SEARCH

SEARCH BY CITATION

Keywords:

  • detection;
  • nested-PCR;
  • Sclerotinia sclerotiorum;
  • stem rot of oilseed rape

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study established a quick and accurate method to detect petal infection of oilseed rape (Brassica napus) by Sclerotinia sclerotiorum using a nested-PCR technique. DNA samples were extracted from each petal using a microwave method, followed by two rounds of PCR amplification. The first-round PCR amplification was performed using the universal fungal primer pair ITS4/ITS5, and the second-round amplification with a specific primer pair XJJ21/XJJ222, which was designed using the single-nucleotide polymorphisms among nuclear rDNA ITS sequences of Sclerotinia spp., Botrytis spp. and other selected fungi. The established technique is rapid and inexpensive, and has a high degree of specificity and sensitivity. This assay can distinguish Sclerotinia spp. from other fungi, including Botrytis cinerea, a closely related and frequent cohabitant on oilseed rape petals, and can detect 50 fg genomic DNA, five ascospores of S. sclerotiorumin vitro or 50 ascospores of S. sclerotiorum on one petal in approximately 6 h, even in the presence of a high background of oilseed rape DNA. This technique was successfully applied in detecting natural petal infections.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Oilseed rape (Brassica napus) is an important crop for edible oil in China. Its annual planting area in China is about 7·0–8·0 million hectares, with more than 80% of the planting areas around the Yangtze River region. The weather conditions (such as temperature, rainfall and humidity) in the region are very conducive to epidemics of stem rot caused by Sclerotinia sclerotiorum, making it the most important disease of oilseed rape in the region. The disease kills whole plants when infection occurs in lower stems, and/or rots branches, branchlets and pods; it causes serious losses by reducing both yield and oil content. It causes an estimated annual loss of 10–30% in seed yield (Yang, 1959; Yang et al., 2004). Stem rot of oilseed rape is very difficult to control since no resistant cultivars are available. Fungicides, such as dimethachlon, carbendazim, iprodione, procymidone and boscalid, are applied for controlling stem rot (Ma et al., 2009), and disease forecasting is mainly based on density of apothecia in soil and weather conditions during the flowering stage of the crop in China (Xu et al., 2003).

Sclerotinia sclerotiorum produces sclerotia as dormant structures to oversummer and overwinter. Sclerotia may germinate mycelially and infect plants directly in the autumn. However, they may also germinate carpogenically and produce apothecia. From apothecia, airborne ascospores are produced and released. These ascospores germinate in 3 h after landing on petals of oilseed rape and develop spreading hyphae within 30 h (Jamaux et al., 1995), the hyphae in infected petals serving as secondary inocula infecting other parts of the plant and spreading the disease (Yang, 1959; Gugel & Morrall, 1986), and lesions becoming visible in 3 days.

Petal infection is the first step for development and prevalence of stem rot of oilseed rape. Gugel & Morrall (1986) and McCartney et al. (2001) showed that disease incidence of sclerotinia stem rot was positively related to the percentage of flower petals infested with ascospores of S. sclerotiorum at the early flowering stage. Therefore, quick and accurate monitoring of the ascospore concentration on the flower at the early flowering stage is essential to estimate disease potential.

