spectrum of disease control, flexibility in application timing, and, as they have a novel mode of action, can be used in anti-resistance strategies (Bartlett et al., 2002). Unfortunately, due to their specificity, the risk of plant pathogens developing resistance is high (Anonymous, 2008). Within 2 years of their commercial release the first resistance problems were reported, with resistance emerging in the wheat powdery mildew pathogen Blumeria graminis f.sp. tritici in northern Germany (Heaney et al., 2000). Molecular analysis of the mitochondrial gene coding cytochrome b (the target site of the QoIs) in the resistant isolates revealed the substitution of glycine by alanine at amino acid position 143 (Heaney et al., 2000; Sierotzki et al., 2000). Resistance has since been detected in 25 plant pathogens, with an additional two cytochrome b mutations, F129L and G137R, also associated with field resistance (Anonymous, 2008). However, the G143A mutation has proven to be the most common cause of resistance. While providing the greatest level of protection for the pathogen from the QoIs, so far the G143A mutation does not appear to impose any fitness penalties on the majority of the pathogens in which it has been identified (Fraaije et al., 2005; Sierotzki et al., 2007; Fisher & Meunier, 2008).

Prior to 2003, QoI fungicides were among the key fungicides applied to winter wheat in Ireland and much of north-western Europe as a means of protecting the crop from Mycosphaerella graminicola infection and the subsequent development of septoria tritici blotch (STB). In addition to their excellent control of M. graminicola, they prolonged the life of wheat leaves and increased yields above those provided by the most active demethylation inhibitors (DMIs) (Ruske et al., 2003). Since M. graminicola infection potentially reduces Irish wheat yields by up to 50%, the commercialization of the QoI fungicides was welcomed and they were extensively applied (B. Dunne, Teagasc Crops Research Centre, Carlow, personal communication). In the UK alone, within 1 year of their registration for use on wheat, QoI fungicides were being applied to over 50% of the crops (Hardwick et al., 2001). Unfortunately the rapid spread of the G143A allele amongst European M. graminicola populations has dramatically reduced the entire fungicide group’s efficacy against this pathogen (Lockley & Clark, 2005). Such resistant isolates have come to dominate M. graminicola populations in Ireland and north-western Europe (Fraaije et al., 2005; Kildea et al., 2006; Leroux et al., 2006), a situation that is likely to continue for the foreseeable future.

Despite the loss of field efficacy against M. graminicola, yield increases have continued to be reported following QoI treatments (McCartney et al., 2007; Thygesen et al., 2009). Physiological changes, such as alterations in hormonal balances, transpiration, carbon dioxide concentrations, photosynthetic rate and nitrogen assimilation have been recorded in QoI-treated wheat leaves, and it is speculated that they contribute to increases in yield (Grossmann & Retzlaff, 1997; Glaab & Kaise, 1999; Nason et al., 2007). In addition to the above physiological effects, limited levels of M. graminicola control, even in high QoI resistance situations, have been reported and may be contributing to these yield increases (Thygesen et al., 2009). In preliminary trials conducted by Teagasc in Ireland in 2005, with >95% resistance present at the trial site, such control was observed, although it was short-lived (unpublished data). The present study describes investigations into the consistency of this control both under Irish field conditions and in a controlled environment. The origins of this control were further examined by studying pycnidiospore germination in the presence of QoI fungicides. The consequences of the findings for the future control of M. graminicola are discussed.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Effect of QoIs on STB disease control under field conditions

