SEARCH

SEARCH BY CITATION

Keywords:

  • chemotype;
  • fusarium head blight;
  • Gibberella zeae;
  • scab;
  • small grains;
  • vomitoxin

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fusarium head blight (FHB), caused principally by Gibberella zeae (Fusarium graminearum), is a devastating disease of small grains such as wheat and barley worldwide. Grain infected with G. zeae may be contaminated with trichothecene mycotoxins such as deoxynivalenol (DON) and nivalenol (NIV). Strains of G. zeae that produce DON may also produce acetylated derivatives of DON: 3-acetyl-DON (3-ADON) and 15-acetyl-DON (15-ADON). Gradients (clines) of 3-ADON genotypes in Canada have raised questions about the distribution of G. zeae trichothecene genotypes in wheat fields in the eastern USA. Tri3 and Tri12 genotypes were evaluated in 998 isolates of G. zeae collected from 39 winter wheat fields in New York (NY), Pennsylvania (PA), Maryland (MD), Virginia (VA), Kentucky (KY) and North Carolina (NC). Ninety-two percent (919/998) of the isolates were 15-ADON, 7% (69/998) were 3-ADON, and 1% (10/998) was NIV. A phylogenetic analysis based on portions of three genes (PHO, RED and URA) from 23 isolates revealed two species of Fusarium (F. graminearum sensu stricto and one isolate of F. cerealis (synonym F. crookwellense)). An increasing trend of 3-ADON genotypes was observed from NC (south) to NY (north). Punctuated episodes of atmospheric transport may favour a higher frequency of 3-ADON genotypes in the northeastern USA, near Canada, compared with the mid-Atlantic states. Discoveries of the NIV genotype in NY and NC indicate the need for more intensive sampling in the surrounding regions.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fusarium head blight (FHB) (Andersen, 1948), caused principally by the fungus Gibberella zeae (Fusarium graminearum sensu stricto) (O’Donnell et al., 2000, 2004) is a devastating disease of wheat (Triticum aestivum) and barley (Hordeum vulgare) worldwide (McMullen et al., 1997; Cowger & Sutton, 2005). During the 1990s, wheat and barley farmers in the USA and Canada lost over $4 billion due to FHB epidemics (McMullen et al., 1997). The disease is particularly problematic because grain infected with G. zeae is often contaminated with trichothecene mycotoxins (Salas et al., 1999; Goswami & Kistler, 2005). In the USA, deoxynivalenol (DON) is the primary mycotoxin in G. zeae-infected grain (McMullen et al., 1997), but in parts of Asia and Europe both DON and nivalenol (NIV) are common contaminants of grain (Ichinoe et al., 1983). These toxins pose a significant threat to the health of humans and domesticated animals, and NIV is more toxic to animals than DON (Ueno, 1977; Mirocha et al., 1985). DON and NIV are potent inhibitors of protein synthesis in animal systems (Ueno, 1977), and even very low levels of these toxins in raw grains can render entire crops unfit for sale, processing, and ultimately consumption. Strains of G. zeae that produce DON may also produce acetylated derivatives of DON: 3-acetyl-DON (3-ADON) or 15-acetyl-DON (15-ADON) (Goswami & Kistler, 2005), and these derivatives may have different contributions to the total mycotoxin contamination in wheat (Ohe et al., 2010).

Polymerase chain reaction (PCR) assays have been developed to rapidly characterize trichothecene genotypes (3-ADON, 15-ADON or NIV) in populations of G. zeae (Ward et al., 2002, 2008; Chandler et al., 2003; Gale et al., 2003, 2005, 2007, 2010; Starkey et al., 2007; Guo et al., 2008). These genotyping assays have contributed to the study of the diversity and mycotoxin potential of FHB pathogens on a global basis (Lee et al., 2001; Ward et al., 2002, 2008; Chandler et al., 2003; Gale et al., 2003, 2005, 2007; Quarta et al., 2006; Starkey et al., 2007; Guo et al., 2008; Scoz et al., 2009). Gale et al. (2003, 2005) observed high frequencies of 15-ADON and 3-ADON genotypes in field populations of G. zeae collected from the Midwest, and in recent years the 3-ADON genotype appeared to be associated with a divergent population of the fungus (Gale et al., 2007). Populations of G. zeae in Louisiana collected from FHB-infected wheat heads were composed mostly of the NIV genotype (Gale et al., 2010). Though testing for DON in raw and processed grain is routinely conducted in the USA (McMullen et al., 1997), testing for NIV is not usually included in assays conducted at mills and elevators. Should the NIV genotype frequently occur in field populations of G. zeae, it would be essential to implement appropriate assays to detect NIV contamination in these regions.

