Induction of systemic resistance against Cucumber mosaic virus by Penicillium simplicissimum GP17-2 in Arabidopsis and tobacco

Authors

  • M. M. Elsharkawy,

    1. United Graduate School of Agriculture Science, Gifu University, 1-1 Yanagido, Gifu City 501-1193, Japan
    2. Department of Agricultural Botany, Faculty of Agriculture, Kafr El-Sheikh University, 33516 Egypt
    Search for more papers by this author
  • M. Shimizu,

    1. Laboratory of Plant Pathology, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido, Gifu City 501-1193, Japan
    Search for more papers by this author
  • H. Takahashi,

    1. Department of Life Science, Graduate School of Agricultural Science, Tohoku University, 1-1 Tsutsumidori-Amamiyamachi, Aoba-ku, Sendai 981-8555, Japan
    Search for more papers by this author
  • M. Hyakumachi

    Corresponding author
    1. Laboratory of Plant Pathology, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido, Gifu City 501-1193, Japan
    Search for more papers by this author

E-mail: hyakumac@gifu-u.ac.jp

Abstract

The plant growth-promoting fungus, Penicillium simplicissimum GP17-2, was evaluated for its ability to induce resistance against Cucumber mosaic virus (CMV) in Arabidopsis thaliana and tobacco plants. Treatment with barley grain inoculum (BGI) of GP17-2 significantly enhanced fresh weight, dry weight and leaf number of A. thaliana and tobacco plants 6 weeks after planting. Two weeks after CMV inoculation, all plants treated with BGI of GP17-2 or its culture filtrate (CF) showed a significant reduction in disease severity compared with non-treated control plants, which exhibited severe mosaic symptoms by the end of the experiment. The enzyme-linked immunosorbent assay (ELISA) demonstrated that CMV accumulation was significantly reduced in plants treated with GP17-2 or its CF relative to control plants. Based on RT-PCR, plants treated with GP17-2 (BGI or CF) also exhibited increased expression of regulatory and defence genes involved in the SA and JA/ET signalling pathways. These results suggested that multiple defence pathways in A. thaliana and tobacco were involved in GP17-2-mediated resistance to CMV, although neither the transgenic NahG line, nor the npr1, jar1 or ein3 mutants disrupted the response in A. thaliana. This is the first report to demonstrate the induction of systemic resistance against CMV by GP17-2 or its CF.

Introduction

Cucumber mosaic virus (CMV) is one of the most destructive plant viruses, affecting the production of many crops in the world (Roossinck, 1999). It is difficult to control CMV because of its broad host range – it attacks more than 800 plant species – and its transmission in a non-persistent manner by more than 60 species of aphids (Palukaitis et al., 1992). Many studies have been published on the development of biological control agents, such as plant growth-promoting rhizobacteria (PGPR) and plant growth-promoting fungi (PGPF) (Lyon & Newton, 1997).

Plants utilize different defence mechanisms against pathogen attack. Some of these mechanisms can be triggered by certain stimuli prior to an attack, resulting in a reduction in disease severity (Ryu et al., 2004; Lee et al., 2005; Kang et al., 2007). The induction of systemic resistance has potential as an alternative method of crop protection. Yarwood (1960) first described the plant response to viral infection as a localized acquired resistance to Tobacco mosaic virus (TMV) in bean leaves. Ross (1961) showed that the infection of lower leaves of tobacco by TMV induced resistance to subsequent TMV infections in distal uninfected leaves, referred to as ‘systemic acquired resistance’ (SAR). SAR can be triggered by exposing the plant to pathogenic microbes or artificially with chemicals, such as salicylic acid (SA), 2,6-dichloro-isonicotinic acid (INA) or benzo-(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Métraux et al., 1991; Görlach et al., 1996; Vallad & Goodman, 2004). Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens (Doornbos et al., 2011). Induced systemic resistance (ISR) is defined as a phenomenon by which a plant exhibits an increased level of resistance to pathogen infection after the appropriate stimulation by avirulent or non-pathogenic microbes.

PGPR and PGPF are classes of soilborne microbes with beneficial effects on plant growth and the induction of defence resistance (Hossain et al., 2007; Ryu et al., 2007; Sultana et al., 2009). Several studies have established the role of selected strains of PGPR in ISR against CMV (Ipper et al., 2008; Wang et al., 2009).

One example of a PGPF is Penicillium simplicissimum GP17-2, which was isolated from the rhizosphere of zoysiagrass (Zoysia tenuifolia) and enhanced the growth of different agricultural crops (Hyakumachi, 1994; Shivanna et al., 1996a; Hossain et al., 2007). The barley grain inoculum (BGI) and culture filtrate (CF) of GP17-2 were shown to induce ISR responses in cucumber (Shivanna et al., 1996b; Koike et al., 2001) and A. thaliana plants (Hossain et al., 2007).