The abilities of the QoI fungicides azoxystrobin (Amistar®, Syngenta) and pyraclostrobin (Modem®, BASF) to control STB when compared to the DMI epoxiconazole (Opus®, BASF) and untreated controls were examined in 2006 and 2007. The trials were conducted at the Teagasc Research Farm, Knockbeg, Co. Laois in 2006 and at the Teagasc Crops Research Centre, Oak Park, Co. Carlow in 2007, using the STB-susceptible winter wheat cultivars Savannah and Consort, respectively (both rated 4 for STB susceptibility on a 1–9 scale where 9 is maximum resistance (Anonymous, 2006)). Trials were laid out in randomized block designs with three-fold replication in 2006 and four-fold replication in 2007. Plots sizes were 20 × 2·25 m in both years. All fungicides were applied using an Azo plot sprayer (Azo-Sprayers) at the manufacturers’ recommended rates (in a spray volume of 220 L ha−1 water) three times during each season on dates corresponding to the emergence of the upper leaves and ear of the wheat plant, and as described by Burke & Dunne (2008) (Tables 1 & 2). Disease assessments commenced on 31 May 2006 and 29 May 2007, respectively and were made at 7-day intervals, continuing until mid-July of each year. Disease severity was visually recorded as the percentage of diseased leaf area on leaves 1–4 (where flag leaf = leaf 1, second leaf = leaf 2, etc.), of 10 primary tillers randomly chosen from each plot, from which the mean was calculated. Plots were harvested each year and yields calculated as kg ha−1 at 15% moisture content.

Table 1.   Fungicide active ingredient (a.i.), commercial name, rates applied, formulation type and manufacturer used in the field trials in both 2006 and 2007
Active ingredientProprietary nameRate of a.i. (g ha−1)Formulation typeaManufacturer
  1. aSC, Suspension concentrate; EC, Emulsion concentrate.

AzoxystrobinAmistar250SCSyngenta
EpoxiconazoleOpus125SCBASF
PyraclostrobinModem250ECBASF
Table 2.   Treatment timing (T1, T2, T3), growth stage (GS) and date at which the various fungicides were applied in the 2006 and 2007 field trials
YearT1T2T3a
GSDateGSDateGSDate
  1. aIn June 2006 a total of 12 rain days (>0·2 mm) were recorded. In June 2007 a total of 20 rain days were recorded, which delayed the final fungicide application.

20063221 April3919 May65 7 June
20073224 April3915 May6926 June

To determine the frequency of QoI resistance at the start of each year, approximately 100 diseased leaves were randomly collected throughout the trial site prior to the first fungicide application. Individual pycnidial isolates of M. graminicola were retrieved and stored as described by Kildea et al. (2006). DNA was extracted from freeze dried 4-day-old cultures using a CTAB extraction protocol and as described by Zhan et al. (2002). To detect the presence of the mutation F129L, a PCR-RFLP assay was used. The primers Cbsequ1 (5′ GATTCACCACAACCAAGTAA) and Cbsep2 (5′ CGTTATTGTGTTGTTTAAGTGCAT) were designed to amplify a 987 bp fragment of the cytochrome b by PCR (Kildea, 2009). This PCR fragment was then digested with the restriction enzyme BsmI (New England Biolabs Inc.), which recognises the nucleotide sequence coding F129. The presence of the G143A mutation was determined using allele-specific PCR adapted from Ware (2006), with the primer StrobSNP1rv replaced by CbSequ2 (5′GTGACTCAACGTGATTAGCA). The presence or absence of both mutations within the retrieved isolates were analysed on 1% agarose gels. In 2006 and 2007, 36 and 31 isolates were obtained from the trials sites, respectively, and screened for the above mutations.

Effect of the QoI pyraclostrobin on STB development on wheat seedlings under controlled environmental conditions

