Evaluation of loop-mediated isothermal amplification (LAMP) assays based on 5S rDNA-IGS2 regions for detecting Meloidogyne enterolobii

Authors


E-mail: hengjian@cau.edu.cn

Abstract

A loop-mediated isothermal amplification (LAMP) assay for detection of Meloidogyne enterolobii (Me-LAMP) was developed based on the sequences of the 5S ribosomal DNA (5S rDNA) and intergenic spacer 2 (IGS2) segment. The LAMP amplification was achieved at 65°C isothermal conditions within 1–1·5 h. Its amplicons were confirmed using gel electrophoresis, SacI enzyme analysis, lateral flow dipstick (LFD) assay, and visual inspection through SYBR Green I and calcein staining. The results demonstrated that the Me-LAMP was able to specifically detect M. enterolobii populations from different geographical origins, with a detection limit of about 10 fg M. enterolobii genomic DNA, which was 10–100 times more sensitive than conventional PCR. In addition, the applicability of LAMP to field detection was confirmed following its successful performance in detecting the pest on root and soil samples. The Me-LAMP assay possessed the characteristics of simplicity, sensitivity and specificity, and is a promising and practical molecular tool for M. enterolobii diagnosis in pest quarantine and field surveys.

Introduction

The root-knot nematode (RKN) Meloidogyne enterolobii (Yang & Eisenback, 1983) was originally described and illustrated from a population isolated from pacara earpod trees (Enterolobium contortisiliquum) in Hainan Province in China. Recently, it was suggested that M. enterolobii was a senior synonym of Meloidogyne mayaguensis (Xu et al., 2004; Randig et al., 2009), a species originally described in Puerto Rico, isolated from aubergine (Solanum melongena) (Rammah & Hirschmann, 1988). Meloidogyne enterolobii is a tropical or subtropical nematode and has a broad host range, attacking various ornamentals, herbs, fruits trees, vegetable crops and wild plants (EPPO, 2008). This nematode has been reported in several continents and countries, including China, USA (Florida), Europe, Africa, Central and South America (EPPO, 2008). Although no extensive surveys of the damage caused by the pest have been carried out, M. enterolobii is now considered one of the most important RKN species (De Waele & Elsen, 2007). Considering the risks of introduction and dissemination of this pest, M. enterolobii was recently added to the NAPPO and EPPO Alert List (EPPO, 2008), and has a quarantine status in the USA (Florida) and the Republic of Korea.

Meloidogyne enterolobii is also known as the most aggressive Meloidogyne species because of its high reproduction rate and ability to overcome the resistance of important crops, such as tomato cv. Rossol with the Mi resistance gene, pepper cvs Snooker and Charleston Belle with the N resistance gene, sweet pepper cv. 9913/2 carrying the Tabasco gene (Brito et al., 2007), sweet potato cv. CDH and soyabean cv. Forrest (Fargette, 1987; Fargette et al., 1996), that show resistance to M. incognita, M. javanica and M. arenaria. In addition, M. enterolobii could not be infected by Pasteuria penetrans (Brito et al., 2004b), a bacterial endospore-forming parasite that has potential as a biocontrol agent for Meloidogyne species. These characteristics mean that, once introduced and established in a new region, M. enterolobii has the potential to devastate local agriculture. Therefore, a method for its accurate detection is necessary to prevent further introduction and spread for quarantine purposes, as well as to provide a diagnosis tool for pest management.

Meloidogyne enterolobii can occur sympatrically with Marenaria, Mincognita, Mjavanica and others. Traditional morphological identification for Meloidogyne spp. has mainly relied on microscopic observation of perineal patterns (Eisenback et al., 1981), which requires examination of adult females, taking considerable time and technical skills. Furthermore, M. enterolobii shows morphological resemblance to M. incognita when considering only the perineal patterns (Brito et al., 2004a), which might be the reason for its misidentification in a number of past surveys. Combining PAGE with histochemical stains for the isozymes of esterases and malate dehydrogenase, M. enterolobii was successfully discriminated from four other common Meloidogyne species (Fargette, 1987), but isozyme electrophoresis performed with adult females and the second-stage juveniles (J2s) did not give reliable diagnosis.