Previously, several methods were developed to assay petal infection. Petals in fields can be collected and placed on semiselective medium (sometimes containing pH indicators). Infected petals can be detected when mycelia grow from the petals (Steadman et al., 1994; Guttierez & Shew, 1998; Hudyncia et al., 2000; Atallah & Johnson, 2004). However, this method takes several days to give results. Molecular techniques based on DNA sequence are rapid, specific and sensitive, and have been used to detect several species of pathogenic fungi, bacteria, viruses and nematodes (Nolasco et al., 1993; Niessen & Vogel, 1998; Fraaije et al., 2001; Hoy et al., 2001; Grote et al., 2002; Chen et al., 2003; Chilvers et al., 2007; Gao et al., 2009). To date, three pairs of PCR primers have been developed for the detection of S. sclerotiorum (Freeman et al., 2002; Roger et al., 2009; Yin et al., 2009). In the laboratory of the present study and elsewhere, as reported by Yin et al. (2009), the primer pair SSREV/SSFWD, developed by Freeman et al. (2002), was not specific enough to distinguish S. sclerotiorum from Botrytis spp., even at a very high annealing temperature in PCR amplification. Botrytis spp., especially B. cinerea, are often present in senescent and dead flowers and leaves, but cause insignificant damage on oilseed rape. Yin et al. (2009) developed a real-time PCR assay using the primer pair SsF/SsR to detect S. sclerotiorum on the petals of oilseed rape. Roger et al. (2009) designed a pair of primers, mtSSFor/mtSSRev, and a quantitative PCR to detect ascospores of S. sclerotiorum. These techniques are accurate and sensitive, but require high quality DNA to ensure reliable results and are expensive and difficult to apply on a large scale. Furthermore, the relationship between quantity of S. sclerotiorum on each petal and the risk of crop infection is still yet not proven.

Thus, in the present study, a nested-PCR assay with the universal primer pair ITS4/ITS5 and a specific primer pair XJJ21/XJJ222 was developed to monitor the percentage of petals infested with S. sclerotiorum at early stages of infection. The new method is rapid, inexpensive and applicable to large-scale detection to measure the risk of sclerotinia stem rot of oilseed rape.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fungal isolates, media and culture

Twenty-two isolates of 12 fungal species were used in this study, including four Sclerotinia spp., five Botrytis spp., Alternaria tenuis, Fusarium graminis and Coniothyrium minitans, a ubiquitous mycoparasite of S. sclerotiorum (Table 1). All the isolates were maintained as mycelial cultures on potato dextrose agar (PDA) at 20°C and stored on PDA slants at 4°C.

Table 1.   Isolates of Sclerotinia sclerotiorum and other fungal species used in this study, with host origin and location
SpeciesIsolateHost originLocation
Sclerotinia sclerotiorumSUN-F-MHelianthus annuusHohhot, Inner Mongolia
SSSZ-14Brassica napusSuizhou, Hubei
SSSZ-254Brassica napusSuizhou, Hubei
SSSZ-25Brassica napusSuizhou, Hubei
SSXG-3Brassica napusXiaogan, Hubei
SSXG-25Brassica napusXiaogan, Hubei
EP-1PNAaSolanum melongenaJiamusi, Heilongjiang
S. nivalisLet-19Lactuca sativaShennongjia, Hubei
S. trifoliorumYwd-APisum sativumWuhan, Hubei
S. minor2003-4-1Lactuca sativaShennongjia, Hubei
Botrytis cinereaGarlicBc-5Allium sativumWuhan, Hubei
Peonybc-2Paeonia suffruticosaWuhan, Hubei
Canbc-2Brassica napusYichang, Hubei
Canbc-6Brassica napusXiaogan, Hubei
B. porriGarlicBc-16Allium sativumZhushan, Hubei
B. acladaOnionBC-7Allium ascalonicumEzhou, Hubei
B. squamosaGarlicBc-2Allium sativumWuhan, Hubei
B. ellipticaLilyBc-2Lilium browniiWuhan, Hubei
Coniothyrium minitansZS-1S. sclerotiorumZhushan, Hubei
Chy-1S. sclerotiorumChangyang, Hubei
Alternaria tenuisWH-3Oxalis corymbosaWuhan, Hubei
Fusarium graminisXGGZ-1Triticum aestivumXiaogan, Hubei

Preparation of ascospores and inoculation

Naturally germinated apothecia of S. sclerotiorum were collected from an oilseed rape field located on the campus of Huazhong Agricultural University, Wuhan, Hubei Province. Mature apothecia were collected from the stem with forceps and put into a sterilized 10-mL syringe with 3 mL sterilized ddH2O. The syringe was pumped many times to release the ascospores. The ascospore suspension was filtered through three layers of lens paper. Ascospore concentration was determined with a haemacytometer under a light microscope and then adjusted with sterilized ddH2O containing 0·01% Tween-20 to 5 × 105, 5 × 104, 5 × 103 or 5 × 102 ascospores mL−1. The diluted ascospore suspensions were used either directly in nested-PCR experiments or for petal inoculation.

