Effects of stolbur phytoplasma infection on DNA methylation processes in tomato plants

Authors

  • J. N. Ahmad,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • C. Garcion,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • E. Teyssier,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • M. Hernould,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • P. Gallusci,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • P. Pracros,

    Search for more papers by this author
    • Present address: INRA, Services Déconcentrés d’Appui à la Recherche (SDAR), F-33140 Villenave d’Ornon, France.

  • J. Renaudin,

    1. INRA, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France Univ. Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, F-33140 Villenave d’Ornon, France
    Search for more papers by this author
  • S. Eveillard

    Corresponding authorSearch for more papers by this author

E-mail: sandrine.eveillard@bordeaux.inra.fr

Abstract

DNA methylation was investigated as a possible mechanism for regulation of floral gene expression in stolbur phytoplasma-infected tomato buds. Expression of methylase and demethylase genes was found to be globally down-regulated in tomato plants infected with stolbur isolate PO, but not in those infected with isolate C. These results are consistent with the finding that SlDEF, a gene orthologous to arabidopsis APETALA3 which is involved in petal formation, was down-regulated in stolbur PO-infected buds and remained unaffected in stolbur C-infected buds, and with the fact that the two stolbur phytoplasma isolates C and PO induce distinct symptoms. Because of variations between the different cell-types of the flower buds, the DNA methylation status of SlDEF could not be clearly established. However, the finding that treatment of stolbur PO-infected plants with 5-azacytidine partially restored SlDEF gene expression strongly suggests that DNA methylation is involved in down-regulation of floral development genes in stolbur PO-infected tomatoes.

Introduction

Phytoplasmas are cell-wall-less, plant pathogenic bacteria that are restricted to the phloem sieve tubes and are vectored by phloem-sap-feeding insects. They are associated with hundreds of diseases that affect many crop plants (ornamentals, vegetables, fruit trees, cereals, grapevines) and cause important yield and quality losses worldwide (Seemüller et al., 1998; Lee et al., 2000). Phytoplasmas induce a wide variety of symptoms, of which leaf yellowing, growth aberrations (proliferation, dwarfism), and flower abnormalities are the most frequently encountered. However, because of the inability to grow phytoplasmas in a cell-free medium, studying the molecular mechanisms that underlie the physiological disorders they cause in their host plants has been strongly limited and, in spite of recent advances such as phytoplasma genome sequencing and description of virulence factors (Oshima et al., 2004; Bai et al., 2009; Hoshi et al., 2009; Sugio et al., 2011), phytoplasma biology is still far from being understood.

The stolbur phytoplasma belongs to taxonomic group 16SrXII and is vectored by the polyphagous insect Hyalesthes obsoletus. It is responsible for diseases in a wide variety of plants including herbaceous (stolbur diseases of tomato and tobacco, strawberry marginal chlorosis) and woody plants (decline of lavender, Bois Noir of grapevine) (Maixner, 2010).

In tomato, the most remarkable symptom of stolbur-diseased plants is the occurrence of flower malformations such as the development of non-pigmented, green flowers (virescence), the change of floral organs into leafy structures (phyllody), sepal hypertrophy and, in some cases, abortion of reproductive organs leading to plant sterility (Pracros et al., 2006). In these previous studies, it was shown that tomato floral abnormalities induced by stolbur phytoplasma-infection were associated with changes of the expression of genes involved in flower development (Pracros et al., 2006).

In infected flowers, the SlFALSIFLORA (SlFA) gene, orthologous to AtLEAFY of Arabidopsis thaliana, was up-regulated, whereas SlDEFICIENS (SlDEF), orthologous to AtAPETALA3, and required for normal petal and stamen development, was down-regulated, in line with petal malformation in infected plants. However, there was no change in the transcription of genes, such as SlFA, that control SlDEF (Pracros et al., 2006), suggesting that additional mechanisms are responsible for the reduced expression of this gene in stolbur phytoplasma-infected flowers.