Little is known about the distribution of trichothecene genotypes of G. zeae in the eastern USA. Recent observations of gradients (clines) of 3-ADON genotypes in Canada (Guo et al., 2008; Ward et al., 2008) raise questions about the distribution of G. zeae trichothecene genotypes in eastern USA wheat fields, particularly those in the northern states close to Canada. Should a similar cline of trichothecene genotypes be observed in the USA, it would suggest that field populations of the fungus may be changing, and increased efforts to track changes in FHB pathogen populations would be warranted. In the present study, a series of PCR assays were implemented to evaluate trichothecene genotypes in populations of G. zeae collected in 39 winter wheat fields in six states of the eastern USA. The specific objectives of this study were to (i) determine the distribution of 3-ADON, 15-ADON and NIV genotypes of G. zeae in commercial winter wheat fields in the eastern USA as a baseline for future assessments, and (ii) attribute the observed trichothecene genotypes to specific members of the Fusarium graminearum species complex. An abstract on a portion of this work has been published (Schmale et al., 2006a).

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Sample collection

Studies were conducted in 39 commercial winter wheat fields in six states (New York, Pennsylvania, Maryland, Virginia, Kentucky and North Carolina) in the eastern USA (Table 1; Fig. 1). Wheat heads showing symptoms of FHB were collected from individual wheat fields approximately 2–4 weeks after flowering during May, June and July of 2006. Samples were collected by the authors and cooperators along arbitrary transects through each of the fields. For four of the fields (Fields 1, 17, 34 and 35; Table 1), the location of each of the sample collections was recorded with a handheld global positioning system (GPS) unit. Individual wheat heads were surface-disinfected in 2% sodium hypochlorite (bleach) for 1 min, rinsed in sterile water, and plated on a modified Nash-Snyder Fusarium selective medium (Schmale et al., 2006b). After 4–5 days, cultures of G. zeae were transferred to ¼-strength potato dextrose agar medium (Difco Laboratories) and single-spored. Single-spored isolates of G. zeae were grown in potato dextrose broth for 4 days on a rotating shaker at 150 rpm. The resulting mycelial suspension was filtered through four layers of sterile cheesecloth and lyophilized for 24 h. Only one single-spored isolate of G. zeae per wheat head was used for analysis.

Table 1.   Trichothecene genotypes of Gibberella zeae collected from 39 commercial winter wheat fields in Virginia, New York, North Carolina, Kentucky, Pennsylvania, and Maryland, USA
StateLocationField3-ADON15-ADONNIV
  1. aFields selected for the spatial distribution analysis of trichothecene genotype.

NYCayuga CoField 1a61040
NYSteuben CoField 22271
NYSteuben CoField 325310
NYGenesee CoField 42490
NYSeneca CoField 58610
NYSeneca CoField 614411
NYSteuben CoField 7140
NY Total  58 (15·4%)317 (84·1%)2 (0·5%)
PALancaster CoField 80120
PACentre CoField 91230
PAVanango CoField 10040
PAWestmoreland CoField 114180
PA Total  5 (8·1%)57 (91·9%)0 (0%)
MDSomerset CoField 120150
MDSomerset CoField 130140
MDQueen Anne CoField 140140
MDDorchester CoField 151140
MDDorchester CoField 16060
MD Total  1 (1·6%)63 (98·4%)0 (0%)
VAMontgomery CoField 17a2270
VAAccomack CoField 18020
VAEssex CoField 190130
VAEssex CoField 200150
VARichmond CoField 210140
VACaroline CoField 220140
VACaroline CoField 230150
VAWestmoreland CoField 241160
VAWestmoreland CoField 250140
VALivingston CoField 260130
VA Total  3 (2·0%)143 (98·0%)0 (0%)
KYLogan CoField 270460
KYLogan CoField 28040
KYWarren CoField 290100
KYSimpson CoField 30060
KYTodd CoField 31040
KYTodd CoField 32030
KYSimpson CoField 33030
KYLogan CoField 34a1780
KY Total  1 (0·6%)154 (99·4%)0 (0%)
NCWashington CoField 35a0770
NCHertford CoField 360270
NCLenoir CoField 371134
NCLenoir CoField 380311
NCRowan CoField 390373
NC Total  1 (0·5%)185 (95·4%)8 (4·1%)
image

Figure 1.  Distribution of Tri3 and Tri12 trichothecene genotypes of Gibberella zeae in 39 commercial winter wheat fields located in New York (NY), Pennsylvania (PA), Maryland (MD), Virginia (VA), Kentucky (KY), and North Carolina (NC), USA. The single isolate of Fusarium cerealis is included in the NIV proportion in NY.