In spite of major advances in the understanding of plant defence responses, little information is available concerning PGPF-mediated induced resistance against viruses. Correlated with the onset of ISR is the enhanced production of the plant antioxidant protective enzyme, peroxidase (Shoman et al., 2003), and the activation of certain plant defence genes that produce pathogenesis-related (PR) proteins, the exact modes of action of which are not entirely understood (Shehata & El-Borollosy, 2008).

Salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) are recognized as key players in the regulation of the signalling pathways involved in SAR and ISR (van Loon et al., 2006; von Dahl & Baldwin, 2007). Both SAR and ISR pathways require NPR1 function (Dong, 1998; Pieterse et al., 1998). Moreover, the Coi1 gene is a key regulatory component of the JA signalling pathway and is required for plant fertility and defence responses (Xie et al., 1998). While SA accumulation is required for SAR (Sticher et al., 1997), ISR is independent of SA, but relies on JA- and ET-mediated pathways (Yan et al., 2002). Some of the PGPR strains that trigger ISR are linked to the induction of SAR (Ryu et al., 2004). In A. thaliana, a microarray analysis of plants that had been exposed to a variety of defence-inducing treatments revealed that more than 50 defence-related genes are co-induced by SA and JA, suggesting that the two signals coordinately regulate these genes (Schenk et al., 2000). Martinez et al. (2001) reported that SA, together with ET, coordinates the activation of defence mechanisms via an interaction between the two signalling pathways. Separate signalling pathways might have evolved to allow plants to fine-tune their defence responses, such that the appropriate defence combination against specific pathogens is deployed according to their virulence strategies (Kunkel & Brooks, 2002). Thuerig et al. (2006) reported Penicillium chrysogenum-induced resistance in A. thaliana that functioned independently of the SA and JA/ET signalling pathways. Sultana et al. (2009) showed that SA and JA/ET signalling pathways were modulated in A. thaliana by Phoma sp. GS8-3. Ryu et al. (2004) showed that PGPR-mediated protection against CMV in A. thaliana was independent of SA and NPR1 but dependent on JA. Tobacco plants treated with a Bacillus sp. had enhanced expression of the PR genes NPR1 and Coi1, which was associated with an increased resistance to CMV (Wang et al., 2009). Although many studies have reported the role of PGPR in the induction of ISR against CMV, little is known about using PGPF against CMV. Thus, the objective of this study was to evaluate the ability of the PGPF P. simplicissimum GP17-2 and its CF to induce resistance against CMV in A. thaliana and tobacco plants.

Materials and methods

Plants and pathogens

Seeds of A. thaliana ecotype Columbia (Col-0) were provided by K. S. Park (NIAST, Suwon, Korea). The mutants ein3 (Chao et al., 1997), jar1 (Staswick et al., 1992) and npr1 (Cao et al., 1994) were obtained from the Nottingham Arabidopsis Stock Centre. The transgenic line NahG (Lawton et al., 1995) was a personal gift. All mutants and transgenic A. thaliana plants were generated in a Col-0 background. Seeds of Nicotiana tabacum cv. Xanthi-nc and Nicotiana benthamiana were obtained from the Laboratory of Plant Pathology, Tohoku University, Japan, as was the yellow strain of Cucumber mosaic virus (CMV-Y). The virus was maintained in tobacco plants (cv. Xanthi-nc). The PGPF isolate P. simplicissimum GP17-2 was obtained from the Laboratory of Plant Pathology, Gifu University.

Barley grain inoculum (BGI)

Autoclaved barley grains (100 g in 100 mL water) were inoculated in a 500-mL Erlenmeyer flask with 10–15 mycelial discs (5 mm) transferred from the actively growing margin of 7-day-old potato dextrose agar (PDA; 2% agar) cultures of GP17-2. After 10–12 days of incubation at 25°C in the dark, the completely colonized barley grains were air-dried at room temperature (23–25°C). The dried BGI was ground to a 1- to 2-mm particle size and stored at 4°C until further use.

Cell-free culture filtrate (CF)

GP17-2 was cultured on PDA medium for 7 days. Twenty mycelial disks (5 mm) of GP17-2 culture were taken from the growing margin of a colony and transferred to a 500-mL Erlenmeyer flask containing 200 mL potato dextrose broth (PDB). The fungal culture was then maintained at room temperature (25°C) for 10 days without shaking. The crude culture filtrate was separated from the mycelia and filtered through two layers of Whatman No. 2 filter paper, and then filter-sterilized through a 0·22-μm Millipore filter.