Oilseed rape petals (cv. Zhongyou 821) were collected from greenhouse-grown plants and used in experiments within 1 h of collection. Ten microlitres of each ascospore concentration were inoculated onto each petal with 20 petals per concentration (i.e. approximately 5000, 500, 50, 5 or 0 ascospores per petal). Ten petals of each treatment were immediately frozen at −80°C individually in 1·5-mL centrifuge tubes until DNA extraction. The remaining 10 petals were incubated in the dark at 24°C with 100% humidity in sealed Petri dishes to allow spore germination.

DNA extraction and purification from mycelium and oilseed rape petals

To extract genomic DNA, mycelia from fungal isolates were spread on a cellophane membrane placed on PDA plates, and incubated for 36 h for Sclerotinia spp. and Botrytis spp., or 5 days for C. minitans, F. graminis and A. tenuis. Mycelia were then harvested by removing the mycelial mat from the cellophane membrane and genomic DNA was extracted with CTAB following the standard procedure (Sambrook et al., 1989). DNA samples were stored at −80°C before use.

To extract total genomic DNA from oilseed rape petals, a microwave-based method was used. Each infested petal, either from the −80°C freezer or from the set incubated at 24°C for 24 h, was put in a Eppendorf tube with 200 μL extraction buffer [2% CTAB (w/v), 2% PVP (w/v), 1·4 m NaCl, 0·1 m Tris–HCl (pH 8·0), 0·02 m EDTA]. Tubes were heated in a microwave oven at 600–700 W three times for 20, 20 and 15 s, respectively, with intervals of 10–20 s between treatments to avoid boiling. After adding another 200 μL extraction buffer, the tubes were treated in a water bath (80°C) for 5 min. The DNA samples were extracted with phenol-chloroform and precipitated with isopropyl alcohol and centrifugation (11 000 g.). Pellets were washed twice with 70% ethanol and air-dried at 37°C for 10 min, and then resuspended in 15 μL sterilized ddH2O, following standard protocols (Sambrook et al., 1989).

Nested-PCR assays

The PCR amplification consisted of two steps. In the first round of PCR amplification, universal primers ITS4 and ITS5 (White et al., 1990) were used. Each 25-μL PCR reaction mixture contained 10 pmol each primer, 0·5 U Taq DNA polymerase (Takara), 10× PCR buffer, 0·2 mm dNTP and 50 ng DNA of each fungal isolate, plus 10 μL DNA from an oilseed rape petal or 10 μL ascospore suspension as prepared above. Cycling conditions were: 95°C for 4 min; then 30 cycles of 94°C for 30 s, 50°C for 45 s and 72°C for 1 min; followed by a final extension of 72°C for 5 min.

To conduct the second round of PCR amplification, a Sclerotinia-specific primer pair, XJJ21 and XJJ222, developed in this study (Table 2), was used. To design the specific primers, the DNA sequences of ITS regions of Sclerotinia spp. and Botrytis spp. were aligned and analysed with the clustal w program, and then primers were designed with the primer premier program (V.5.0). The length of expected PCR product from Sclerotinia spp. was 292 bp using genomic DNA or first-round PCR amplification product as DNA template. Each 25-μL XJJ21/XJJ222 PCR reaction mixture contained 10 pmol each primer, 0·5 U Taq, 10× PCR buffer, 0·2 mm dNTP and 1 μL of 10-fold-diluted first-round PCR products (1 μL of undiluted first round PCR products for DNA from oilseed rape petal or ascospores) as template. Cycling conditions were: 95°C for 4 min; then 30 cycles of 94°C for 30 s, 63°C for 30 s and 72°C for 30 s; followed by a final extension of 72°C for 5 min. Products from the second round of amplification were analysed on 1·5% agarose gel and the DNA was stained with ethidium bromide. PCR amplifications were also performed using primers SSREV/SSFWD according to Freeman et al. (2002).