Download figure to PowerPoint

Preparation of template DNA

DNA was extracted from lyophilized fungal mycelia using a simple bead-beating procedure. Approximately 100 mg of lyophilized mycelium was homogenized with 0·5 mm silica/zirconia beads (BioSpec products) using a Mini-BeadBeater-1™ (BioSpec products) for 1 min at 2164 g. Genotyping assays were conducted either from aqueous suspensions of homogenized mycelia or from genomic DNA extracted from homogenized mycelia using either Qiagen’s DNeasy Plant Mini kit or the BioSprint 15 DNA Plant kit (Qiagen, Inc.), following the manufacturer’s protocols.

PCR assays to determine trichothecene genotypes

Two multiplex PCR assays were used to evaluate trichothecene genotypes in field populations of G. zeae (Ward et al., 2002; Gale et al., 2003, 2005). These assays relied on the amplification of portions of two genes, Tri3 and Tri12, that provide an indication of mycotoxin production in G. zeae (Ueno, 1977; Ward et al., 2002). Tri3 encodes a 15-O-acetyltransferase (McCormick et al., 1996) and Tri12 encodes a trichothecene efflux pump (Alexander et al., 1999). Four separate primers were used to amplify each gene: 3CON, 3NA, 3D15A, 3D3A for Tri3 and 12CON, 12NF, 12-15F, 12-3F for Tri12 (Ward et al., 2002; Gale et al., 2003, 2005) (Table 2). Only one trichothecene genotype-specific amplicon is produced for each of the two genes (Ward et al., 2002; Gale et al., 2003, 2005). For the Tri3 primer set, PCR products of 243, 710 and 840 bp are produced for 3-ADON, 15-ADON and NIV genotypes, respectively. For the Tri12 primer set, PCR products of 410, 670 and 840 bp are produced for 3-ADON, 15-ADON and NIV genotypes, respectively. PCR amplifications were performed in a 25 μL reaction volume containing 12·5 μL pre-mixed Taq 2× Master Mix (M0270L; New England Biolabs), 0·2 μm of each primer, and 200–250 ng template DNA. Cycling conditions consisted of an initial denaturation step at 94°C for 10 min, followed by two cycles of 94°C for 30 s, 59°C for 30 s and 72°C for 30 s. The annealing temperature was stepped down every two cycles to 58, 56, 54, 53, 52 and 51°C, then 50°C for 21 cycles, with a final extension at 72°C for 10 min. Resulting PCR products were separated by electrophoresis in 0·8% agarose gels, stained with ethidium bromide at a final concentration of 0·5 μg mL−1, and visualized under UV light. A 100 bp mass ladder (Quick-Load 100 bp DNA ladder; New England Biolabs) was used to size the PCR amplicons.

Identification of representative isolates to species

To assist in the identification of representative isolates to species, portions of three genes were amplified and bi-directionally sequenced from 23 isolates (Table S1). These 23 isolates were selected to represent the different genotypes sampled in each of the states. The genes were PHO (phosphate permease), RED (putative reductase) and URA (ammonia ligase) (O’Donnell et al., 2004). Primer sequences are listed in Table 2. SeqMan Pro (Lasergene v8.1.1) was used to trim, align and concatenate consensus sequences. The Clustal V method in MegAlign (Lasergene v8.1.1) was used to align sequences and generate phylogenetic trees for portions of individual genes and for concatenated sequences for all of the genes. A bootstrapping analysis was also conducted in MegAlign, with a random number generator seed of 111 and 1000 bootstrap trials. Sequences from ARS (NRRL) Culture Collection reference isolates were downloaded from GenBank and incorporated into the alignments and resulting phylogenetic trees.

Table 2.   List of primers and sequences used to genotype and sequence isolates of Gibberella zeae in this study
Primer nameGeneSequence (5′–3′)
3CONaTri3TGGCAAAGACTGGTTCAC
3NAaTri3GTGCACAGAATATACGAGC
3D15AaTri3ACTGACCCAAGCTGCCATC
3D3AaTri3CGCATTGGCTAACACATG
12CONaTri12CATGAGCATGGTGATGTC
12NFaTri12TCTCCTCGTTGTATCTGG
12-15FaTri12TACAGCGGTCGCAACTTC
12-3FaTri12CTTTGGCAAGCCCGTGCA
PHO1bPHOATCTTCTGGCGTGTTATCATG
PHO6bPHOGATGTGGTTGTAAGCAAAGCCC
RED1dbREDTCTCAGAAAGACGCATATATG
RED2bREDCGTAACTGCGTCATTCGGC
URA7bURAACAGACGCCATTCAGGATTGG
URA10bURAGCAATCTTTGTGATGGTAGCTTGATC

Spatial distribution plots

Plots depicting the spatial distribution of trichothecene genotypes were created for four of the field populations (Fields 1, 17, 34 and 35; Table 1) using GPS waypoints for each of the sample locations. The frequency of each genotype was represented at each of the GPS-referenced sampling locations.