The ability of five M. graminicola isolates, selected from the Oak Park M. graminicola collection (stored in 30% glycerol at −80°C) to cause STB on seedlings of cv. Consort treated with pyraclostrobin either as a protectant or as an eradicant was assessed under controlled environmental conditions. Isolates were chosen based upon their sensitivity to the QoI fungicide azoxystrobin (determined using a microtitre assay as described by Kildea et al., 2006) and partial cytochrome b sequence (S. Kildea, unpublished data) and included three resistant isolates with the cytochrome b mutation G143A (isolates KK14, WAT8 and R27), an intermediately resistant isolate with the cytochrome b mutation F129L (isolate ss10) and a sensitive isolate with a wild-type cytochrome b (isolate OFF1). To produce inoculum, an initial culturing step was conducted for all isolates by spotting 10 μL of their −80°C stock onto potato dextrose agar (PDA) (Oxoid Ltd) for 4 days, followed by an additional re-culturing for 4 days. During both culturing steps, plates were incubated under a 12 h cycle of NUV/darkness at 18°C. Spores of each isolate were subsequently scraped from the surface of the PDA and diluted in sterile distilled water (SDW) to give a final spore concentration of 1 × 106 spores mL−1. To aid wetting, two drops of Tween 20 were added to each spore suspension. Wheat seedlings grown for 14 days in 9 × 9 × 9 cm3 pots (nine seedlings per pot) were inoculated with an individual isolate by spraying to run-off using a hand held sprayer (Hozelock), while control plants were sprayed with SDW. Pots were covered with clear polythene bags to maintain high humidity and placed in a controlled glasshouse, where light and temperature were adjusted to ensure 12 h light/darkness, at 18°C/12°C, respectively. Bags were removed 48 h post inoculation. The trial was designed as a randomized block with three-fold replication and three treatments; pyraclostrobin applied as a protectant (48 h prior to fungal inoculation), or as an eradicant (48 h post fungal inoculation), and an untreated control. Fungicides were applied at the manufacturer’s recommended field rate using the system described by Burke & Dunne (2008). Disease was assessed on the second leaves as the percentage of diseased leaf area at days 16, 20, 24 and 28 post fungal inoculation. The experiment was conducted twice.

Effect of the QoIs on Mycosphaerella graminicola pycnidiospore germination

The effects of the QoI fungicides azoxystrobin and pyraclostrobin on the germination of pycnidiospores of eight M. graminicola isolates were determined using a spore germination assay. Diseased leaf material of each isolate was produced on untreated seedling leaves of cv. Consort as described above. To prevent cross-contamination, each isolate was inoculated onto the seedlings using an individual sprayer, and each pot was subsequently sealed in a clear polythene bag and placed into the controlled environment. Adequate space was provided between pots to ensure once bags were removed leaves from different pots did not touch. To prevent splash dispersal of spores, no overhead watering was performed. To induce pycnidiospore production and release, diseased leaf material was cut into 5 cm sections, placed on water agar and incubated for 24 h, in the dark, at 20°C. Pycnidiospores emerging from the pycnidia as cirri were collected using a sterile needle and suspended in 500 μL SDW. Aliquots (50 μL) of this suspension were inoculated onto water agar, and water agar amended with pyraclostrobin or azoxystrobin to a final concentration of 0·33 mg active ingredient L−1. A cover-slide was placed over the inoculated pycnidiospores and plates were incubated in the dark at 20°C. After 24 h incubation, germination of the different isolates was determined by visually assessing 100 pycnidiospores. Germination was regarded as successful if apical germ tubes were greater in length than the original pycnidiospore. The effect of the QoIs on germination was determined by measuring the length of 30 pycnidiospore germ tubes of each isolate using a compound microscope with a calibrated eye piece (×40). The assay was conducted twice.

Data analysis

The disease assessment data collected at various assessments in both the field and glasshouse trials were used to generate, for each replicate of each treatment, the area under the disease progress curve (AUDPC) (Shaner & Finney, 1977). Differences in the ability of the fungicides to control STB were determined by analysis of variance (anova) using a general linear model procedure. In the model, treatments and blocks were classified as fixed and random factors, respectively. Comparisons between treatments were determined using Tukey’s studentized range test at the 5% level. Using the same model, the effects of the different treatments on yield were also investigated. For the pycnidiospore germination assay, differences in germination between the QoI treatments and the untreated controls were calculated for each isolate using a 2-sample t-test. All statistical analysis was performed using Minitab 14 (Minitab, Inc.).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Effect of QoIs on STB development and wheat yields

Isolates with the cytochrome b G143A mutation dominated the M. graminicola population at the trial prior to the initial fungicide application in both years, with 86% and 97% of the isolates possessing the mutation in 2006 and 2007, respectively. No isolates with the F129L mutation were detected in either year.