Plant growth conditions

For the barley grain inoculum experiments, sterilized paper pots (size 3·8 × 5 cm for A. thaliana and 5 × 7·5 cm for tobacco) were filled with approximately 40 g (A. thaliana) or 70 g (tobacco) autoclaved commercial potting medium ‘Star-bed’ (soilless, peat-based potting medium, containing humus, rock phosphate and composted plant materials, Kyodohiryo Co. Ltd., Aichi, Japan), and sown with A. thaliana, N. tabacum or N. benthamiana seeds (five seeds per pot). After germination, plants were thinned to one plant per pot and maintained in a growth chamber under a 9-/15-h day/night cycle at 22°C for A. thaliana and a 12-/12-h day/night cycle at 25°C for tobacco.

For the culture filtrate experiments, A. thaliana and tobacco seeds were surface-sterilized by immersion in 70% ethanol for 2 min followed by 2% (v/v) NaOCl for 2 min, thoroughly rinsed three times in sterile distilled water, and vernalized for 2 days at 4°C in the absence of light. The seeds were soaked in 0·5 mL distilled water in Eppendorf tubes and stored in a refrigerator for 3 days at 4°C to synchronize germination. Using sterilized rockwool, five seeds were individually sown in each cube of rockwool, and thinned to one plant per cube after germination. The plants were irrigated with a 10-fold dilution of MGRL nutrient solution (Fujiwara et al., 1992) once a week and maintained in the growth chambers as described previously.

Fungal and chemical pre-treatment

Autoclaved potting medium in sterile pots was amended with the powdered BGI (0·5% w/w) of GP17-2 and sown with A. thaliana and tobacco seeds. Autoclaved potting medium supplemented with an equal volume of autoclaved barley grain served as a control. In the case of the rockwool-grown plants, 4-week-old A. thaliana and tobacco plants were treated with 50% diluted CF of GP17-2 for 1 h, then the excess CF was washed away with distilled water. The control plants were similarly treated with 50% diluted PDB.

The synthetic SAR inducer benzothiadiazole (BTH), a functional analogue of SA (Lawton et al., 1996), was included in these experiments as a positive control. The A. thaliana and tobacco plants grown in soil were treated with a soil drench of 0·3 mm BTH (Novartis Agro) 1 day prior to the challenge inoculation. However, in the case of the rockwool system, 4-week old A. thaliana and tobacco plants were treated for 1 h with a 5 mm BTH solution a day prior to the virus challenge inoculation and subsequently washed with distilled water.

Root colonization

Root colonization by GP17-2 was evaluated in A. thaliana and tobacco plants 7 weeks after planting for both GP17-2 and control treatments. Roots were collected from nine randomly selected plants, washed with tap water to remove the adhering soil, rinsed three times with sterile-distilled water, and blotted to dryness. They were then cut into 1-cm segments, plated onto PDA amended with 200 mg chloramphenicol L−1 and incubated for 3–4 days at 25°C. After incubation, the GP17-2 colonies were identified by the colour and growth pattern of the mycelia and pigments produced. The isolation frequency of the fungus was determined by counting the number of colony-forming root segments among the 100 root segments plated per replicate, as described by Meera et al. (1995).

Cucumber mosaic virus inoculations

The CMV inoculum used throughout the experiments consisted of infected tobacco leaf tissue ground in 0·01 m sodium phosphate buffer, pH 7·0, containing 0·002 m EDTA (1 g tissue per 50 mL sodium phosphate buffer). All inoculation materials were chilled at 4°C prior to the inoculation and maintained on ice during the inoculation. The plants were inoculated 4 weeks after planting by rubbing the inoculum onto the oldest leaf. Disease severity ratings for A. thaliana plants were: 0 = no symptoms; 2 = mild deformation and mosaic of the youngest two leaves; 4 = pronounced leaf deformation and mosaic of the youngest two leaves with progression of symptoms into sequentially older leaves; 6 = pronounced leaf deformation and mosaic progressed beyond the two youngest leaves, with all leaves expressing some form of CMV-induced symptoms; 8 = similar symptoms as described for a rating of 6, with plants also being stunted in growth (including both reduced internode extension and smaller leaves); and 10 = plants severely stunted with a majority of leaves being small, severely deformed and tightly bunched together (Ryu et al., 2004). Disease severity was rated in tobacco plants by counting leaves with symptoms. The disease severity results were expressed as mean values of 10 samples in each treatment.