Statistical analysis

Frequency counts of genotypes were expressed as the proportion of the total number for each field. A mixed model was fitted to the data using the SAS (R) software, mixed procedure (SAS Institute, v9.2). Genotype and state were treated as fixed-effect factors. Fields within each state were treated as random effects, or replicates, as multiple fields were sampled within each state. Upon inspection of residual plots, the arcsine-square root transformation was applied to trichothecene genotype proportions in order to increase homogeneity of variances and attain normality.

Inspection of the data indicated certain genotypes occurred in higher percentages in particular states (Table 1). For that reason, the following one-df linear contrasts were analysed using proc mixed to determine whether the observed frequency differences were significant: (i) New York was compared to the other surveyed states for 3-ADON and 15-ADON; (ii) New York and Pennsylvania were compared to the other surveyed states for 3-ADON, and (iii) North Carolina was compared to the other states for NIV. The significance criterion alpha level was set at 0·05/4 approximately = 0·01.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Tri3 and Tri12 trichothecene genotypes were evaluated in a total of 998 single-spored isolates of G. zeae collected from 39 commercial wheat fields in six states (Table 1, Fig. 1). Individual field populations ranged from two isolates (Field 18, Table 1) to 110 isolates (Field 1, Table 1). All of the PCR assays produced PCR products of expected size for the representative Tri3 and Tri12 3-ADON, 15-ADON and NIV genotypes (Fig. 2). Numbers of isolates of each of the three genotypes are given in Table 1. Taken as a whole, 92% (919/998) of the isolates had the 15-ADON genotype, 7% (69/998) had the 3-ADON genotype, and 1% (10/998) had the NIV genotype. However, there was a significant genotype × state interaction (< 0·0001, Table 3). Linear contrasts indicated that New York had a significantly higher percentage of 3-ADON genotypes and a lower percentage of 15-ADON genotypes than the other five states as a whole (< 0·0001). A high frequency of 3-ADON genotypes (25 of 56 total isolates, or 45%) was observed in one field in Steuben County, New York. Together, New York and Pennsylvania also had a higher percentage of 3-ADON genotypes than the other four states (< 0·0001).

image

Figure 2.  Representative PCR amplicons for Tri3 (top, lanes 1–9) and Tri12 (bottom, lanes 11–19) genotypes of Gibberella zeae. For Tri3, PCR products of 243, 710 and 840 bp are produced for 3-ADON, 15-ADON and NIV genotypes, respectively. For Tri12, PCR products of 410, 670 and 840 bp are produced for 3-ADON, 15-ADON and NIV genotypes, respectively. Representative 3-ADON (lanes 1–3, 11–13), 15-ADON (lanes 4–6, 14–16), and NIV (lanes 7–9, 17–19) genotypes are shown. States follow the underscore. The top and bottom markers for the mass ladder are 1517 and 100 bp, respectively.

Download figure to PowerPoint

Table 3.   Effects of state and trichothecene genotype in the analysis of variance of Gibberella zeae isolates sampled from 39 fields in six states in the eastern USA
EffectDfF-valueP-value
Genotype2943·6<0·0001
State51·50·232
Genotype × state106·6<0·0001
Contrasts
 NY versus other states – 3-ADON135·6<0·0001
 NY & PA versus other states – 3-ADON123·8<0·0001
 NY versus other states – 15-ADON124·6<0·0001
 NC versus other states – NIV122·1<0·0001

Although only about 4% of North Carolina isolates were of the NIV genotype, this percentage was higher than that found in the other five states taken together (Table 3, < 0·0001), and higher than that found in New York (= 0·004). Out of 998 isolates tested from the six states, only 10 had the NIV genotype, with eight of these from North Carolina and two from New York (Table 1). Five were found in two fields in Kinston, North Carolina (Lenoir County, in the central Coastal Plain) separated by <1 km from each other; the total number of isolates in the two fields was 50. Three NIV isolates were found in a total of 40 isolates sampled from a field in Salisbury, North Carolina (Rowan County in the Piedmont). Thus, although NIV genotypes were just 1% of the total six-state sample, and only 4·1% of the North Carolina sample, they were 7·5–10% of the isolates sampled from two specific locations in North Carolina. A single NIV genotype isolate was found in each of two fields in the Finger Lakes Region of western New York. These fields were in Cohocton (Steuben County) and Seneca Falls (Seneca County) and separated by ca. 75 km.