High disease levels were observed in both seasons (all leaf layers assessed in the untreated plots were completely diseased by early July) and significant differences in disease control were observed between treatments (Table 3). Disease development was slower in 2007 than in 2006. In both seasons, epoxiconazole significantly reduced disease on all leaf layers compared to azoxystrobin, pyraclostrobin and the untreated. Both QoIs reduced disease significantly, although differing in their abilities to do so. Azoxystrobin only provided significant reductions in disease on the flag leaves in 2006. Pyraclostrobin reduced disease significantly on the flag leaves and second leaves in 2006 and on the first three leaf layers in 2007. In 2007, the control provided by pyraclostrobin on the flag leaves, second leaves and third leaves was significantly greater than that provided by azoxystrobin.

Table 3.   Area under disease progress curves (AUDPC) of winter wheat (leaves 1–4) and yield infected by Mycosphaerella graminicola following three applications of epoxiconazole, azoxystrobin, pyraclostrobin or left untreated in 2006 and 2007
YearTreatmentAUDPCaYieldb t ha−1
Leaf 1Leaf 2Leaf 3Leaf 4
  1. aFor each year column values for area under disease progress curves and yield not sharing the same accompanying letter were significantly different as determined by Tukey’s studentized range test (< 0·05).

  2. bYield calculated at 15% grain moisture.

  3. cTukey’s studentized range test (< 0·05).

2006Untreated2007a2902a3825a4027a5·48a
Epoxiconazole61b395b2224b2989b9·41b
Pyraclostrobin1016c2087c3620a3912a7·05c
Azoxystrobin1227c2295ac3687a3961a6·76c
HSD (< 0·05)c4997185484111·27
2007Untreated1501a1984a2775a3523a6·04a
Epoxiconazole180b351b1000b2002b8·85b
Pyraclostrobin932c1512c2109c2991a6·93c
Azoxystrobin1302a1918a2845a3351a6·13ac
HSD (< 0·05)2612225286110·83

In both years, plots treated with epoxiconazole had a significantly greater yield than those treated with azoxystrobin or pyraclostrobin, or untreated (Table 3). In 2006, both QoIs significantly increased yields compared to the untreated control, whereas in 2007, only pyraclostrobin significantly increased yields compared to the untreated control.

Effect of the QoI pyraclostrobin on STB development on wheat seedlings under controlled environmental conditions

Initial disease symptoms were generally observed around 10–12 days post- inoculation (dpi) as necrotic flecks randomly dispersed throughout the inoculated leaves. All isolates, with the exception of OFF1, caused >70% disease on the second leaves 28 dpi. No disease was observed on pyraclostrobin-treated leaves inoculated with the sensitive M. graminicola isolate (OFF1), while only seven of the 108 pyraclostrobin-treated leaves inoculated with the intermediately resistant isolate ss10 showed any visible symptoms of disease. Pyraclostrobin significantly delayed disease development caused by each of the three resistant isolates (KK14, R27 and WAT8) (Table 4). No significant differences were observed between the pre- or post-fungal inoculation applications of pyraclostrobin in terms of their effects on delaying disease development caused by the resistant isolates.

Table 4.   Development of septoria tritici blotch caused by five Mycosphaerella graminicola isolates differing in their resistance to the QoIs following treatment with pyraclostrobin applied 48 h pre or post fungal inoculation
IsolateQoI statusaAUDPCbHSD (< 0·05)c
UntreatedQoI-PreQoI-Post
  1. aConfirmed by partial sequence analysis of the cytochrome b gene and an azoxystrobin microtitre plate assay; S, wild type and sensitive; I, F129L mutation reduced sensitivity; R, G143A and resistant.

  2. bArea under disease progress curve. Treatment with QoI pre and post fungal inoculation prevented disease development on the sensitive isolate.

  3. cTukey’s studentized range test (< 0·05).

  4. *Significantly different to the untreated controls (< 0·05).