In A. thaliana, it has already been suggested that the decreased expression of AtAPETALA3 leading to flower abnormalities could result from cytosine hypermethylation (Finnegan et al., 1996). Indeed, among the strategies that plants have evolved to cope with severe environmental stresses, changes in DNA methylation patterns were recently suggested to be an adaptive response that may modulate gene expression. For example, reduction in DNA methylation levels was reported in roots of cold-treated maize seedlings, demonstrating that DNA methylation was dynamically modified in response to environmental stimuli (Steward et al., 2002). Plant DNA methylation is also impacted under biotic stress conditions, as shown by the depletion in methylation that precedes the activation of the pathogen-responsive gene NtAlix1 following Tobacco mosaic virus (TMV) infection (Wada et al., 2004). Altered plant DNA methylation was also reported for the cotton–Verticillium spp. pathosystem (Guseinov & Vanyushin, 1975), and it was observed that A. thaliana displays centromeric DNA hypomethylation upon infection by Pseudomonas syringae (Pavet et al., 2006).

In plant genomic DNA, up to 30% of the total cytosine residues are 5-methyl cytosine (m5C), depending on plant species, organ and culture conditions (Steward et al., 2002). Cytosine methylation occurs in CpG, CpNpG and CpNpN contexts (where N can be any nucleotide) (Finnegan et al., 1998; Steward et al., 2002; Teyssier et al., 2008; Law & Jacobsen, 2010). Cytosine methylation is proposed to play an important role in transposon and retrotransposon silencing, chromatin structure, and regulation of tissue-specific gene expression (Zhang et al., 2010). In addition, spontaneous hypermethylation of specific loci can lead to the formation of stable epialleles. Such hypermethylation has been described for the SUPERMAN locus in A. thaliana, resulting in the formation of extra stamens, and for an SBP-box transcription factor in tomato, impairing fruit ripening (Manning et al., 2006).

It was previously shown that infection by stolbur isolate PO had almost no effect on the expression of SlFA, which is known to positively control expression of SlDEF (Pracros et al., 2006). Therefore, in the present study it was hypothesized that methylation could be involved in the epigenetic regulation of SlDEF gene expression. To test this hypothesis, the effect of plant DNA demethylation was studied on subsequent stolbur phytoplasma infection. A cytidine analogue, 5-azacytidine, was used to experimentally alter methylation in infected plants.

Materials and methods

Biological materials: plants and pathogens

Seeds of tomato (Solanum lycopersicum) cv. Ailsa Craig (Darby et al., 1977) were obtained from the Tomato Genetics Resource Center (University of California, Davis, USA). Tomato plants were grown from seeds and maintained in the greenhouse (27°C day, 20°C night).

Stolbur phytoplasma isolate C (stolbur C) was initially found in tomato in Vaucluse (southeastern France) (Cousin et al., 1968) and was maintained in tomato by successive side-grafting. Stolbur phytoplasma isolate PO (stolbur PO) was initially introduced into periwinkle (Catharanthus roseus) plants through natural insect (H. obsoletus) transmission in an apricot orchard in Pyrénées Orientales (southern France) (Jarausch et al., 2001). It was transferred from periwinkle to tomato plants using dodder (Cuscuta campestris), a phloem-sap-feeding parasitic plant, and was further propagated in tomato by side-grafting.

Batches of 10 tomato seedlings (2 months old) were side-grafted with pieces of bark (two per plant) from healthy (control), stolbur C- or stolbur PO-infected plants. Colonization of plants by the stolbur phytoplasma was followed by symptom observation, and verified by PCR, using primers fU5 (5′-CGGCAATGGAGGAAACT-3′) and rU3 (5-TGTTACAAAGAGTAGCTGAA-3′) (Ahrens & Seemüller, 1992). Young leaves and flower buds 1, 3 and 5 mm in size were harvested 25 days after grafting when symptoms of yellowing and deformation appeared on leaves. On stolbur C and PO phytoplasma-infected tomatoes, leaves and flower buds of branches with symptoms harvested from 10 plants (one batch) were pooled to homogenize the samples. Leaves and flower buds of equivalent size and position were harvested from healthy tomato plants. Three independent experiments were conducted.