Enzyme-linked immunosorbent assay (ELISA)

Indirect ELISA, as described previously (Zehnder et al., 2000) with some modifications, was used to determine CMV-Y concentration. Leaf samples were collected at 7 and 14 days post-inoculation (dpi), ground in 50 mm carbonate buffer (pH 9·6) and added to microtitre plates at a final dilution of 1:10 (g tissue mL−1 buffer). The plates were incubated overnight at 4°C and then washed three times with phosphate-buffered saline containing Tween (PBS-T). Anti-CMV (primary antibody) was added to the plates at a concentration of 1 fg mL−1 in PBS-T. The plates were incubated for 1·5 h at 37°C and washed three times with PBS-T. Goat anti-rabbit immunoglobulin conjugated to alkaline phosphatase was diluted 1:7500 in PBS-T and added to the plates. The plates were incubated at 37°C for 1 h then washed three times with PBS-T, the substrate (p-nitrophenylphosphate at 1 mg mL−1 in 10% diethanolamine, pH 9·8) was added and the reaction allowed to develop at room temperature. Absorbance values were read at 405 nm on a Bio-Rad model 550-microplate reader. ELISA was repeated in triplicate with four replicates per treatment and two leaves for each replicate.

Evaluation of plant growth

Shoot fresh weight and dry weight and number of leaves from the BGI-treated and non-treated A. thaliana and tobacco plants were recorded 6 weeks after planting. The experiment was repeated in triplicate with 10 plants per replicate.

RT-PCR analysis

For RNA analysis, leaves (three plants of A. thaliana or two leaves of tobacco for each sampling period) were harvested at different times after inoculation and stored at −80°C until further use. Total RNA was extracted following Suzuki et al. (2004) with some modifications. Briefly, leaves of randomly selected plants were ground in liquid nitrogen using a sterilized mortar and pestle and homogenized with the following extraction buffer: 100 mm Tris-HCl (pH 9·5), 10 mm EDTA (pH 8·0), 2% lithium dodecyl sulphate, 0·6 m NaCl, 0·4 m trisodium citrate and 5% 2-mercaptoethanol. Following centrifugation at room temperature, the resulting aqueous phase was re-extracted with a chloroform/isoamyl alcohol (24:1) mixture. The supernatant was collected and extracted with water-saturated phenol, guanidium thiocyanate, sodium acetate (pH 4·0) and chloroform. The upper aqueous phase was precipitated with isopropanol. The precipitated RNA was collected, washed, air-dried briefly and dissolved in RNase-free water. After treatment with RNase-free DNase, the DNase was inactivated according to the manufacturer’s instructions (Takara Bio Inc.). Approximately 1 μg total RNA was reverse-transcribed into single-stranded cDNA using a mixture of oligo-dT primer, RNase inhibitor (20 U μL−1) and RTase (50 U μL−1) according to the manufacturer’s instructions (Toyobo). An aliquot of the obtained cDNA was amplified by RT-PCR, as described by Suzuki et al. (2004), to monitor the expression of a set of well-characterized defence-related genes: AtPR-1 (Pieterse et al., 1998), AtPR-2, AtHEL, AtPR-5 (Oñate-Sánchez & Singh, 2002), AtPDF1.2, AtVSP (Penninckx et al., 1996), AtActin (Jones et al., 2003), NtPR-1a, NtNPR1, NtCoi1 (Wang et al., 2009) and NtActin (Takabatake et al., 2007). The gene-specific primers used in these experiments are listed in Table 1.

Table 1.   Gene-specific primers used in RT-PCR analysis in this study
GeneForward primer (5′-3′)Reverse primer (5′-3′)
AtPR-1 GTAGGTGCTCTTGTTCTTCCTTCACATAATTCCCACGAGG
AtPR-2 TCAAGGAAGGTTCAGGGATGTCGGTGATCCATTCTTCACA
AtHEL GTACCACCGCGGACACTGTCAATGAGATGGCCTTGTTGA
AtPR-5 ATGGCAAATATCTCCAGTATTCACAATGTCGGGGCAAGCCGCGTTGAGG
AtPDF1.2a AATGAGCTCTCATGGCTAAGTTTGCTTCCAATCCATGGAATACACACGATTTAGCACC
AtVSP TTTTACGCCAAAGGACTTGCATCCCGAGTTCCAAGAGGTT
AtActin GTTGGGATGAACCAGAAGGAGAACCACCGATCCAGACACT
NtPR-1a GTGTAGAACCTTTGACCTGGGATTCGCCTCTATAATTACCTGGA
NtNPR1 GATGTGTGTGTTTGTGTGGACAACGAGTCCATCGGATGTCAGATCAGAAGGTCTAG
NtCoi1 GGATTGACTGATTTGGCGAAGGTCCCTCACTGGCTACAACTCGT
NtActin GGGTTTGCTGGAGATGATGCTGCTTCGTCACCAACATATGCAT

Data analysis

The data were subjected to analysis of variance (anova) using xlstat pro statistical analysis software (Addinsoft). The experiments were repeated at least three times, and treatment means were separated using a Fisher’s least significant difference (LSD) test. A Steel–Dwass test was conducted using Ekuseru-Toukei 2010 (Social Survey Research Information Co., Ltd). All analyses were conducted at a significance value of P ≤ 0·05.