Table 2.   Sequence characteristics of primers used in this study
Primer nameSequence (5′–3′)aBasesTm (°C)Expected PCR sizeReference
  1. aSNP sites are underlined, and introduced nucleotide substitutions are boxed.

ITS4TCCTCCGCTTATTGATATGC2058564White et al. (1990)
ITS5GGAAGTAAAAGTCGTAACAAGG2257
XJJ21GTTGCTTTGGCGTGCTGCTC2065292This study
XJJ222CTGACATGGACTCAATACCAATCTG2563
SSREVTGACATGGACTCAATACCAAGCTG2463278Freeman et al. (2002)
SSFWDGCTGCTCTTCGGGGCCTTGTATGC2470

To determine if host-plant DNA would interfere with the nested PCR, 10 ng genomic DNA of B. cinerea or Brassica napus was added to the nested-PCR reaction mixture and compared with the same reactions without host-plant DNA. To test the applicability of the nested PCR with naturally infested samples, 80 petals of oilseed rape from a field with a history of sclerotinia stem rot were collected at early stages of infection. DNA was isolated from each petal using the microwave method and processed as described above. The nested-PCR was applied to the 80 DNA samples and the number of samples showing positive results was noted.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Design of PCR primers

Internal transcribed spacer (ITS) sequences of S. sclerotiorum and other selected fungi were downloaded from GenBank (http://www.ncbi.nlm.nih.gov) and analysed using the programs dnaman 5.0, primer premier 5.0 program and oligo 6. The accession numbers of the ITS sequences used were: S. sclerotiorum, EF091809, M96382; S. trifoliorum, U01218; S. minor, Z99673; B. cinerea, Z73765, EU519210; B. porri, EU519206; B. aclada, EU000196; B. squamosa, EU519205; B. elliptica, EU519207; Monilinia laxa, EF153017; C. minitans, AJ293809. The ITS sequences of S. sclerotiorum and B. cinerea shared 99% identity and there were only eight single-nucleotide polymorphisms (SNPs) in the region. The S. sclerotiorum-specific primers XJJ21/XJJ221 were designed by using four SNPs, namely the 125th, 126th, 374th and 391th, and by creating two mismatched sites, the 119th and 377th (Fig. 1, Table 2). The specificity of the primers was checked using blast searches of the GenBank databases. The results showed that although the PCR assay could not distinguish S. sclerotiorum from the closely related Sclerotinia species, S. trifoliorum (accession number U01218) and S. minor (accession number Z99673), it did not amplify DNA from the other fungi, including B. cinerea.

image

Figure 1.  Alignment of ITS sequences of Sclerotinia sclerotiorum (EF091809) and Botrytis cinerea (Z73765) in the regions of the forward primer XJJ21 (a) and the reverse primer XJJ222 (b). Base gaps are indicated by dots. R-C-Primer XJJ222* means the reverse complement sequence of primer XJJ222.

Download figure to PowerPoint

Specificity and sensitivity of the assay

Nested-PCR assays using primer pairs ITS4/ITS5 and XJJ21/XJJ222 and PCR assays using primer SSFWD/SSREV developed by Freeman et al. (2002) were conducted using genomic DNA from a range of different fungal species (Table 1). A predicted 292-bp fragment was amplified specifically using the primers pairs ITS4/ITS5 and XJJ21/XJJ222 from isolates of Sclerotinia spp., but no products were obtained from other fungal isolates tested, including Botrytis spp., Fusarium sp., Alternaria sp. and Coniothyrium sp. However, PCR using primers SSFWD/SSREV could not distinguish isolates from Sclerotinia and Botrytis species (Fig. 2).