5-Azacytidine (Aza-C) treatment

Tomato seeds were germinated and seedlings were grown for 4 weeks in Murashige and Skoog medium supplemented with 10 or 50 μm Aza-C (Janousek et al., 1996; Kondo et al., 2006; Takeno, 2010), before being transferred to the greenhouse. After 2 months, batches of 10 plants were side-grafted with scions from healthy (control), stolbur C-, or stolbur PO-infected plants and symptom production (leaf yellowing and deformation) was recorded as a function of time after grafting. Colonization of plants by the stolbur phytoplasma was verified by PCR using primer pair fU5-rU3 (Ahrens & Seemüller, 1992). The experiment was repeated twice at a 2-year interval. As a control for SlDEF gene expression in flower buds of the Aza-C-treated tomatoes infected with stolbur PO phytoplasma, flower buds of 1, 3 and 5 mm from bunches with flowers showing a normal phenotype were harvested and pooled by size.

Nucleic acid isolation

Genomic DNA was isolated from 0·5 g fresh leaves and 0·2 g flower buds sampled from healthy, stolbur C- and stolbur PO-infected tomatoes using the cetyl-trimethyl ammonium bromide method as described previously (Pracros et al., 2006).

For RNA extraction, collected samples were immediately frozen in liquid nitrogen and stored at −80°C until use. Total RNAs were isolated using the Tri-Reagent® (Sigma-Aldrich) protocol. Briefly, 0·1–0·2 g frozen young flower buds or leaves were ground in liquid nitrogen and the powder was mixed with 2 mL Tri-Reagent® following the manufacturer’s protocol. The nucleic acids were dissolved in 20 μL sterile water and the concentration was determined with a UV spectrophotometer at λ = 260 nm.

For RT-PCR experiments, RNA samples (10 μg) were treated with RQ1-DNase (5 U) according to the supplier’s instructions.

Semiquantitative RT-PCR analysis

One microgram of RQ1-DNase-treated RNA was reverse-transcribed using 5 μm oligodT18 primer and 200 U Superscript II reverse transcriptase (Invitrogen) in a 25-μL reaction mixture containing 10 mm DTT, 20 μm dNTPs and 40 U RNase Out (Invitrogen) (Pracros et al., 2006). The reaction was performed according to the recommended protocol except that the mixture (RNA+oligodT18) was heat-denatured at 65°C for 5 min before adding the reverse transcriptase and the other components. Controls, without reverse transcriptase, were used to verify the efficiency of the DNase treatment; as expected, no amplification was obtained. PCR amplification was carried out from 0·1 μL RT reaction mixture in the presence of primers at 2 μm each and 1·5 U Taq DNA polymerase (Promega). The annealing temperature and the number of PCR cycles varied depending on the primer set used (Table 1). Sequences of tomato demethylase genes DML728 (SGN-U319728), DML729 (SGN-U319729) and DML325 (SGN-U324525) were retrieved from TIGR (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=tomato) and SGN (http://solgenomics.net/). Primers specific to these genes and SlDEF are listed in Table 1. Other primers used are as described in Teyssier et al. (2008). PCR products were separated by 1·5% agarose gel electrophoresis in 1 × TAE buffer, and stained with ethidium bromide. Band intensities were quantified using the Bio-Rad Fluor-S Max MultiImager system and Quantity One software. In each of the three experiments, leaves and flower buds were collected from young parts of 10 tomato plants and pooled together to make a homogeneous RNA sample. All RT-PCR analyses were carried out in triplicate.