Results

Effect of BGI of P. simplicissimum GP17-2 on systemic protection against CMV in A. thaliana and tobacco

Symptoms of CMV appeared 10 dpi, and ranged from mild mosaic in young non-inoculated leaves to severe mosaic with stunting. At 14 dpi, A. thaliana and tobacco plants grown in soils amended with the BGI of GP17-2 exhibited a dramatic reduction in CMV symptoms as compared with the non-treated control plants, which showed severe symptoms of mosaic with small, deformed leaves (Fig. 1). All of the A. thaliana lines, N. tabacum cv. Xanthi-nc and N. benthamiana treated with the BGI of P. simplicissimum GP17-2 showed significant reductions in disease severity rating, similar to BTH-treated plants, 14 days after CMV inoculation (Fig. 2a,b).

Figure 1.

 Disease symptoms caused by Cucumber mosaic virus infection in (a) Arabidopsis thaliana, (b) Nicotiana tabacum and (c) Nicotiana benthamiana plants pre-treated with barley grain inoculum of Penicillium simplicissimum GP17-2, 2 weeks after virus challenge inoculation.

Figure 2.

 Disease severity in Cucumber mosaic virus-inoculated Arabidopsis thaliana and tobacco (Nicotiana tabacum and N. benthamiana) plants treated with barley grain inoculum of Penicillium simplicissimum GP17-2 or with BTH, relative to non-treated control plants at 14 days post-inoculation. Columns represent mean values (n = 10, error d.f. = 27). Bars indicate standard errors. Different letters above columns indicate significant differences by the Steel–Dwass test for A. thaliana and Fisher’s LSD test for tobacco (P ≤ 0·05).

Based on ELISA to measure CMV accumulation at 1 and 2 weeks after the virus challenge inoculation, CMV titre was significantly reduced in all A. thaliana and tobacco plants treated with BGI of GP17-2. However, the BTH-treated npr1 transgenic plants showed no significant differences in CMV titre compared with the control plants (Fig. 3).

Figure 3.

Cucumber mosaic virus accumulation in leaves of Arabidopsis thaliana lines, Nicotiana tabacum and Nicotiana benthamiana treated with either Penicillium simplicissimum GP17-2 or BTH at (a and b) 7 days and (c and d) 14 days post-inoculation. Columns represent mean values (n = 4, error d.f. = 9). Bars indicate standard errors. Statistical comparisons are among treatments within primary inoculated or secondary non-inoculated leaves and within the same line. Different letters indicate significant differences using Fisher’s LSD (P ≤ 0·05).

Effect of CF of P. simplicissimum GP17-2 on systemic protection against CMV

Two weeks after inoculation, the severity of CMV was significantly reduced in all A. thaliana and tobacco plants pre-treated with the CF of GP17-2 compared with the untreated control plants (Figs 4 and 5). Similarly, ELISA demonstrated that CMV titre was significantly reduced in A. thaliana and tobacco plants treated with CF of GP17-2 relative to the controls. These results confirm that the CF of GP17-2 was as effective as the BGI of GP17-2 (Fig. 6).

Figure 4.

 Disease symptoms caused by Cucumber mosaic virus infection of (a) Arabidopsis thaliana, (b) Nicotiana tabacum and (c) Nicotiana benthamiana plants pre-treated with culture filtrate of Penicillium simplicissimum GP17-2, 2 weeks after virus challenge inoculation.

Figure 5.

 Disease severity of Cucumber mosaic virus-inoculated Arabidopsis thaliana and tobacco (Nicotiana tabacum and N. benthamiana) plants treated with culture filtrate of Penicillium simplicissimum GP17-2 or with BTH, relative to non-treated control plants at 14 days post-inoculation. Columns represent mean values (n = 10, error d.f. = 27). Bars indicate standard errors. Different letters above columns indicate significant differences by the Steel–Dwass test for A. thaliana and Fisher’s LSD test for tobacco at P ≤ 0·05.

Figure 6.

Cucumber mosaic virus accumulation in leaves of Arabidopsis thaliana lines, Nicotiana tabacum and Nicotiana benthamiana treated with either culture filtrate of Penicillium simplicissimum GP17-2 or BTH at (a and b) 7 days and (c and d) 14 days post-inoculation. Columns represent mean values (n = 4, error d.f. = 9). Bars indicate standard errors. Statistical comparisons are among treatments within inoculated or non-inoculated leaves and within the same line. Different letters indicate significant differences using Fisher’s LSD (P ≤ 0·05).

All of the A. thaliana lines had the same protection values, regardless of the GP17-2 inoculum type used, as did the tobacco plants. In addition, no significant differences were observed between the protection values induced by the BGI of GP17-2 or its CF in any A. thaliana lines or tobacco plants.