image

Figure 2.  Specificity test of (a) the nested PCR with primer pairs ITS4/ITS5 and XJJ21/XJJ222 and (b) PCR with primer pair SSREV/SSFWD using DNA from different fungal species. Lane M: 100-bp marker (Fermentas); lanes 1–7: isolates SUN-F-M, SSSZ-14, SSSZ-254, SSSZ-25, SSXG-3, SSXG-25 and EP-1PNAa of S. sclerotiorum, respectively; lanes 8–10: Sclerotinia nivalis Let-19, S. trifoliorum Ywd-A and S. minor 2003-4-1, respectively; lanes 11–14: isolates GarlicBc-5, Peonybc-2, Canbc-2 and Canbc-6 of Botrytis cinerea, respectively; lanes 15–18: B. porri GarlicBc-16, B. aclada OnionBC-7, B. suqamosa GarlicBc-2 and B. elliptica LilyBc-2, respectively; lanes 19 and 20: isolates ZS-1 and Chy-1 of Coniothyrium minitans, respectively; lane 21: Alternaria tenuis WH-3; lane 22: Fusarium graminis XGGZ-1; lane 23: (water) negative control.

Download figure to PowerPoint

Sensitivity tests were carried out using 10-fold serial dilutions of genomic DNA of S. sclerotiorum isolate Sunf-M as template. One microlitre of 5000, 500, 50, 5 or 0·5 fg μL−1 was used as DNA template in the first round of the nested PCR reaction. One microlitre of first-round PCR products was used as template for second-round PCR amplification. The PCR amplifications were conducted nine times for each DNA concentration. Among the nine PCR repeats, nine positive amplifications were detected when 5000 or 500 fg μL−1 template DNA were used, but only eight and four positive amplifications were detected when 50 and 5 fg μL−1 template DNA were used, respectively. No positive amplifications were obtained when only 0·5 fg μL−1 template DNA was used. Sensitivity for detecting ascospores of S. sclerotiorum was also tested using 5000, 500, 50 or 5 ascospores as PCR template in each 25-μL PCR reaction mixture. Positive amplification results were obtained from five ascospores per reaction in eight out of nine PCR repeats.

In order to test the influence of genomic DNA of B. cinerea and Brassica napus on the PCR assay, nested-PCR was conducted to amplify S. sclerotiorum DNA in the presence 10 ng of B. cinerea or Brassica napus DNA with primer pairs ITS4/ITS5 and XJJ21/XJJ222. The results showed that background DNA of B. cinerea decreased the assay’s sensitivity from 50 fg DNA of S. sclerotiorum to 500 fg, whilst DNA of Brassica napus showed no influence on the sensitivity of the nested PCR (Fig. 3).

image

Figure 3.  Sensitivity test of the nested PCR with primer pairs ITS4/ITS5 and XJJ21/XJJ222 in amplifying Sclerotinia sclerotiorum DNA in the presence of 10 ng Brassica napus DNA (a), 10 ng Botrytis cinerea DNA (b), or in the absence of host plant DNA (c). Lanes 1–to 7: 10 ng, 1 ng, 100 pg, 50 pg, 5 pg, 500 fg and 50 fg S. sclerotiorum DNA, respectively; lane 8: water; lane 9: no-DNA negative control.

Download figure to PowerPoint

Detection of S. sclerotiorum on oilseed rape petals

In order to determine the sensitivity of the assay with a high background of plant and other microorganisms’ DNA, ascospores were inoculated onto petals and DNA samples extracted. Ten microlitres of DNA from oilseed rape petals inoculated with 5000, 500, 50 or 5 ascospores and non-inoculated petals were used to perform nested PCR with the specific primers. Results showed that the targeted DNA fragment could be detected when petals were inoculated with 50 ascospores or more, regardless of whether the DNA samples were extracted from petals immediately after inoculation or after a 24-h incubation post-inoculation (Table 3). There was no amplification in any of the negative control PCRs containing reagent only, or spore-free petal samples.

Table 3.   Detection of Sclerotinia sclerotiorum ascospores on oilseed rape petals by nested PCR with primer pairs ITS4/ITS5 and XJJ21/ XJJ222
TreatmentaDetection rate (number of positive tests/total number of tests)
5 × 102 ascospores5 × 10 ascospores5 ascosporesWater-no ascospores
  1. aAscospores were inoculated onto oilseed rape petals, then immediately stored at −80°C (‘No incubation’), or incubated for 24 h at 20°C to allow spore germination and reproduction (‘24 h incubation’).