In the past two decades, molecular diagnostics using different regions of the genome and mitochondrial DNA have been developed which could provide an alternative strategy for M. enterolobii identification. Restriction fragment length polymorphism (RFLP) studies revealed M. enterolobii-specific polymorphisms distinguishing it from other Meloidogyne spp. (Fargette et al., 1996). However, the RFLP technique required relatively large amounts of high-quality DNA. Various PCR-based methods were developed for distinguishing M. enterolobii from other Meloidogyne spp., which can detect a single juvenile nematode. For example, the fingerprints of random amplified polymorphism DNA (RAPD) and amplified fragment length polymorphism (AFLP) were used to assess inter- and intraspecific variation of M. enterolobii (Blok et al., 1997; Tigano et al., 2010). PCR-based markers for M. enterolobii identification were developed by amplifying fragments of mitochondrial DNA regions (Blok et al., 1997, 2002; Brito et al., 2004a; Xu et al., 2004), the intergenic region (IGS) from the ribosomal DNA (Adam et al., 2007), a species-specific satellite DNA (Randig et al., 2009) and a species-specific sequence-characterized amplified region (SCAR) of genomic DNA (Tigano et al., 2010). Compared with traditional methods, PCR-based diagnostics have provided fast, accurate and sensitive tools for RKN identification. However, the associated diagnostic procedures still extend over several hours and require expensive and sophisticated laboratory instrumentation and trained personnel. These drawbacks limit its routine uses, especially in quarantine departments and the poorly resourced laboratories in rural areas of developing countries. A detection method that is not only speedy and sensitive, but also simple and economical in practical applications would be preferred.

In 2000, Eiken Chemical Company Ltd developed a novel nucleic acid amplification method termed loop-mediated isothermal amplification (LAMP) (Notomi et al., 2000). The LAMP reaction requires a DNA polymerase with strand-displacement activity (usually the Bacillus stearothermophilus (Bst) polymerase) and a set of four to six specially designed primers based on six or eight distinct regions of the target DNA. The LAMP method has several advantages over traditional PCR: (i) LAMP amplification can be achieved using simple heating devices (a water bath or a heating block) that maintain isothermal conditions (60–65°C), and all LAMP steps are conducted within one reaction tube; (ii) amplification can be achieved using partially or non-processed template, so DNA extraction may not be necessary; (iii) reactions yield large amounts of product in a short time (0·5–1 h); (iv) sensitivity is equal to or higher than that of traditional PCR; and (v) various detection formats can be used – positive LAMP reactions can be visualized with the naked eye by adding DNA-intercalating dyes such as ethidium bromide, SYBR Green I, propidium iodide and Quant-iT PicoGreen, or metal-ion indicators such as hydroxynaphthol blue (HNB) (Goto et al., 2009), CuSO4 (Zoheir & Allam, 2011) and calcein (Tomita et al., 2008), or by measuring the increase in turbidity derived from magnesium pyrophosphate formation to infer increases in amplified DNA concentration. They can also be detected by real-time detection methods (Bekele et al., 2011). Because of these advantages, LAMP technology has attracted much attention since it was reported by Notomi et al. (2000). Up to now, more than 400 reports evaluating the LAMP method have been published, and LAMP technology has been packaged in commercially available detection kits for a variety of pathogens, including viruses, fungi, bacteria and parasitic diseases (Mori & Notomi, 2009).

However, only limited attempts have been made to detect plant parasitic nematodes (PPNs) by LAMP assay. To date, two separate LAMP assays have been developed, one for detection of the pinewood nematode Bursaphelenchus xylophilus (Kikuchi et al., 2009) and the second for four common Meloidogyne spp. (Niu et al., 2011). This study presents a rapid LAMP test for M. enterolobii (Me-LAMP) diagnosis based on the sequences of 5S ribosomal DNA (5S rDNA) and intergenic spacer 2 (IGS2). The LAMP set was evaluated by comparison with conventional PCR tests and its applicability was examined by performing tests using root and soil samples.

Materials and methods

Nematode populations and DNA template preparation

The populations of PPNs used in this work are listed in Table 3. Meloidogyne spp. collected from various provinces in China were maintained on a susceptible tomato cultivar (Solanum lycopersicum cv. Baiguo) in axenic cultures starting from a single-egg mass in a greenhouse. These populations had been identified previously by microscopic observation of perineal patterns (Eisenback et al., 1981; Yang & Eisenback, 1983) and by molecular diagnosis using species-specific SCAR markers (Zijlstra et al., 2000; Tigano et al., 2010).