Effect of BGI of P. simplicissimum GP17-2 on the growth of A. thaliana and tobacco

Arabidopsis thaliana and tobacco plants treated with the BGI of GP17-2 exhibited a significant increase in shoot fresh weight and dry weight and number of leaves compared with the control plants (Table 2). The treated A. thaliana plants showed increases of 64%, 71% and approximately two leaflets in shoot fresh weight, shoot dry weight and number of leaves, respectively, over the control plants (Table 2). Similarly, treated N. benthamiana plants showed average increases of 105%, 90% and approximately one leaf in fresh weight, dry weight and number of leaves, respectively, compared with the control (Table 2). As for N. tabacum, plants exhibited 136% and 163% increases in average fresh weight and dry weight, respectively, compared with the control, but no significant increase in the number of leaves (Table 2). However, across all plants the BTH treatments resulted in significantly reduced growth compared with the control.

Table 2.   Effect of Penicillium simplicissimum GP17-2 colonization and BTH treatment on growth of Arabidopsis thaliana, Nicotiana tabacum and Nicotiana benthamiana
TreatmentFresh weightDry weightNumber of leaves/plant
A. thaliana N. tabacum N. benthamiana A. thaliana N. tabacum N. benthamiana A. thaliana N. tabacum N. benthamiana
  1. *Values are means ± SEM (n = 5, error d.f. = 12). Different letters indicate significant differences by Fisher’s LSD at P ≤ 0·05.

GP17-21·00 ± 0·05a*9·52 ± 0·38a5·38 ± 0·21a0·12 ± 0·01a1·13 ± 0·09a0·57 ± 0·02a18·80 ± 0·49a7·20 ± 0·49a7·60 ± 0·40a
BTH0·40 ± 0·01b2·76 ± 0·16b1·58 ± 0·12b0·05 ± 0·00b0·26 ± 0·02b0·17 ± 0·01b15·20 ± 0·49b6·40 ± 0·40a6·00 ± 0·00b
Control0·61 ± 0·03c4·04 ± 0·15c2·62 ± 0·11c0·07 ± 0·00c0·43 ± 0·02c0·30 ± 0·01c16·80 ± 0·49c6·80 ± 0·49a6·8 ± 0·49ac

Root colonization

GP17-2 was reisolated at high frequencies from A. thaliana Col-0 and N. tabacum plants 6 weeks after planting. The reisolation frequencies were 90% and 85% for A. thaliana Col-0 and N. tabacum, respectively.

Effect of BGI of P. simplicissimum GP17-2 on expression of SA- and JA/ET-inducible defence-related genes

For BGI-treated A. thaliana Col-0, the expression of AtPR-1, AtPR-2, AtPR-5 and AtHEL was initially detected 1 day after CMV inoculation by RT-PCR and remained elevated at 6 dpi. Similarly, BTH-treated A. thaliana showed strong activation of PR genes prior to infection, and activity remained elevated at 6 dpi, whereas expression was not detected until 6 dpi in plants infected with CMV alone (control). By contrast, expression of AtPDF1.2 was detected 2 dpi and appeared to decline at 4 dpi. Expression of AtVSP was detected 1 dpi and remained elevated at 2 dpi. The BTH treatment showed no stimulation of the JA/ET-responsive AtPDF1.2 gene or the JA-responsive AtVSP gene after CMV infection. Similarly, none of the JA/ET-responsive genes showed enhanced expression after CMV infection in the control plants (Fig. 7).

Figure 7.

 Expression of defence-related genes in leaves of Arabidopsis thaliana Col-0 plants treated with Penicillium simplicissimum GP17-2 or 0·3 mm BTH 1 day before challenge inoculation with Cucumber mosaic virus. SA-responsive (AtPR-1, AtPR-2 and AtPR-5), ET/JA-responsive (AtPDF1.2), ET-responsive (AtHEL) and JA-responsive (AtVSP) genes were analysed as representative markers by RT-PCR using specific primers for each gene. A constitutively expressed AtActin was used as a control in RT-PCR.

In tobacco plants, expression of the NtPR-1a and NtNPR1 genes was observed 1 day after the induction treatment and remained elevated for 6 dpi. The NtCoi1 gene was elevated 1 dpi and appeared to decline 4 dpi (Fig. 8).

Figure 8.

 Expression of defence-related genes in leaves of Nicotiana tabacum plants treated with Penicillium simplicissimum GP17-2 or 0·3 mm BTH 1 day before challenge inoculation with Cucumber mosaic virus. SA-responsive NtPR-1a, a regulator of various defence genes (NtNPR1), and a regulator of the JA-dependent pathway (NtCoi1) were analysed as representative marker genes by RT-PCR using specific primers for each gene. A constitutively expressed NtActin was used as a control in RT-PCR.