The spatial distribution of trichothecene genotypes in each of the field populations was visualized by plots of GPS-referenced genotype counts in individual fields (Fig. 3). Samples were collected at 15 GPS-referenced locations in the New York field (Fig. 3a), 13 locations in the Virginia field (Fig. 3b), 25 locations in the Kentucky field (Fig. 3c), and 77 locations in the North Carolina field (Fig. 3d). In the New York field, the 15-ADON genotype was observed at all of the sampling locations in the field, but the 3-ADON genotype was observed at only six of them (n = 110 isolates). In the Virginia field, the 3-ADON genotype was observed twice, and these observations were at two separate locations that did not include observations of the 15-ADON genotype. The remainder of the sampling locations contained only the 15-ADON genotype (n = 29 isolates). In the Kentucky field, the 3-ADON genotype was observed at one location, with the remainder of the locations containing only the 15-ADON genotype (n = 79 isolates). In the North Carolina field, only the 15-ADON genotype was observed (n = 77 isolates).

image

Figure 3.  Spatial distribution of trichothecene genotypes of Gibberella zeae in four mid-Atlantic USA winter wheat fields. Samples were collected along arbitrary transects through each of the fields. The number of isolates observed at each of the GPS-referenced sample locations is indicated by the relative size of the circles. Isolates of the 15-ADON and 3-ADON genotypes are represented by the solid black and empty areas of circles, respectively. (a) New York, Field 1: 104 isolates of the 15-ADON genotype and six of the 3-ADON genotype. (b) Virginia, Field 17: 27 isolates of the 15-ADON genotype and two of the 3-ADON genotype. (c) Kentucky, Field 34: 78 isolates of 15-ADON genotype and one of the 3-ADON. (d) North Carolina, Field 35: all 77 isolates were 15-ADON.

Download figure to PowerPoint

Partial sequences from the PHO, RED and URA genes were used to assist in the identification of 23 isolates to species; eight of these isolates were 3-ADON, eight were 15-ADON and seven were NIV (Table S1). A phylogenetic tree based on 1658 bp of concatenated DNA sequence (PHO-RED-URA) revealed two large groups (Fig. 4). One group consisted of NRRL reference strains of G. zeae (28336, 5883 and 13383) and all but one of the isolates from this study (Fig. 4). The other group consisted of NRRL reference strains of F. cerealis (25491, 13721 and 25805) and isolate NIV7 from Cohocton, New York (Steuben County). Phylogenetic trees based on portions of individual sequences of PHO, RED and URA also showed a similar trend; NIV7 consistently clustered with F. cerealis for all of the individual gene comparisons and the remainder of the strains clustered with G. zeae (data not shown). Morphological observations of culture characteristics and macroconidia of isolate NIV7 from ¼-PDA were consistent with the description of F. cerealis (synonym F. crookwellense) by Leslie & Summerell (2006); the cultures produced red pigments, macroconidia with 5–6 septa with a foot-shaped basal cell, and microconidia were absent.

image

Figure 4.  Phylogenetic tree based on a total of 1658 bp of concatenated DNA sequence of portions of three genes (PHO-RED-URA) from 23 isolates representative of 3-ADON, 15-ADON and NIV genotypes and sequences from selected NRRL strains that were downloaded from GenBank. The 23 isolates were selected to represent the different genotypes sampled in each of the states. States and NRRL strain designations follow the underscore. Numbers at the branch points represent significant bootstrap values of 75 or greater.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

This study provides the first detailed report on the distribution of trichothecene genotypes of G. zeae in commercial winter wheat fields in the eastern USA. Of the 998 isolates sampled in 39 wheat fields, 92% (919/998) of the isolates were of the 15-ADON genotype, 7% (69/998) were of the 3-ADON genotype, and 1% (10/998) was of the NIV genotype. The sampled fields differed in environment and cultural practice, yet all were within regions of the eastern USA with moderate rainfall and large areas of corn, where soft winter wheat is grown in rotation with other crops, and where FHB occurs to some extent nearly every year. Broad geographic surveys for trichothecene genotypes of G. zeae from wheat in the eastern USA are important to establish baselines for these genotypes against which any future shifts in populations can be assessed (Gale et al., 2003, 2005, 2007; Starkey et al., 2007; Guo et al., 2008; Ward et al., 2008).