Several methods of DNA extraction were used in this study. DNA of single second-stage juveniles (J2s) and females was extracted following the method described by Zijlstra et al. (1997), and dissolved to a final volume of 15 μL. DNA from many of the nematode juveniles was isolated by using the DNeasy Tissue kit (QIAGEN) according to the manufacturer’s specifications. Purified DNA was quantified using a spectrophotometer, and aliquots were diluted to 100 ng μL−1 in distilled water as stocks at −20°C.

LAMP primer design

5S rDNA-IGS2 sequences were chosen as the candidate target for LAMP primer design. The M. enterolobii 5S rDNA-IGS2 sequence (acc no. GQ395559) was used as a seed for blast analysis against the NCBI GenBank database, then the retrieved sequences of Meloidogyne and related species were downloaded, and compared by multiple sequence alignment using clustalX 2·0 (Larkin et al., 2007) with a gap-opening penalty of 10 and gap-extension penalty of 0·05. Alignment was then manually adjusted using the bioedit software (Hall, 1999). Finally, the 5S rDNA-IGS2 regions known to be conserved within species and known to exhibit strong dissimilarities with other Meloidogyne spp. (Table 1) were selected for designing Me-LAMP primers (Fig. 1) using PrimerExplorer v.4 software (http://primerexplorer.jp). To confirm the specificity of LAMP product through restriction digestion, a SacI enzyme site was introduced into the connection between the B1c and B2 sequences of the BIP primer (Table 2), so that the 240-bp LAMP target sequence could be digested by SacI and yield two predicted segments of almost equal length (about 120 bp).

Table 1.   List of 5S rDNA-IGS2 sequences from plant-parasitic nematode species used in bioinformatics analyses and primer design
SpeciesAccession no.PopulationOriginReference
Meloidogyne enterolobiiHQ896360Sanya1Hainan, ChinaThis study
HQ896361Sanya2Hainan, ChinaThis study
GQ395528ME97SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
GQ395547MEL111SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
GQ395559MEL372SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
DQ641506 Guangdong, ChinaK. Zhuo and J. Liao (unpublished data)
M. mayaguensisAY194854Line 13Puerto RicoHandoo et al., 2004;
M. incognitaGQ395501ME160SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
FJ555690 SwitzerlandJ.E. Frey, S. Kiewnick and M. Oggenfuss (unpublished data)
GQ395503ME168SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
M. arenariaGQ395518MEL46SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
U42342GovanUSAL.L. Georgi and A.G. Abbott (unpublished)
EU364878 Pennsylvania, USASkantar et al., 2008;
M. javanicaGQ39551355·6SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
M. haplaGQ130137Root gall no. 23Shandong, ChinaDirect submission
AY528418HIHawaii, USAHandoo et al., 2005a;
AJ421708Q48Queensland, AustraliaWishart et al., 2002;
M. fallaxGQ395579LA48SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
GQ39557529·1SwitzerlandM.H.M. Holterman, M. Oggenfuss, S. Kiewnick and J.E. Frey (unpublished data)
AJ421703Pleumeur GautierFranceJ. Wishart, M.S. Phillips and V.C. Blok (unpublished data)
M. chitwoodiAJ421701CkNetherlandsWishart et al., 2002;
AF013992CAMC2CanadaD.J. Petersen and T.C. Vrain (unpublished data)
M. thailandicaAY858796 ThailandHandoo et al., 2005b;
M. floridensisAY194853FloridaFlorida, USAHandoo et al., 2004;
M. artielliaAF248479 Bari, ItalyDe Giorgi et al., 2002;
Globodera pallidaL28955Pa2/3UKStratford & Shields, 1994
G. rostochiensisL28954 UKStratford & Shields, 1994
Figure 1.

 Design for Meloidogyne enterolobii-specific LAMP primers based on 5S rDNA-IGS2 sequences. (a) Scheme of the rDNA-IGS segment of M. enterolobii and the LAMP-amplified regions. (b) Multiple alignment of 5S rDNA (partial) and IGS2 (partial) sequences of representative M. enterolobii and other closely related species. The boundaries of the 5S rRNA genes and the IGS2 elements are indicated by double angles («»). In the aligned sequences, an asterisk indicates a match, a dash indicates a gap or unknown sequence. Localization and sequences of the designed LAMP oligonucleotides are shown on a grey background; FITC-labelled probe is marked by a box. Amplification directions are indicated by black arrows reported above the sequences.