Table 1. List of primers used
Primer nameSequence 5′– 3′TargetNo. cyclesAnnealing temperature (°C)Size (bp)Used for
fU5CGGCAATGGAGGAAACT16S rDNA3555881Detection
rU3TGTTACAAAGAGTAGCTGAA16S rDNADetection
Dml728fTCTGGAACTGTACC DML728 3255246RT-PCR
Dml728rGGTGAGTGAAATTTTCCCT DML728 RT-PCR
Dml729fTTCTGGAATTGTACCCTGTG DML729 3055248RT-PCR
Dml729rGTTGATTGAAGTTCTGGAA DML729 RT-PCR
Dml325fACTTCC TCGATAGACTGGTG DML325 3255246RT-PCR
Dml325rCAG GAAGTGGTTGGAGAGG DML325 RT-PCR
SlDEFF5GGTTGAGTAGTAATTTTCACC SlDEF 2850140RT-PCR
SlDEFR2TTCATACTTCCACATGATC SlDEF RT-PCR
Fme2GAAGAAATGGGCTATTCAAG SlDEF 2856280MSRE-PCR
Rme2CCGTTATTTCAAGAATCTTTAC SlDEF MSRE-PCR
Fme3GATCTTTAACTTTCCCCCTT SlDEF 3056179MSRE-PCR
Rme3CCGTTATTTCAAGAATCTTTAC SlDEF MSRE-PCR
F20TAGTTAATTAGAGAGTATTTG SlDEF 3052640Bisulphite seq
R22ATCTTAAATACTCAAACCCTA SlDEF Bisulphite seq
F21AAGTTACGATGTAGATTATA SlDEF 3052396Bisulphite seq
R23TTATCCCTACCATCACAAC SlDEF Bisulphite seq

Real-time RT-PCR analysis

The cDNAs were first diluted to 100 ng μL−1 in sterile water. Real-time RT-PCR assays were performed with a Roche Light Cycler 480. Each reaction tube contained 1 × SYBR Green Fluorescein Mix (Applied Biosystems), primers at 250 nm each and 1 μL cDNA in a final volume of 25 μL. The thermal cycling programme was as follows: 95°C for 15 min, 45 steps each of 20 s at 95°C, 40 s at the annealing temperature (which was adjusted according to the primer pair used) and 40 s at 72°C. The cycling programme was followed by a melting-curve programme: 30 s at 95°C, 10 s at 60°C and a melting step from 60°C to 100°C (step of 0·5°C every 10 s) for 80 cycles, and a final step of 10 min at 72°C. All RT-PCR analyses were carried out in triplicate as described above. Efficiencies of all primer pairs were determined using tenfold dilutions of the RT-PCR product (undiluted, 1/10, 1/100, 1/1000, 1/10 000) using LightCycler 480 software and were found to range from 95 to 110%.

The results were analysed using relative gene expression (RGE) values (Pfaffl, 2001), according to the following formula:

image

Methylation-sensitive restriction endonuclease and PCR amplification (MSRE-PCR) analyses

DNA samples (0·5 μg) were digested with 40 U MboI and Sau3AI (recognition site GATC; Fermentas) at 37°C for 18 h in a final volume of 20 μL. Sau3AI is sensitive to methylation, whereas MboI is not. In the control, the restriction enzyme was omitted. PCR was performed using two distinct primer pairs, Fme2-Rme2 and Fme3-Rme3 (Table 1), designed from the SlDEF gene sequence to amplify regions close to the 5′UTR-end, each containing a single CGATC site. The amplification reaction mixture contained 1 U Taq DNA polymerase (Promega), 0·2 mm dNTPs (Promega) and primers at 2 μm each. Amplification was carried out for 35 cycles each consisting of 45 s at 94°C, 45 s at 52°C and 45 s at 72°C. Finally, 8 μL PCR product were loaded onto 2% agarose 1 × TAE gels for electrophoresis and visualized after ethidium bromide staining. Experiments were performed with three distinct RNA preparations from three distinct batches of tomatoes.