OFF1S42600
ss10I5530·631·4
KK14R842510*460*216
WAT8R451172*123*240
R27R905481*424*207

Effect of azoxystrobin and pyraclostrobin on the germination of Mycosphaerella graminicola pycnidiospores

Pycnidiospore germination was recorded within 3 h of the initiation of incubation as primary germ tube growth from the apices. Following 24 h incubation, primary germ tubes had developed up to four times the length of the original spore, with secondary germ tubes emerging both from the original spore and the primary germ tubes (Table 5; Fig. 1). Similar patterns of germination were observed among all eight isolates assessed. Differences were recorded between the different isolates and azoxystrobin and pyraclostrobin with respect to germination and subsequent growth. Azoxystrobin and pyraclostrobin completely inhibited germination of the sensitive isolate (OFF1), with no attempts at germination observed. Azoxystrobin failed to prevent germination of the intermediate-resistant isolate (ss10), although the fungicide did significantly reduced germ tube length. Germination of ss10 pycnidiospores was inhibited by pyraclostrobin. Neither azoxystrobin nor pyraclostrobin prevented germination of the resistant isolates, and no malformations in germination were observed. Differences were, however, observed between fungicides for the resistant isolates, with pyraclostrobin significantly reducing germ tube length (Table 5; Fig. 1).

Table 5.   Effect of the QoIs azoxystrobin and pyraclostrobin on germination of Mycosphaerella graminicola pycnidiospores
IsolateQoI statusaPycnidiospore size (μm)bGerm tube length after 24 h (μm)
UntreatedAzoxystrobinPyraclostrobin
  1. aAs in Table 1.

  2. bAverage length of 60 pycnidiospore germ tubes assessed over two replicates. Treatments with * had significantly (< 0·05) less growth than their untreated equivalents.

  3. cValues in brackets represent standard deviations.

  4. dn.g., no germination detected.

OFF1S46 (±10·15)c184 (±33·88)n.g.dn.g.
ss10I51 (±14·23)204 (±30·77)156 (±26·28)n.g.
Epo 6/9R43 (±4·85)189 (±44·81)189 (±33·90)121 (±26·79)*
KK14R41 (±10·13)161 (±36·48)148 (±37·19)103 (±21·12)*
WAT8R38 (±6·89)159 (±38·02)150 (±39·08) 94 (±21·63)*
R27R42 (±13·21)152 (±30·26)143 (±27·51) 91 (±18·99)*
ss4R45 (±2·81)197 (±41·32)168 (±36·18)106 (±26·27)*
ss5R44 (±2·14)184 (±28·57)182 (±36·12)104 (±21·07)*
image

Figure 1.  Germination of Mycosphaerella graminicola pycnidiospores of the sensitive isolate OFF1 (a,b,c), the intermediate isolate (d,e,f) and the resistant isolate (g,h,i) after 24 h incubation on untreated water agar (a,d,g), azoxystrobin amended water agar (b,e,h) and pyraclostrobin amended water agar (c,f,i). Bar represents 40 μm and black arrowheads indicate original pycnidiospore.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The lack of efficacy of the QoI fungicides against STB was evident in both field trials conducted in this study. Poor efficacy associated with the G143A mutation has been observed elsewhere in north-western Europe (Gisi et al., 2005; Lockley & Clark, 2005). Despite high levels of QoI resistance, pyraclostrobin increased yield in both years, with azoxystrobin also increasing yields in 2006. Weekly disease assessments showed that yield increases followed a delay in STB development resulting from QoI treatment. This control only occurred for a limited period, but it probably prolonged the life of the upper leaves sufficiently for them to contribute to increased yield. McCartney et al. (2007) also found that QoI fungicides contributed to winter wheat yield in Northern Ireland, but did not suggest a reason for this.

Pyraclostrobin is regarded as a second generation QoI possessing eradicant activity. Before the emergence of resistance, Stierl et al. (2000) and Lockley & Clark (2005) highlighted pyraclostrobin’s superior curative/eradicant activity against M. graminicola compared with first generation QoIs (e.g. azoxystrobin). Adverse weather conditions in the summer of 2007 resulted in the final fungicide application being delayed by approximately 14 days. Under these conditions, the eradicant activity of pyraclostrobin may have contributed to its superior disease control and yield increase compared with azoxystrobin.