Effect of CF of P. simplicissimum GP17-2 on expression of SA- and JA/ET-inducible defence-related genes

In A. thaliana plants, the CF of GP17-2 induced the expression of AtPR-1, AtPR-2, AtPR-5, AtHEL and AtVSP prior to inoculation, and expression remained elevated at 6 dpi. Similarly, BTH-treated A. thaliana showed elevated expression levels of AtPR-1, AtPR-2, AtPR-5 and AtHEL after induction treatment, which remained elevated at 6 dpi. By contrast, none of the PR-responsive genes showed stimulated expression after CMV inoculation in the control plants. The expression of AtPDF1.2 was best observed at 2 dpi in the CF treatment, while BTH and control treatments showed no stimulation of JA/ET-responsive genes after CMV infection (Fig. 9).

Figure 9.

 Expression of defence-related genes in leaves of Arabidopsis thaliana Col-0 plants treated with culture filtrate of Penicillium simplicissimum GP17-2 or 5 mm BTH 1 day before challenge inoculation with Cucumber mosaic virus. SA-responsive (AtPR-1, AtPR-2 and AtPR-5), ET/JA-responsive (AtPDF1.2), ET-responsive (AtHEL) and JA-responsive (AtVSP) genes were analysed as representative markers by RT-PCR using specific primers for each gene. A constitutively expressed AtActin was used as a control in RT-PCR.

In tobacco plants, NtPR-1a and NtNPR1 expression was detected 1 day after the induction treatment and remained elevated for 6 dpi. Expression of NtCoi1 was initially detected 1 day after infection, remaining elevated at 6 dpi (Fig. 10).

Figure 10.

 Expression of defence-related genes in leaves of Nicotiana tabacum plants treated with culture filtrate of Penicillium simplicissimum GP17-2 or 5 mmol L−1 BTH 1 day before challenge inoculation with Cucumber mosaic virus. SA responsive NtPR-1a, a regulator of various defence genes (NtNPR1), and a regulator of JA-dependent pathway (NtCoi1) were analysed as representative marker genes by RT-PCR using specific primers for each gene. A constitutively expressed NtActin was used as a control in RT-PCR.

Discussion

Induced systemic resistance is a widespread phenomenon that has been intensively investigated with respect to the underlying signalling pathways and potential use in plant protection (Heil & Bostock, 2002). Several studies have reported resistance induction against local lesion viruses, but the inefficiency of the treatment against systemic invasion by viruses is of little value for controlling the disease (Di Piero et al., 2010). Although many studies have shown the occurrence of viral inhibition by PGPR, mainly in studies of CMV with A. thaliana or tobacco plants (Ryu et al., 2004, 2007; Ipper et al., 2008; Thapa et al., 2009; Wang et al., 2009), little is known about the ISR against plant viruses associated with PGPF.

The results of this study demonstrated that the BGI and CF of GP17-2 could protect A. thaliana and tobacco plants against CMV, manifested as reductions in disease severity and in viral titre in leaves. Plants treated with a chemical inducer (BTH) of the plant defence response displayed responses that were similar, but not identical, to those of plants inoculated with GP17-2. Grohmann & Musumeci (1972) obtained similar results when they uncovered inhibitors to TMV infection in the culture filtrate from Aspergillus flavus. There was also a report that mycolaminaran, a β-1,3-glucan which was purified from Phytophthora megasperma cytoplasm, could reduce TMV incidence (Zinnen et al., 1991). Mycolaminaran also inhibited the incidence of infection of Datura stramonium and Nicotiana glutinosa by four strains of Cauliflower mosaic virus (CaMV) and Tomato spotted wilt virus (TSWV), respectively (Heinkel et al., 1992). The metabolites produced by the cyanobacteria Synechococcus leopoliensis and Nostoc sp. affected the incidence of TMV (Di Piero et al., 2000).

This study used several A. thaliana genotypes to elucidate the signalling pathways involved in these responses. In the disease suppression experiment including both the BGI and CF of GP17-2, significant disease suppression was observed in A. thaliana plants expressing the NahG transgene which impairs SA accumulation, indicating that the induction was independent of the SA signalling pathway. Similarly, A. thaliana mutants impaired in the JA (jar1)/ET (ein2) signalling pathways failed to disrupt the GP17-2-mediated suppression of CMV. Npr1 is required for both SAR and ISR (Mou et al., 2003); however, the npr1 mutant showed full protection after treatments with the BGI and CF of GP17-2, indicating that the npr1 mutation did not attenuate the GP17-2-mediated suppression of CMV.