No incubation10/109/101/100/10
24 h incubation10/107/100/100/10

The aim of the nested-PCR assay was to detect the percentages of petal infestation at early flowering in the field. Eighty pieces of senescent and detached petals were collected randomly from the leaves of oilseed rape in the campus experimental field of Huazhong Agricultural University. DNA was extracted from each petal, then 10 μL DNA were PCR-amplified to detect S. sclerotiorum. The target DNA fragment was amplified from 28 of the 80 petal samples (Fig. 4).

image

Figure 4.  Detection of Sclerotinia sclerotiorum on naturally infested oilseed rape petals using the nested-PCR amplification. Lane M: 100-bp marker (Fermentas); lanes 1–10: 10 petals randomly collected from a field; lane 11: 10 ng DNA of S. sclerotiorum SUN-F-M (positive control); lane 12: water (negative control).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The ITS regions of rDNA change rapidly and carry differences between closely related species and even within species (Ward & Adams, 1998; Martin & Rygiewicz, 2005). Because of the significant diversity of ITS among fungi, DNA sequences of ITS regions can facilitate fungal barcoding (Druzhinina et al., 2005; Koljalg et al., 2005). However, some species are so close phylogenetically that their ITS regions are almost identical or highly similar. The ITS sequences of S. sclerotiorum and B. cinerea share 99% identity, with only eight SNPs in the ITS region. In the present study, based on the SNP sites, a pair of primers (XJJ21/XJJ221) able to distinguish Sclerotinia spp. from Botrytis spp. and other fungi was successfully designed by introduction of one nucleotide substitution to each forward and reverse primer. The nucleotide substitution strategy for primer designing has been proven previously (Ye et al., 2001; Chen et al., 2003; Yu et al., 2007); this study confirmed that it can be used to distinguish fungi whose ITS regions share 99% identity.

Because B. cinerea and its related species are often found living on the senescent flowers of oilseed rape without causing significant disease, it is necessary to distinguish S. sclerotiorum from B. cinerea in PCR detection. The nested-PCR assay established here may help in making decisions for the control of stem rot since it can distinguish S. sclerotiorum from B. cinerea and other Botrytis spp. The primer pair used cannot distinguish S. sclerotiorum from other Sclerotinia species, such as S. trifoliorum, S. minor and S. nivalis, but this is not a problem since the other Sclerotinia spp. are not natural pathogens of oilseed rape and are typically not found in oilseed rape fields, plus they have limited natural host ranges (Bom & Boland, 2000).

High sensitivity is one of the advantages of the nested-PCR assay. As the results showed, the targeted DNA fragment can be amplified from 500 fg fungal genomic DNA in the presence of a high background of DNA of B. cinerea, or about 50 ascospores (approximate 100 nuclei of S. sclerotiorum) on one petal. An ascospore when deposited on a petal may germinate in 3 h if conditions permit, with hyphae emerging at the cell junctions or through the periclinal cell walls about 30 h post-inoculation (Jamaux et al., 1995). Thus, one petal can have about 100 nuclei (about 10 cells) within 2 days in field conditions if this ascospore colonizes successfully (Wong & Willetts, 1979), and this can be detected by nested PCR. Usually, post-inoculation incubation would allow multiplication of the pathogen and increase DNA contents. It is curious that the incubation did not improve in this case detection rates, and the number of positive amplifications actually decreased after the 24-h incubation (Table 3). The reason behind this decrease remains to be determined.