To ascertain if the limited STB control observed in the QoI-treated plots was predominantly related to the ability of the QoIs to slow the growth of M. graminicola, their effect on disease development under controlled environment conditions was investigated. Using five M. graminicola isolates, including three with the G143A mutation, the capacity of pyraclostrobin, applied either as a protectant or as an eradicant, to provide limited control of STB caused by QoI-resistant M. graminicola was demonstrated under controlled conditions. However, even here, the delay in STB symptoms may not be entirely due to direct inhibition by pyraclostrobin of QoI-resistant isolates of M. graminicola. Physiological effects on plants such as a reduction in ethylene production, inhibition of reactive oxygen species and induction of systemic acquired resistance reported by Grossmann & Retzlaff (1997), Wu & von Tiedemann (2002) and Herms et al. (2002), respectively, following QoI treatment may hamper STB development, and thus their role cannot be ruled out.

As the QoI fungicides primarily inhibit fungal growth by preventing respiration, it was considered that some level of respiration inhibition within resistant isolates may have contributed to the control of STB observed in the QoI treatments. As a means of assessing this possibility in vitro, pycnidiospore (representative of the most important field inoculum source during late spring and early summer) germination studies were performed in the presence of azoxystrobin or pyraclostrobin at half the recommended field rate. At this test concentration, pyraclostrobin restricted the growth of pycnidiospores of QoI-resistant M. graminicola while azoxystrobin did not. Extrapolation from field application rates to the concentrations present in/on treated wheat leaves in the field is not possible and, while concentrations could be determined by chemical analysis, this would be time-consuming and of limited value, since they will vary over time and are affected by environmental conditions. However, the restriction in germ tube growth in vitro strongly suggests that the control provided by pyraclostrobin in field and controlled environments was at least in part due to direct inhibitory effects on the pathogen. Further investigations of pycnidiospore germination using a range of pyraclostrobin concentrations are warranted to establish the range over which such activity occurs. The differences identified between azoxystrobin and pyraclostrobin in their effects on pycnidiospore germination may have contributed to the differences in their abilities to control the disease and increase yields under field conditions in 2007. Unlike 2006, when 14% of the M. graminicola population of the trial site was QoI sensitive, only 3% was sensitive in 2007.

Germ tube elongation and subsequent growth in the presence of pyraclostrobin progressed in a similar manner to that in the untreated controls, although at a slower rate. This suggests that pyraclostrobin reduced either the ability of the germinating spore to produce energy or the energy available to the spore required for normal growth. As the ability of both QoIs to disrupt electron transfer through the cytochrome bc1 complex is abolished by the mutation G143A, it is questionable if the slower growth rate of the resistant isolates in the presence of the fungicide results from direct inhibition of respiration. Analysis of the redox potentials and activity of QoI-resistant M. graminicola mitochondria in the presence of pyraclostrobin may determine if the fungicide still binds (albeit to a much lesser extent) and disrupts respiration.

If the QoIs are unable to inhibit respiration of M. graminicola isolates possessing the G143A mutation, pyraclostrobin must place the pathogen under some other additional stress. Roohparvar et al. (2008) have previously shown that the M. graminicola major facilitator superfamily (MFS) transporter MgMfs1 is up-regulated in field isolates with the G143A mutation following QoI treatment. As this MFS transporter has been associated with the extrusion of the QoIs azoxystrobin, kresoxim-methyl and trifloxystrobin from M. graminicola (Roohparvar et al., 2007), Roohparvar et al. (2008) suggested that its up-regulation is required to ensure normal membrane function in the presence of the QoIs. Although the MSF transporters do not actively utilise energy, other cellular transporters, such as the ATP-binding cassettes (ABC transporters), which are also activated by QoIs (Judelson & Senthil, 2006), do. Interestingly, pyraclostrobin is slightly more hydrophobic and smaller in size than azoxystrobin, and as such may have a greater negative impact on cellular fluidity within M. graminicola. It is feasible that to overcome this, a diversion of energy by the pathogen to alleviate such stresses could have resulted in the reductions in germ tube growth, and hence the differences in disease control provided by both fungicide under field conditions.