There were strong correlations between disease severity and ELISA values in the different treatments in A. thaliana and tobacco plants. Moreover, A. thaliana and tobacco plants treated with either the BGI or CF of GP17-2 showed significantly lower ELISA values in non-inoculated leaves than in inoculated leaves at 7 and 14 dpi. These data indicate that treatment with the BGI or CF of GP17-2 limited virus movement into young leaves. Naylor et al. (1998) reported that the SA-mediated resistance in tobacco to Potato virus Y and CMV was related to the inhibition of viral replication and movement, respectively.

In the present study, roots were treated with the BGI or CF of GP17-2, and CMV was inoculated into the leaves, so that no direct contact existed between the two microorganisms. The treatments with the BGI and CF of GP17-2 probably induced changes in the roots that extended up to the leaves and activated defence mechanisms. Therefore, this suppression of disease seems to be via the activation of induced systemic resistance. These results confirmed that GP17-2 and its CF activate different signalling pathways against bacterial and viral pathogens. The data also demonstrated that the BGI of P. simplicissimum GP17-2 enhanced the growth of A. thaliana and tobacco plants. These data are consistent with those obtained for the BGI of GP17-2 in A. thaliana plants by Hossain et al. (2007). Shivanna et al. (1994) reported that the ammonium-N content of barley grains colonized by certain PGPF isolates increased as a result of the increased root utilization of ammonium-N and subsequent enhanced plant growth. Mechanisms of growth promotion might be the ability of the fungus to provide minerals to plants in a more available form and the suppression of attacking pathogens. Also, PGPF could produce plant hormones (such as auxins, cytokinins or gibberellins), that alter root morphology and stimulate growth (Furukawa et al., 1996; Contreras-Cornejo et al., 2009).

Molecular and genomic tools are now being used to uncover the complexity of the induced defence-signalling networks that have evolved during the co-evolutionary arms race between plant defences and their attackers (Pieterse & Dicke, 2007). It has been demonstrated that a network of interconnected signal transduction pathways in which SA, JA and ET play central roles regulates plant defence responses (Robert-Seilaniantz et al., 2007). These signalling pathways do not function independently but influence each other through a complex network of synergistic and antagonistic interactions (Koornneef & Pieterse, 2008). The present study analysed the expression of the defence-related marker genes of the SA- and JA/ET-dependent pathways. Both the BGI and CF of GP17-2 up-regulated the expression of the SA-responsive PR genes AtPR-1, AtPR-2, AtPR-5 and NtPR-1a, the JA/ET-responsive gene AtPDF1.2, the ET-responsive gene AtHEL, the JA-responsive gene AtVSP, the key player in activating the JA signalling pathway NtCoi1, and the regulator of various sets of defence genes NtNPR1, compared with the challenged control plants. The BTH treatments in soil and rockwool systems showed an induction of SA-responsive genes and AtHEL, but not AtPDF1.2 or NtCoi1. These results indicate that BTH can induce SA-responsive genes (Kohler et al., 2002). AtHEL is an ET-responsive gene, and SA might mediate its induction in response to BTH treatment as reported by van Wees et al. (1999) and Norman-Setterblad et al. (2000). Previous studies reported that some PGPF and PGPR strains could activate the induction of defence genes in A. thaliana and tobacco plants. Hossain et al. (2007) found that expression of the defence AtPR and AtVsp genes in mutant plants after CF treatment was enhanced in only the ein2 mutant; by contrast, AtPDF1.2 was eliminated in jar1 and ein2 mutants. Additionally, treatment of tobacco plants with Bacillus spp. activated the induction of NtPR1, NtNPR1 and NtCoi1 genes, indicating that Bacillus spp. mediated ISR against viral infection (Wang et al., 2009). Ahn et al. (2002) showed that treatment with selected strains of Bacillus amyloliquefaciens caused a rapid transcript accumulation of the defence-related genes, including PR-1a, phenylalanine ammonia-lyase (PAL), and 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) in tobacco plants after inoculation treatment. In addition, the treatment of A. thaliana plants resulted in the activation of AtPR-1 and AtPDF1.2.

In conclusion, the data show that treatment with the BGI of GP17-2 enhanced the growth of A. thaliana and tobacco compared with the BTH and control plants. Additionally, the disease severity and ELISA data demonstrated that treatment with the BGI or CF of GP17-2 suppressed CMV in A. thaliana and tobacco plants. The RT-PCR analysis showed that treatment with the GP17-2 or its CF increased the expression of SA-, JA- and ET-inducible genes. These results indicate that GP17-2 and its CF elicit ISR against CMV-Y via multiple pathways in A. thaliana and tobacco plants.

Acknowledgements

This work was supported by the Egyptian Government and a grant (KAKEN (B) 22380177) from the Japanese Ministry of Education, Culture, Sports, Science, and Technology (Monbukagakusho).

Ancillary