The other advantage of the nested-PCR assay is its speed. The time from DNA extraction to obtaining results is approximately 6 h. In this assay, microwaving was introduced to break cells before extracting petal DNA. This procedure for DNA preparation is not only rapid, being completed in as little as 15 min (Goodwin & Lee, 1993), but also very convenient for large-scale preparation of DNA samples, since petals do not need to be ground in liquid nitrogen. The sensitivity of nested PCR using such crude DNA as template was decreased to 50 ascospores per petal, which is still meaningful for the assessment of risk of disease. The nested-PCR technique has been applied to study the relationship between positive amplifications from field petal samples and the incidence of sclerotinia stem rot in a research project to establish a disease-forecasting system.

Sclerotinia sclerotiorum is worldwide plant fungal pathogen with a wide range of host plants. Besides oilseed rape, it also attacks many other important crops, including sunflower (Helianthus annuus), soybean (Glycine max) and vegetables such as lettuce, celery and beans during spring and early summer (Purdy, 1979; Boland & Hall, 1994). This rapid assay technique may find applications in other cropping systems for identification and disease forecasting of sclerotinia diseases.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The research was supported by the Special Fund for Agro-scientific Research in the Public Interest (3-21). We thank Dr Weidong Chen of the USDA-ARS (Washington State University), USA for his editorial assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Atallah ZK, Johnson DA, 2004. Development of sclerotinia stem rot in potato fields in south-central Washington. Plant Disease 88, 41923.
  • Boland GJ, Hall R, 1994. Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology 16, 93108.
  • Bom M, Boland GJ, 2000. Evaluation of polyclonal-antibody-based immunoassays for detection of Sclerotinia sclerotiorum on canola petals, and prediction of stem rot. Canadian Journal of Microbiology 46, 7239.
  • Chen P, Roberts PA, Metcalf AE, Hyman BC, 2003. Nucleotide substitution patterning within the Meloidogyne rDNA D3 region and its evolutionary implications. Journal of Nematology 35, 40410.
  • Chilvers MI, du Toit LJ, Akamatsu H, Peever TL, 2007. A real-time, quantitative PCR seed assay for Botrytis spp. that cause neck rot of onion. Plant Disease 91, 599608.
  • Druzhinina IS, Kopchinskiy AG, Komon M, Bissett J, Szakacs G, Kubicek CP, 2005. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genetics and Biology 42, 81328.
  • Fraaije BA, Lovell DJ, Coelho JM, Baldwin S, Hollomon DW, 2001. PCR-based assays to assess wheat varietal resistance to blotch (Septoria tritici and Stagonospora nodorum) and rust (Puccinia striiformis and Puccinia recondita) diseases. European Journal of Plant Pathology 107, 90517.
  • Freeman J, Ward E, Carderon C, McCartney A, 2002. A polymerase chain reaction (PCR) assay for the detection of inoculum of Sclerotinia sclerotiorum. European Journal of Plant Pathology 108, 87786.
  • Gao F, Liu PY, Ma JF, Li H, Li GY, 2009. Studies on the detection of defoliating and non-defoliating pathotypes of Verticillium dahliae in soils. Acta Phytopathologica Sinica 39, 3103.
  • Goodwin DC, Lee SB, 1993. Microwave miniprep of total genomic DNA from fungi, plants, protists and animals for PCR. BioTechniques 15, 438, 441–2, 444.
  • Grote D, Olmos A, Kofoet A, Tuset JJ, Bertolini E, Cambra M, 2002. Specific and sensitive detection of Phytophthora nicotianae by simple and nested-PCR. European Journal of Plant Pathology 108, 197207.
  • Gugel RK, Morrall RAA, 1986. Inoculum-disease relationships in sclerotinia stem rot of rapeseed in Saskatchewan. Canadian Journal of Plant Pathology 8, 8996.
  • Guttierez WA, Shew HD, 1998. Identification and quantification of ascospores as the primary inoculum for collar rot of green-house-produced tobacco seedlings. Plant Disease 82, 48590.