Even though pyraclostrobin consistently restricted M. graminicola development and subsequent STB development in the field, under controlled conditions and in vitro, the levels of disease control and yield increases were significantly lower than those achieved by epoxiconazole. Where QoI fungicides are applied in mixtures with triazole partners, increased disease control and yields, above those achieved by the triazole alone, have continued to be observed (McCartney et al., 2007; Thygesen et al., 2009). However, where populations are dominated by isolates of M. graminicola with the G143A mutation, the use of QoIs alone to control STB cannot be recommended. The ability of pyraclostrobin to hamper the growth of QoI-resistant M. graminicola is, however, an interesting discovery. Utilising this knowledge to enhance future control will require further research.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The authors thank Jim Grace and John Fenlon for their assistance with the field trials. This research has been funded by Teagasc under the Walsh Fellowship scheme.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Anonymous, 2006. HGCA Recommended List – Winter Wheat 2006/2007. http://www.hgca.com/document.aspx?fn=load&media_id=2377&publicationId=2010
  • Anonymous, 2008. List of Pathogens with Field Resistance Towards the QoI Fungicides. http://www.frac.info/frac/meeting/2008/Pathogens_with_field_resistance_towards_2008.pdf .
  • Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M, Parr-Dobrzanski B, 2002. The strobilurin fungicides. Pest Management Science 58, 64962.
  • Burke JJ, Dunne B, 2008. Investigating the effectiveness of the Thies Clima ‘Septoria Timer’ to schedule fungicide applications to control Mycosphaerella graminicola on winter wheat in Ireland. Crop Protection 27, 7108.
  • Fisher N, Meunier B, 2008. Molecular basis of resistance to cytochrome bc1 inhibitors. FEMS Yeast Research 8, 18392.
  • Fraaije BA, Cools HJ, Fountaine J et al. , 2005. Role of ascospores in further spread of QoI-resistant cytochrome b alleles (G134A) in field population of Mycosphaerella graminicola. Phytopathology 95, 93341.
  • Gisi U, Pavic L, Stanger C, Hugelshofer U, Sierotzki H, 2005. Dynamics of Mycosphaerella graminicola populations in response to selection by different fungicides. In: DehneHW, GisiU, KuckKH, RussellPE, LyrH, eds. Modern Fungicides and Antifungal Compounds IV. Alton, UK: BCPC, 89101.
  • Glaab J, Kaise WM, 1999. Increased nitrate reductase activity in leaf tissue after application of the fungicide kresoxim-methyl. Planta 207, 4428.
  • Grossmann K, Retzlaff G, 1997. Bioregulatory effects of the fungicidal strobilurin kresoxim-methyl in wheat (Triticum aestivum). Pesticide Science 50, 1120.
  • Hardwick NV, Jones DR, Slough JE, 2001. Factors affecting diseases of winter wheat in England and Wales, 1989–98. Plant Pathology 50, 45362.
  • Heaney SP, Hall AA, Davies SA, Olaya G, 2000. Resistance to fungicides in the QoI-STAR cross-resistance group: current perspectives. In: Proceedings of the BCPC Congress, Pests and Diseases 2000. Alton, UK: BCPC, 75562.
  • Herms S, Seehaus K, Koehle H, Conrath U, 2002. A strobilurin fungicide enhances the resistance of tobacco against tobacco mosaic virus and Pseudomonas syringae pv. tabaci. Plant Physiology 130, 1207.
  • Judelson HS, Senthil G, 2006. Investigating the role of ABC transporters in multifungicide insensitivity to Phytophthora infestans. Molecular Plant Pathology 7, 1729.
  • Kildea S, 2009. Fungicide Resistance in the Wheat Pathogen Mycosphaerella graminicola. Belfast, UK: Queens University Belfast, PhD thesis.