Table 2.   DNA primers used for LAMP and traditional PCR detection of Meloidogyne enterolobii
Primer setOligonucleotideSequence (5′→ 3′)LengthUsageReference
VRF1/F2VRF1CGTAACAAGGTAGCTGTAG19 ntrRNA-ITS universal primersFerris et al., 1993
VRF2TCCTCCGCTAAATGATATG19 nt
MK7-F/RMK7-FGATCAGAGGCGGGCGCATTGCGA23 ntM. enterolobii-specific SCARTigano et al., 2010
MK7-RCGAACTCGCTCGAACTCGAC20 nt
Me-LAMPMeF3CCAAGTACTAAGGAAGCCC18 ntLAMP assay for M. enterolobiiThis study
MeB3ATCCTAATTTTYCTCCCACACA19 nt
MeFIPACAGTGATTACGACCATACCGCGTTCGTTGCTTAACTTGCCAGA44 nt
MeBIPTCTAAGGCAAAGTGGGCGGAGCTCTYTTTGCCTTAAACCATTCCC44 nt
MeLFAAGCACGCCATCCCGTC17 nt
MeLBTGTTGTTCGCTGTTCGC17 nt
Me ProbeMe ProbeGGGCGGGGCTATTTGTTGTTCGCTGTTCGCGGG33 ntLateral flow dipstick assayThis study

Optimization of the LAMP conditions

The LAMP reaction was performed according to the method previously described (Notomi et al., 2000; Tomita et al., 2008; Niu et al., 2011). The procedure used 25 μL reaction mixture containing 2·5 μL of 10×Bst DNA polymerase buffer, 1·4 mm dNTP, 1·6 μm (each) FIP and BIP primers, 0·2 μm (each) F3 and B3 outer primers, 0·8 μm (each) LF and LB primers, 0·8 m betaine (Sigma-Aldrich Co.), 8 U Bst DNA polymerase (New England Biolabs Ltd) and 1 μL purified genomic DNA (∼10 ng). Although the LAMP assay could use the non-denatured DNA, for improved amplification efficiency the template DNA in this study was denatured at 95°C for 5 min and then cooled on ice before adding Bst DNA polymerase. To find the optimum temperature and time for the visual LAMP amplification, the reactions were carried out in a 60–65°C water bath for 30, 45, 60 or 75 min. Finally, the mixture was heated at 80°C for 5 min to terminate the reaction.

The LAMP amplification results were visually inspected by the naked eye and under UV light by adding 1·0 μL of 1:10-diluted fluorescent dye SYBR Green I (Invitrogen) to the mixture and observing the solution’s colour. Alternatively, the turbidity could be derived from the white precipitate of magnesium pyrophosphate in the mixture and detected by the naked eye. Furthermore, the amplified products were monitored using 1·8% agarose gel electrophoresis stained with ethidium bromide. For the visualization of the LAMP amplicons with calcein, the LAMP assay was carried out in a 25-μL reaction mixture containing the same components as above, but with the addition of 25 μm calcein and 0·5 mm MnCl2, then the LAMP results were directly inspected by the naked eye or under UV light.

Traditional PCR

The PPN rDNA-ITS universal primer pair VRF1/F2 was used for evaluating plate DNA qualification (Table 2) (Ferris et al., 1993). Meloidogyne enterolobii-specific SCAR marker MK7-F/R was adapted for monitoring the specificity of the Me-LAMP assays (Table 2) (Tigano et al., 2010). The LAMP outer primer pair MeF3/B3 was used to confirm that the LAMP amplified the correct target. Each PCR mix had a total volume of 25 μL and contained 2·5 μL 10×Ex Taq buffer, 2 μL 2·5 mm dNTP, 0·5 μL 10 μm forward and reverse primers, 2 U Ex Taq-polymerase (Takara Bio Inc.) and 1 μL plate DNA (∼10 ng). Initial denaturation was conducted at 94°C for 4 min, followed by 30 cycles of denaturation (30 s at 94°C), annealing (30 s at 55°C for VRF1/F2, 62°C for MK7-F/R, 60°C for MeF3/B3) and extension (60 s at 72°C). Subsequently, 5 μL PCR products were subjected to 1·8% agarose gel electrophoresis, stained with ethidium bromide and visualized under UV light.

Verification of LAMP detection specificity

To confirm the specificity of LAMP amplification for the target sequences, the Me-LAMP products were digested separately with SacI restriction enzyme. The restriction enzyme site was selected on the basis of appropriate sequence information (shown in the Me-BIP sequence, Table 2). In addition, the products generated from conventional PCR using primer pair MeF3/B3 were cloned using the pMD18-T vector system (TaKaRa Bio Inc.) and sequenced.