  • Hoy MA, Jeyaprakash A, Nguyen R, 2001. Long PCR is a sensitive method for detecting Liberobacter asiaticum in parasitoids undergoing risk assessment in quarantine. Biological Control 22, 27887.
  • Hudyncia J, Shew HD, Cody BR, Cubeta MA, 2000. Evaluation of wounds as a factor to infection of cabbage by ascospores of Sclerotinia sclerotiorum. Plant Disease 84, 31620.
  • Jamaux I, Gelie B, Lamarque C, 1995. Early stages of infection of rapeseed petals and leaves by Sclerotinia sclerotiorum revealed by scanning electron microscopy. Plant Pathology 44, 2230.
  • Koljalg U, Larsson KH, Abarenkov K et al. , 2005. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. New Phytologist 166, 10638.
  • Ma HX, Chen Y, Wang JX et al. , 2009. Activity of carbendazim, dimethachlon, iprodione, procymidone and boscalid against sclerotinia stem rot in Jiangsu Province of China. Phytoparasitica 37, 4219.
  • Martin KJ, Rygiewicz PT, 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiology 5, 218.
  • McCartney HA, Heran A, Li Q, 2001. Infection of oilseed rape (Brassica napus) by petals containing ascospores of Sclerotinia sclerotiorum. In: YoungCS, HughesKJD, eds. Proceedings of Sclerotinia 2001, the XI International Sclerotinia Workshop. Central Science Laboratory, York, England. Reading, UK: British Society for Plant Pathology, 1834.
  • Niessen L, Vogel RF, 1998. Group specific PCR-detection of potential trichothecene producing Fusarium-species in pure cultures and cereal samples. Systematic and Applied Microbiology 21, 61831.
  • Nolasco G, de Blas C, Torres V, Ponz F, 1993. A method combining immunocapture and PCR amplification in a microtiter plate for the detection of plant viruses and subviral pathogens. Journal of Virological Methods 45, 20118.
  • Purdy LH, 1979. Sclerotinia sclerotiorum: history, disease and symptomatology, host range, geographic distribution, and impact. Phytopathology 69, 87580.
  • Roger SL, Atkins SD, West JS, 2009. Detection and quantification of airborne inoculum of Sclerotinia sclerotiorum using quantitative PCR. Plant Pathology 58, 32431.
  • Sambrook J, Frisch EF, Maniatis T, 1989. Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press.
  • Steadman JR, Marcinkowska J, Rutledge S, 1994. A semi-selective medium for isolation of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology 16, 6870.
  • Ward E, Adams MJ, 1998. Analysis of ribosomal DNA sequences of Polymyxa species and related fungi and the development of genus- and species-specific PCR primers. Mycological Research 102, 96574.
  • White TJ, Bruns T, Lee S, Taylor JW, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: InnisMA, GelfandDH, SninskyJJ, WhiteTJ, eds. PCR Protocols: A Guide to Methods and Applications. San Diego, CA, USA: Academic Press, 31522.
  • Wong JAL, Willetts HJ, 1979. Cytology of Sclerotinia sclerotiorum and related species. Journal of General Microbiology 112, 2934.
  • Xu J, Mao S, Zhang G, Chen H, 2003. Research on occurrence, regularity and control technique of Sclerotinia sclerotiorum (Lib.) de Bary on rape. Chinese Agricultural Science Bulletin 19, 867.
  • Yang SM, 1959. An investigation on the host range and some ecological aspects of the Sclerotinia disease of rape plants. Acta Phytopathologica Sinica 5, 11122.
  • Yang JH, Pan YL, Zhu GM, Zhou YJ, 2004. Mechanism of resistance of Sclerotinia sclerotiorum to carbendazim and diethfencarb. Journal of Plant Protection 31, 748.
  • Ye S, Dhillon S, Ke X, Collins AR, Day INM, 2001. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Research 29, e88.
  • Yin Y, Ding LS, Liu X, Yang JH, Ma ZH, 2009. Detetion of Sclerotinia sclerotiorum in planta by a real-time PCR assay. Journal of Phytopathology 157, 4659.
  • Yu JX, Wu PS, Gao BD, Yan J, Zhu SF, 2007. Use of allele-specific PCR of translation elongation factor 1-α gene to identify soybean sudden death syndrome pathogen (Fusarium virguliforme). Acta Phytopathologica Sinica 37, 3641.