Results from the phylogenetic analysis revealed at least two formal species of Fusarium within the field populations (Fusarium graminearum sensu stricto and Fusarium cerealis (synonym F. crookwellense)). The isolates identified as F. graminearum sensu stricto represented all three genotypes observed in this study (3-ADON, 15-ADON and NIV). The single isolate identified as F. cerealis from Cohocton, New York (Steuben County) was of the NIV genotype. The association of the NIV genotype with F. cerealis is consistent with NIV genotypes reported for strains of F. cerealis from Germany and Poland (Chandler et al., 2003). Future sampling in the USA that targets FHB pathogens other than F. graminearum may help reveal additional species that persist in field populations and likely contribute to mycotoxin contamination (e.g. Starkey et al., 2007).

The 15-ADON genotype was abundant and relatively homogeneous in all six of the states studied, yet the 3-ADON genotype was always observed in low frequencies. An exception occurred in one field in Steuben County, New York where 45% of the isolates were of the 3-ADON genotype. The composite observations contrast with those of Gale et al. (2003, 2005, 2007), Guo et al. (2008), and Ward et al. (2008), who reported that the 3-ADON genotype has increased dramatically in recent years in parts of north-central USA and Canada. The potential fitness (in terms of reproductive success) advantages to G. zeae conferred by the production of different trichothecene mycotoxins have yet to be examined in detail. Studies by Proctor et al. (1995) and Desjardins et al. (1996) demonstrated that DON is a virulence factor in wheat, but relative roles of the acetylated forms of DON in the fitness of the fungus have not been established. Ohe et al. (2010) conducted a replicated field study in Germany and Canada in 2008 to examine the aggressiveness and mycotoxin production of isolates of G. zeae representing 3-ADON and 15-ADON genotypes in three wheat lines reported to vary in susceptibility to FHB. Mean and terminal FHB indices did not differ for either of the trichothecene genotypes across six locations, but two of the lines contained significantly higher levels of DON in five out of the six field locations that could be attributed in part to the 3-ADON genotype. Given the current range of resistance in cultivars of soft winter wheat deployed in the eastern USA, it seems unlikely that aggressiveness alone may be sufficient to drive the selection of trichothecene genotypes in field populations of G. zeae.

In Canada, Ward et al. (2008) observed an increasing frequency of 3-ADON genotypes of G. zeae from Alberta (west) to Prince Edward Island (east). Less than 6% of the isolates in Alberta were 3-ADON (n = 149 isolates) and 100% of the isolates from Prince Edward Island were 3-ADON (n = 61 isolates). Guo et al. (2008) observed a similar west-to-east trend of more frequent 3-ADON genotypes of G. zeae in southern Manitoba, Canada, though many of the populations on the eastern side of this region contained small sample sizes (<25 isolates). The present study revealed an increasing trend of 3-ADON genotypes from North Carolina (south) to New York (north), and New York and Pennsylvania had a significantly higher percentage of 3-ADON genotypes than the other four states. The explanation for this trend is unclear, but perhaps punctuated episodes of atmospheric transport (Maldonado-Ramirez et al., 2005) from Canada (Gale et al., 2007) favour a higher frequency of 3-ADON genotypes in the northeastern USA. Ascospores of G. zeae are forcibly discharged into the air (Sutton, 1982; Schmale et al., 2005) and may be transported over long distances in the atmosphere (Maldonado-Ramirez et al., 2005). Future population studies that subdivide 15-ADON and 3-ADON populations of G. zeae (e.g. Gale et al., 2007) into a finer population structure may assist in answering questions about the migration and stability of current (and future) populations of the fungus.

GPS-referenced samples were collected from one field (Field 1 in New York, Fig. 3a) that had a sizeable diversity (6% 3-ADON, 94% 15-ADON) of trichothecene genotypes. Small samples of as few as five wheat heads showing symptoms collected at one sampling location were sufficient to identify the 3-ADON genotype. The 15-ADON and 3-ADON genotypes were distributed fairly evenly throughout the field, suggesting that sampling the field on any of a variety of spatial scales would have yielded an accurate measure of the trichothecene genotype diversity in the whole field. Of course, additional fields with a greater diversity of genotypes would need to be sampled in a geo-referenced manner in order to draw a firm conclusion. Future studies designed to characterize the spatial distribution of trichothecene genotypes in commercial wheat fields may provide clues about the origin and nature of inoculum for epidemics of FHB. These clues may aid in developing and/or excluding strategies for the management of FHB, such as the control of potential inoculum sources of G. zeae (Keller et al., 2010).