To determine the LAMP specificity for the target Meloidogyne species, 43 PPN populations, including several Meloidogyne spp. and other species originating from different geographical regions and hosts (Table 3), were subjected to LAMP assays and the results compared with those of conventional PCR using the PPN universal primer pair VRF1/F2 and M. enterolobii-specific SCAR marker MK7-F/R, both of which were adapted for monitoring the specificity of the Me-LAMP assays. Specificity tests were repeated three times.

Table 3.   Species or populations of plant-parasitic nematode used to evaluate the analytical specificity of the LAMP assay
SpeciesCodeOriginal hostGeographical originVRF1/F2 PCRMK7-F/R PCRMe-LAMP
GelLFD
  1. ‘+’ and ‘−’ represent positive and negative results, respectively.

Meloidogyne enterolobiiMeGD1PepperPanyu, Guangdong++++
MeGD1PepperGuangzhou, Guangdong++++
MeHN1Pigeon peaQionghai, Hainan++++
MeHN2AubergineDanzhou, Hainan++++
MeHN3OkraDanzhou, Hainan++++
MeHN4GuavaSanya, Hainan++++
MeHN4GuavaSanya, Hainan++++
MeLN1TomatoShenyang, Liaoning++++
M. incognitaMiHaN1Bitter melonSanya, Hainan+
MiHaN2PapayaSanya, Hainan+
MiHaN3GuavaQionghai, Hainan+
MiHaN4BananaQionghai, Hainan+
MiHaN5Swamp cabbageQiongzhong, Hainan+
MiHaN6TomatoQiongzhong, Hainan+
MiHaN7CelosiaTunchang, Hainan+
MiHeN1TomatoZhongmou, Henan+
MiHeB1TomatoTangshan, Hebei+
MiHuN1CeleryJishou, Hunan+
MiHuN2CucumberJishou, Hunan+
MiSD1TomatoShouguang, Shandong+
MiBJ1TomatoMiyun, Beijing+
MiBJ2CeleryYanqing, Beijing+
MiBJ3CucumberYanqing, Beijing+
MiXJ1CowpeaKuche, Xinjiang+
M. javanicaMjHeN1PapayaSanya, Hainan+
MjHeN2Swamp cabbageSanya, Hainan+
MjSD1TomatoShouguang, Shandong+
M. arenariaMaHaN1Water SpinachSanya, Hainan+
MaHaN2AubergineSanya, Hainan+
MaSD1TomatoShouguang, Shandong+
M. haplaMhSD1TomatoShenyang, Liaoning+
MhSD2TomatoShouguang, Shandong+
Heterodera glycinesHgLN1SoyabeanShenyang, Liaoning+
H. avenaeHaBJ1WheatHuairou, Beijing+
HaBJ2WheatYanqing, Beijing+
HaHB1WheatBaoding, Hebei+
H. filipjeviHjHN1WheatXuchang, Henan+
Ditylenchus destructorDdJS1Sweet potatoNanjing, Jiangsu+
DdHB1Sweet potatoBaoding, Hebei+
DdSX1Sweet potatoTaigu, Shanxi+
Bursaphelenchus xylophilusBxJS1PineNanjing, Jiangsu+
B. mucronatusBmLN1PineShenyang, Liaoning+

Lateral flow dipstick (LFD) assay

For LAMP-LFD reactions, a 5′ biotin-labelled FIP primer was used in LAMP reactions, but other primers and components used were as described above. A DNA probe (Me probe) was designed from the sequence between the B1c and B2 regions of the LAMP amplicon, and labelled with FITC at the 5′ end (Fig. 1a, Table 2). Hybridization was carried out using the method recommended in previous reports (Kiatpathomchai et al., 2008). Then, 20 pmol probe were added to the LAMP products and incubated at 63°C for 5 min. After hybridization, 8 μL hybridized product were added to 100 μL assay buffer in a new tube. Finally, the commercially prepared LFD strips (MileniaBiotec) were dipped into the mixture for 5 min to detect the amplicon–probe hybrid; a reaction that gave a strong signal on the test line was determined to be a positive LFD assay.

Verification of LAMP detection sensitivity

To determine LAMP sensitivity, serial 10-fold dilutions of M. enterolobii genomic DNA (at an initial concentration of ∼100 ng μL−1) were prepared in ddH2O and subjected to LAMP and conventional PCR (using primer pair MeF3/B3) amplifications. In addition, the LAMP assays were also performed with 15 μL 10-fold serial dilutions of DNA template isolated from single juveniles and females of M. incognita. Amplification was monitored as described above. Sensitivity tests were repeated three times.