  • Kildea S, Mullins E, Mercer PC, Cooke LR, Dunne B, O’Sullivan E, 2006. Sensitivity of Mycosphaerella graminicola populations in the Republic of Ireland to DMI and QoI fungicides. In: BrysonRJ, BurnettFJ, FosterV, FraaijeBA, KennedyR, eds. Fungicide Resistance: Are We Winning the Battle but Losing the War? Aspects of Applied Biology 78, 5964.
  • Leroux P, Walker SA, Albertini C, Gredt M, 2006. Resistance to fungicides in French populations of Septoria tritici, the causal agent of wheat leaf blotch. In: BrysonRJ, BurnettFJ, FosterV, FraaijeBA, KennedyR, eds. Fungicide Resistance: Are We Winning the Battle but Losing the War? Aspects of Applied Biology 78, 15362.
  • Lockley D, Clark WS, 2005. Fungicide Dose-response Trials in Wheat: the Basis for Choosing ‘Appropriate Dose’. London, UK: Home-Grown Cereals Authority: HGCA Project Report no. 373.
  • McCartney C, Mercer PC, Cooke LR, Fraaije BA, 2007. Effects of a strobilurin-based spray programme on disease control, green leaf area, yield and development of fungicide-resistance in Mycosphaerella graminicola in Northern Ireland. Crop Protection 26, 127280.
  • Nason MA, Farrar J, Bartlett D, 2007. Strobilurin fungicides induce changes in photosynthetic gas exchange that do not improve water use efficiency of plants grown under conditions of water stress. Pest Management Science 63, 1191200.
  • Roohparvar R, De Waard MA, Kema JHJ, Zwiers LH, 2007. MgMfs1, a major facilitator superfamily transporter from the fungus wheat pathogen Mycosphaerella graminicola, is a strong protectant against natural toxic compounds and fungicides. Fungal Genetics and Biology 45, 37888.
  • Roohparvar R, Mehrabi R, Van Nistelrooy JGM, Zwiers LH, De Waard MA, 2008. The drug transporter MgMfs1 can modulate sensitivity of field strains of the fungal wheat pathogens Mycosphaerella graminicola to the strobilurin fungicide trifloxystrobin. Pest Management Science 64, 68593.
  • Ruske RE, Gooding MJ, Jones SA, 2003. The effects of adding picoxystrobin, azoxystrobin and nitrogen to a triazole programme on disease control, flag leaf senescence, yield and grain quality of winter wheat. Crop Protection 22, 97587.
  • Shaner G, Finney RE, 1977. The effect of nitrogen fertilization on the expression of slow-mildewing resistance in Knox wheat. Phytopathology 67, 10516.
  • Sierotzki H, Wullschleger J, Gisi U, 2000. Point mutation in cytochrome b gene conferring resistance to strobilurin fungicides in Erysiphe graminis f.sp. tritici field isolates. Pesticide Biochemistry and Physiology 68, 10712.
  • Sierotzki H, Frey R, Wullschleger J et al. , 2007. Cytochrome b gene structure and structure of Pyrenophora teres and P. tritici-repentis and implications for QoI resistance. Pest Management Science 63, 22533.
  • Stierl R, Merk M, Schrof W, Butterfield EJ, 2000. Activity of the new BASF strobilurin fungicide, BAS 500 F, against Septoria tritici on wheat. In: Proceedings of the BCPC Conference, Pests and Diseases 2000. Alton, UK: BCPC, 85964.
  • Thygesen K, Jørgensen LN, Jensen KS, Munk L, 2009. Spatial and temporal impact of fungicide spray strategies on fungicide sensitivity of Mycosphaerella graminicola in winter wheat. European Journal of Plant Pathology 123, 43547.
  • Ware SB, 2006. Aspects of Sexual Reproduction in Mycosphaerella Species on Wheat and Barley: Genetic Studies on Specificity, Mapping, and Fungicide Resistance. Wageningen, the Netherlands: Wageningen University, PhD thesis.
  • Wu Y, Von Tiedemann A, 2002. Impact of fungicides on active oxygen species and antioxidant enzymes in spring barley (Hordeum vulgare L.) exposed to ozone. Environmental Pollution 116, 3747.
  • Zhan J, Kema GHJ, Waalwijk C, McDonald BA, 2002. Distribution of mating type alleles in the wheat pathogen Mycosphaerella graminicola over spatial scales from lesions to continents. Fungal Genetics and Biology 36, 12836.