The discoveries of the NIV genotypes of G. zeae and F. cerealis in New York and the NIV genotype in North Carolina indicate the need for more intensive sampling in these states and the surrounding regions. NIV is more toxic to animals than DON (Ueno, 1977; Mirocha et al., 1985), and it is important to determine whether NIV producers also occur frequently in other neighbouring states in the eastern USA. Should the NIV genotype of G. zeae become established in the USA (Gale et al., 2010), it will be essential to have robust methods for detecting NIV contamination in wheat, barley and corn production regions where this genotype occurs. With the exception of the 29 isolates gathered from Riner in the Virginia Piedmont, none of the Virginia samples were collected near the border with North Carolina. Mycotoxin genotype identification should be conducted in order to define the extent of the present ‘NIV area’, starting in central and western North Carolina and working outward to southern Virginia and to South Carolina. Assays should also be done for potential NIV content of naturally infected grain samples in the North Carolina Piedmont and central Coastal Plain, and in western and central New York. This information will be helpful, for example, in determining whether routine testing for NIV in grains and forages from certain areas is warranted.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank D. Cuadra, N. McMaster, C. Perry, D. Reaver, K. Roll, W. Russell, B. Sinclair and J. Sprick for excellent technical assistance in the Schmale lab. We thank C. Albers, M. Dennis, E. DeWolf, K. Fry, C. Grote, A. Grybauskas, J. Hunter, D. Johnson, J. Kinney, D. Mason, D. Morris, J. Patton-Özkurt and S. VanSickle for coordinating, collecting and/or shipping samples for analysis. This research was supported in part by funding from the Virginia Small Grains Board Project #06-2456-06 and Cornell University Hatch Project NYC153433.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Alexander NJ, McCormick SP, Hohn TM, 1999. TRI12, a trichothecene efflux pump from Fusarium sporotrichioides: gene isolation and expression in yeast. Molecular and General Genetics 261, 97784.
  • Andersen AL, 1948. The development of Gibberella zeae headblight of wheat. Phytopathology 38, 595611.
  • Chandler EA, Duncan RS, Thomsett MA, Nicholson P, 2003. Development of PCR assays to Tri7 and Tri13 and characterisation of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiological and Molecular Plant Pathology 62, 35567.
  • Cowger C, Sutton AL, 2005. The southeastern U.S. Fusarium head blight epidemic of 2003. Plant Health Progress. doi:10.1094/PHP-2005-1026-01-RS. [http://www.plantmanagementnetwork.org/pub/php/research/2005/fhb/].
  • Desjardins AE, Proctor RH, Bai GH et al. , 1996. Reduced virulence of trichothecene-nonproducing mutants of Gibberella zeae in wheat field tests. Molecular Plant-Microbe Interactions 9, 77581.
  • Gale LR, Ward TJ, Balmas V, Kistler HC, 2003. Detection of distinct subpopulations of Fusarium graminearum lineage 7 in the US. In: Canty SM, Lewis J, Ward RW, eds. Proceedings of the 2003 National Fusarium Head Blight Forum. East Lansing, MI, USA: Michigan State University, 139.
  • Gale LR, O’Leary LE, Bryant JD, Ochocki GE, Ward TJ, Kistler HC, 2005. Displacement of the native population of Fusarium graminearum in North Dakota and Minnesota by a genetically divergent and more toxigenic population. In: Canty SM, Boring T, Wardwell J, Siler L, Ward RW, eds. Proceedings of the 2005 National Fusarium Head Blight Forum. East Lansing, MI, USA: Michigan State University, 158.
  • Gale LR, Ward TJ, Balmas V, Kistler HC, 2007. Population subdivision of Fusarium graminearum sensu stricto in the upper midwestern United States. Phytopathology 97, 14349.
  • Gale LR, Harrison SA, Ward TJ et al. , 2010. Nivalenol type populations of Fusarium graminearum and F. asiaticum are prevalent on wheat in southern Louisiana. Phytopathology 101, 12434.
  • Goswami RS, Kistler HC, 2005. Pathogenicity and in planta mycotoxin accumulation among members of the Fusarium graminearum species complex on wheat and rice. Phytopathology 95, 1397404.
  • Guo XW, Fernando WGD, Seow-Brock HY, 2008. Population structure, chemotype diversity, and potential chemotype shifting of Fusarium graminearum in wheat fields of Manitoba. Plant Disease 92, 75662.
  • Ichinoe M, Kurata H, Sugiura Y, Ueno Y, 1983. Chemotaxonomy of Gibberella zeae with special reference to production of trichothecenes and zearalenone. Applied and Environmental Microbiology 46, 13649.