LAMP testing on host roots and soil samples

To demonstrate the field application of LAMP as a diagnostic tool for M. enterolobii surveys and management, 30 tomato root galls induced by M. enterolobii and 20 artificial inoculation soil samples collected from a greenhouse were surveyed using the LAMP method. Meloidogyne incognita-induced root galls, healthy roots and M. incognita-infected soil samples were used as negative controls (Table 4). The presence of M. enterolobii in galls from the same sampled root system was confirmed by using acid fuchsin stain and microscopic observation. To obtain crude Meloidogyne DNA from galls of nematode-infested tomato roots, approximately 5-mg sections of galls were crushed using a tapered glass rod in 40 μL worm lysis buffer (WLB: 50 mm KCl, 10 mm Tris pH 8·2, 2·5 mm MgCl, 60 μg mL−1 proteinase K, 0·45% Tween 20 and 0·01% gelatin) (Castagnone-Sereno et al., 1995). The lysis tissue was centrifuged slightly and 3 μL supernatant were transferred into a 25-μL LAMP reaction mixture. Experimental soil samples were prepared by adding 10 000 fresh-hatched juveniles to 100 g RKN-free and moist soil and mixing well. DNA eluate (50 μL) of Meloidogyne in 100-mg soil samples was prepared by using a PowerSoil™ DNA Isolation Kit (Mo-Bio Laboratories) following the instruction manual, and 1 μL of the undiluted DNA eluate was used for a 25-μL LAMP reaction mixture. The LAMP reactions were performed at 63°C for 60 min. Amplification was monitored with gel electrophoresis and SYBR Green I stain.

Table 4.   Detection of Meloidogyne enterolobii in root and soil samples using LAMP and conventional PCR
SamplesNematode densityRKN-LAMPMK7-F/R
Positive/trialsPositive ratePositive/trialsPositive rate
  1. Me: M. enterolobii; Mi: M. incognita.

  2. aRoot galls were sampled from Meloidogyne-infested tomato roots.

Root gallsa
 Me-induced galls1·31 females/gall29/3096·7%11/2055·6%
 Mi-induced galls1·19 females/gall0/2000/100
 Healthy rootNo female or gall0/100  
Soil
 Me-infected soil100 juveniles/g20/20100%20/20100%
 Mi-infected soil100 juveniles/g0/1000/100

Results

Confirmation of LAMP products

With a 10-ng plate of pure M. enterolobii genomic DNA, although detectable product was synthesized by incubating at 60°C for 30 min, optimization of LAMP reaction conditions (temperature and time) revealed that the ideal settings for the primer set were 63°C for 60 min, so LAMP assays were performed under these conditions.

After the LAMP reactions, the amplified products consisted of complex cauliflower-like structures with different sizes. As expected, the typical ladder-like pattern on gel electrophoresis was observed in all positive samples, but not in the negative controls (Fig. 2a).

Figure 2.

 Specificity of Me-LAMP detection and product confirmation. (a) The specificity of Me-LAMP assay. Lane M: molecular marker. Me, Mi, Mj, Ma and Mh represent Meloidogyne enterolobii, M. incognita, M. javanica, M. arenaria and M. hapla, respectively. (b) Restriction enzyme analysis of the LAMP products with (lane +) or without (lane −) SacI digestion.

It was difficult to see the white precipitate of magnesium pyrophosphate which is the subsidiary outcome of LAMP reactions with the naked eye without centrifugation. Under visual fluorescence detection with SYBR Green I and calcein, positive or negative results were easily determined, the samples giving positive reactions appearing green, while the negative control remained orange (Fig. 3).

Figure 3.

 Specificity of the LAMP assay products visualized by adding SYBR Green I (a) and calcein (b). Top row: direct visualization by the naked eye. Bottom row: observation under UV transillumination. Me, Mi, Mj, Ma and Mh represent Meloidogyne enterolobii, M. incognita, M. javanica, M. arenaria and M. hapla, respectively. The H2O tube was used as a negative control without DNA template.

To confirm that the amplification products had corresponding DNA structures, the amplified products were digested with restriction enzyme SacI and analysed by electrophoresis. The amplicons were digested completely and the resulting 120-bp fragment was in good agreement with the size theoretically predicted (Fig. 2b).

Determination of specificity for Me-LAMP assay

Specificity of the LAMP primers was tested using Meloidogyne spp., Heterodera glycines, H. avenae, H. filipjevi, Ditylenchus destructor, B. xylophilus and B. mucronatus (Table 3). With a gel electrophoresis analysis, all nematode populations could be amplified by the PPN universal primer pair VRF1/F2. As expected, only the eight M. enterolobii populations could be detected by M. enterolobii-specific SCAR marker MK7-F/R and the Me-LAMP set. Other PPN species were negative in both assays under the same reaction conditions (Table 3).

The LFD test further confirmed the presence of positive LAMP amplicons by hybridization in a sequence-dependent manner. Tests showed that the Me-LAMP LFD detection method was specific for M. enterolobii; the 20 pmol Me DNA probe yielded a strong signal of purple colour at the test line, and no cross-reactions occurred with other Meloidogyne spp. (Fig. 4) or the no-template control. These findings were consistent with the results of gel electrophoresis, SYBR Green I and calcein staining used in visual detection. In addition, the LFD detection method was time-saving and not equipment-dependent.

Figure 4.

 Specificity of LAMP-LFD for Meloidogyne spp. detection. Samples Me, Mi, Mj, Ma and Mh represent M. enterolobii, M. incognita, M. javanica, M. arenaria and M. hapla, respectively. H2O represents a no-template negative control.

Determination of sensitivity for LAMP assay

For analytical sensitivity tests, the Me-LAMP reactions were performed using 10-fold serial dilutions of pure DNA of M. enterolobii. As shown in Fig. 5a, the minimum detection concentration required for the Me-LAMP assay was 10 fg genomic DNA, i.e. 100 times more sensitive than conventional PCR (primer pair MeF3/B3 with a detection limit of 1 pg) (Fig. 5b) in a 60-min reaction. In addition, the LAMP assays were also performed successfully with 1% crude DNA isolated from single juveniles or females of M. enterolobii (Fig. 5c).

Figure 5.

 Comparison of the sensitivity of Me-LAMP and conventional PCR using serial DNA dilutions. (a) Me-LAMP and (b) MeF3/B3 products from serial DNA concentration. Initial template concentration was 100 ng Meloidogyne enterolobii DNA μL−1. The line 100–10−8 indicates serial dilutions of DNA solutions as templates. (c) Me-LAMP products from serial dilutions of single M. enterolobii DNA. Lane NC: no-template control. Lane M: DNA molecular marker.

Evaluation of the LAMP assay using root and soil samples

To demonstrate the applicability of the Me-LAMP method in field samples, the performance of this method was evaluated using root materials infested with M. enterolobii and soils artificially inoculated with J2s. For root gall samples, 29 of the 30 (96·7%) replicated LAMP reactions showed a positive result using M. enterolobii-induced galls, while with the same crude DNA extracts, only 11 of 20 (55·6%) samples were successfully detected by PCR reactions. With the control samples of M. incognita-induced galls and healthy roots, neither of the methods exhibited a false-positive reaction (Table 4). Additionally, for soil samples, all of the 20 M. enterolobii-infected soil samples were positively detected by the LAMP and PCR assays. By contrast, no amplification was obtained from the M. incognita-infected soil samples by either method (Table 4). These results indicated the high detection capability of the Me-LAMP assay.

Discussion

Traditional M. enterolobii diagnosis, based on morphological microscopic observation, isozyme electrophoresis and PCR-based molecular methods, is time-consuming and requires specialized techniques or knowledge. This report presents a novel method to detect M. enterolobii using the LAMP technique. The Me-LAMP reactions could be completed within 1–1·5 h by incubating at 65°C, the results were visually inspected using SYBR Green I and calcein staining, and amplicons were confirmed through gel electrophoresis, SacI enzyme analysis and lateral flow dipstick (LFD) assays. In this study, LAMP showed greater sensitivity than conventional PCR, as it could detect 10 fg pure genomic DNA or 1/100 crude DNA of single juveniles or females. Furthermore, the results indicated that the Me-LAMP assay could be successfully applied to the diagnosis of crude DNA isolated from root and soil samples. Therefore, in comparison to conventional methods, the Me-LAMP assay has the advantages of saving time, low cost and ease of operation, significantly increasing the efficiency of M. enterolobii diagnosis and management.