  • Keller MD, Waxman KD, Bergstrom GC, Schmale DG, 2010. Local distance of wheat spike infection by released clones of Gibberella zeae disseminated from infested corn residue. Plant Disease 94, 11515.
  • Lee T, Oh DW, Kim HS et al. , 2001. Identification of deoxynivalenol- and nivalenol producing chemotypes of Gibberella zeae by using PCR. Applied and Environmental Microbiology 67, 296672.
  • Leslie JF, Summerell BA, 2006. The Fusarium Laboratory Manual. Ames, IA, USA: Blackwell Publishing, 388.
  • Maldonado-Ramirez SL, Schmale DG, Shields EJ, Bergstrom GC, 2005. The relative abundance of viable spores of Gibberella zeae in the planetary boundary layer suggests the role of long-distance transport in regional epidemics of Fusarium head blight. Agricultural and Forest Meteorology 132, 207.
  • McCormick SP, Hohn TM, Desjardins AE, 1996. Isolation and characterization of Tri3, a gene encoding 15-O-acetyltransferase from Fusarium sporotrichioides. Applied and Environmental Microbiology 62, 3539.
  • McMullen MP, Jones R, Gallenberg D, 1997. Scab of wheat and barley: a re-emerging disease of devastating impact. Plant Disease 81, 13408.
  • Mirocha CJ, Pawlosky RJ, Tong-Xia Z, Lee YW, 1985. Chemistry and biological activity of Fusarium roseum mycotoxins. In: Lacey J, ed. Trichothecenes and Other Mycotoxins. Proceedings of the International Mycotoxin Symposium, Sydney, Australia, 1984. New York, USA: John Wiley & Sons, 1984.
  • O’Donnell K, Kistler HC, Tacke BK, Casper HH, 2000. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proceedings of the National Academy of Sciences of the United States of America 97, 790510.
  • O’Donnell K, Ward TJ, Geiser DM, Kistler HC, Aoki T, 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genetics and Biology 41, 60023.
  • Ohe C, Gauthier V, Tamburic-Ilincic L et al. , 2010. A comparison of aggressiveness and deoxynivalenol production between Canadian Fusarium graminearum isolates with 3-acetyl and 15-acetyldeoxynivalenol chemotypes in field-grown spring wheat. European Journal of Plant Pathology 127, 40717.
  • Proctor RH, Hohn TM, McCormick SP, 1995. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Molecular Plant-Microbe Interactions 8, 593601.
  • Quarta A, Mita G, Haidukowski M, Santino A, Mule G, Visconti A, 2006. Multiplex PCR assay for the identification of nivalenol, 3- and 15-acetyl-deoxynivalenol chemotypes in Fusarium. FEMS Microbiology Letters 259, 713.
  • Salas B, Steffenson BJ, Casper HH et al. , 1999. Fusarium species pathogenic to barley and their associated mycotoxins. Plant Disease 83, 66774.
  • Schmale DG, Arntsen QA, Bergstrom GC, 2005. The forcible discharge distance of ascospores of Gibberella zeae. Canadian Journal of Plant Pathology 27, 37682.
  • Schmale DG, Wood-Jones AK, Bergstrom GC, Cowger C, 2006a. Spatial patterns of trichothecene genotypes of Gibberella zeae in wheat fields. In: Canty SM, Clark A, Van Sanford D, eds. Proceedings of the 2006 National Fusarium Head Blight Forum. East Lansing, MI, USA: Michigan State University, 140.
  • Schmale DG, Leslie JF, Saleh AA, Shields EJ, Bergstrom GC, 2006b. Genetic structure of atmospheric populations of Gibberella zeae. Phytopathology 96, 10216.
  • Scoz LB, Astolfi P, Reartes DS, Schmale DG, Moraes MG, Del Ponte EM, 2009. Trichothecene mycotoxin genotypes of Fusarium graminearum sensu stricto and Fusarium meridionale in wheat from southern Brazil. Plant Pathology 58, 34451.
  • Starkey DE, Ward TJ, Aoki T et al. , 2007. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genetics and Biology 44, 11914.
  • Sutton JC, 1982. Epidemiology of wheat head blight and maize ear rot caused by Fusarium graminearum. Canadian Journal of Plant Pathology 4, 195209.
  • Ueno Y, 1977. Mode of action of trichothecenes. Pure and Applied Chemistry 3, 173745.
  • Ward TJ, Bielawski JP, Kistler HC, Sullivan E, O’Donnell K, 2002. Ancestral polymorphism and adaptive evolution in the trichothecene gene cluster of phytopathogenic Fusarium. Proceedings of the National Academy of Sciences of the United States of America 99, 927883.
  • Ward TJ, Clear RM, Rooney AP et al. , 2008. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genetics and Biology 45, 47384.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Table S1 Isolates used for Fusarium species identification and phylogenetic analysis

FilenameFormatSizeDescription
PPA_2443_sm_ts1.doc55KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.