Within the rDNA repeat clusters from a wide variety of organisms, the IGS region is the least conserved. The primer pair 194 (5′-TTAACTTGCCAGATCGGACG-3′) and 195 (5′-TCTAATGAGCCGTACGC-3′) was designed to amplify the IGS2 region between the 5S rRNA and 18S rRNA genes for Meloidogyne spp., with PCR product sizes as follows: (a) M. incognita, M. javanica, M. arenaria (720 bp), (b) M. enterolobii (780 bp), (c) M. hapla (700 bp), (d) M. fallax (1600 bp) and M. chitwoodi (1700 bp) (Blok et al., 1997). The length polymorphism of IGS2 was recently used in a PCR-based molecular diagnostic to separate M. enterolobii from other common and economically important species of RKNs (Blok et al., 1997; Adam et al., 2007; Tigano et al., 2010). In this study, the Me-LAMP primers were designed to target the 5S rDNA-IGS2 using the PrimerExplorer v.4 program and modified manually. To avoid misdiagnoses, primers were selected to have an anchored location of low intraspecific variation and high interspecific variation, especially at the extension terminal of the 5′ end of F1c, the 5′ end of B1c, the 5′ end of BP and the 3′ end of B3 (Fig. 1). The results in this study indicated that the Me-LAMP assay was consistent with the result of M. enterolobii-specific SCAR marker MK7-F/R, exhibited high specificity to M. enterolobii populations, with no cross reaction with other PPNs samples.

Several studies have reported the use of the LAMP method for detecting various pathogens (Mori & Notomi, 2009). However, many of these studies used an expensive real-time PCR system) or a real-time turbidimeter for confirmation of the reaction. The use of expensive equipment decreases the versatility of LAMP and greatly limits the wide use of this procedure, especially in developing countries, so rapid and unambiguous visual inspection of LAMP results is essential for diagnostics, and several fluorescent intercalating dyes (such as ethidium bromide, SYBR Green I, hydroxynaphthol blue (HNB), Quant-iT PicoGreen, CuSO4 and calcein) have been developed to allow visual discrimination of positive samples. Here, two methods of visual detection were compared: (i) addition of SYBR Green I after incubation; and (ii) addition of calcein and MnCl2 before incubation. These two indicators gave similar colour changes from orange to green in positive amplifications, which could be judged under natural light as well as under UV light, and agreed with the gel results. However, consistent with previous reports, both SYBR Green I and calcein staining resulted in weak fluorescence under UV light in a negative reaction (Niessen & Vogel, 2010; Niu et al., 2011). In addition, the calcein and MnCl2 method showed a range of partial to total inhibition of the LAMP reaction and the colour change was difficult to see, which led to poor judgment by different independent observers (Goto et al., 2009). Taking into consideration the variation in visual observation between different observers, in future studies all the developed indicators should be systematically compared and analysed in multi-aspects of rapidity, simplicity, sensitivity and cheapness, then the most effective and practical means should be recommended and employed in LAMP detection.

To evaluate the applicability of the Me-LAMP method in the real world, it was tested on root and soil field samples. It was found that 29 of the 30 (96·7%) M. enterolobii-induced root galls and 20/20 (100%) infected soil samples were successfully detected, even though the LAMP reactions were performed on crude DNA extracted through a simple procedure. Combined with similar observations in previous reports (Sun et al., 2010; Francois et al., 2011), this indicated that the LAMP assay has great stability and sensitivity, and can overcome interference from a wide range of substances, such as polysaccharides, fats, proteins, salts and DNA from non-target organisms. Recently, some novel rapid methods and devices were developed to extract pathogen DNA from infected plant tissues within a few minutes (Tomlinson et al., 2010a,b). In the present study, the LAMP reactions were carried out by incubating in a water bath, but for field detection, this would be time-consuming and inconvenient. However, compact and portable kits have been developed to provide an amplification and detection platform for LAMP (Lee et al., 2008; Lucchi et al., 2010), which will facilitate its applications in point-of-care testing.

In summary, a rapid and highly specific LAMP assay was developed for the detection of M. enterolobii. Compared with conventional PCR, the LAMP method is simple to operate, with good sensitivity, and does not require specialized equipment. The primary results suggest that the Me-LAMP assay provides a promising tool for molecular diagnosis of M. enterolobii infections in point-of-care testing.

Acknowledgements

We are grateful to Dr Chen Zhongxiao for his careful reading our manuscript and modification. This study was financially supported by the Special Fund for Agro-scientific Research in the Public Interest, China (no. 201103018), the National Foundation of Natural Sciences, China (no. 30971901) and project 948 from the Ministry of Agriculture of China (no. 2011-G4).

Ancillary