Statistical analyses

For each experiment, Student’s t-tests were conducted and P values determined. Numbers of bunches were counted for each of the 10 plants. Numbers of bunches in non-treated plants were compared to those in Aza-C-treated plants for each category (healthy, stolbur C- or stolbur PO-infected). For expression of the methyltransferase genes (Table 3), normalized values obtained with Quantity One software (Bio-Rad) were used for the statistical analyses. In the case of the demethylase genes, values of RGE were used for the statistical analyses.

SlDEF bisulphite sequencing

Bisulphite sequencing was performed using bisulphite-modified DNA (Foerster & Scheid, 2010). Bisulphite treatment of DNAs from flower buds of healthy or stolbur PO-infected tomatoes was done using an Epitec bisulphite kit (QIAGEN) following the manufacturer’s recommendations. One microgram of DNA was submitted to the bisulphite treatment. For each sample, 2-μL aliquots of the bisulphite-treated material were used for the first PCR with primers F20-R22. Then, 1 μL of a tenfold dilution of these products was used for the second PCR with primers F21-R23 (see primer sequences in Table 1). Each PCR consisted of 30 cycles of 94°C for 45 s, 52°C for 45 s and 72°C for 50 s. The amplified products, the sequence of which included the CAAT box and the TATA boxes of the SlDEF gene, were cloned using the pGEMT-Easy vector following the manufacturer’s recommendations (Promega). Twenty clones of each plant, healthy or infected, were sequenced, and experiments were repeated three times.

Southern blot hybridization

DNA methylation was analysed by Southern blot hybridization of DNA after digestion by methylation-sensitive restriction enzymes. Total DNA (15 μg) from flower buds (1, 3 and 5 mm) or leaves from healthy, stolbur C- and stolbur PO-infected tomatoes was digested with MspI or HpaII (Fermentas) which both recognize the restriction site C1C2GG but display distinct sensitivities to the methylation of cytosine residues. MspI is inhibited when C1 is methylated and therefore provides an estimation of the CNG-type of methylation, whereas HpaII is inhibited when any of the C1 and C2 cytosine residues is methylated. After digestion, DNA fragments were separated by agarose gel electrophoresis and blotted onto Hybond-XL membrane (Amersham). Hybridizations were performed with DIG-labelled (Roche) arabidopsis 5S rDNA as the probe (Teyssier et al., 2008).

Results

Symptom expression in stolbur C- and stolbur PO-infected tomato plants

Stolbur C-infected tomatoes displayed small leaves (indented, ragged-edged) with light marginal chlorosis. Flowers were of reduced size and poorly pigmented, but harboured normal floral organs and were fertile. In contrast, the leaves of stolbur PO-infected tomatoes were of normal size, but chlorotic and crook-shaped. In addition, when comparing healthy and stolbur PO-infected tomatoes, the number of flower bunches was significantly lower in infected plants (with Student’s t-test, < 1·10−7). Indeed, there were one or two flower bunches per PO-infected plant, compared with five or six for healthy ones. In addition, flower buds were characterized by hypertrophied sepals that occasionally fused (leading to the so-called big-bud symptom) and aborted petals and stamens leading to plant sterility (Fig. 1). These differences in symptoms were certainly not caused by a difference in phytoplasma titre. The finding that PCR detection of the phytoplasmas in stolbur C- and stolbur PO-infected plants yielded very similar amplification signals indicates that these differences in symptom production are probably not related to differences in the multiplication rate, but instead are dependent on the identity of the phytoplasma isolate. This assumption is further reinforced by the fact that, whatever the stage of infection, stolbur C-infected tomatoes never showed hypertrophied sepals or other symptoms typical of stolbur PO-infected tomatoes, and vice versa.

Figure 1.

 Floral symptoms observed on healthy (a, d) or stolbur PO (b, e) or stolbur C (c, f) phytoplasma-infected tomato (Solanum lycopersicum) cv. Ailsa Craig plants.

Expression of SlDEF in stolbur C- and PO-infected tomatoes

To analyse SlDEF gene expression in stolbur phytoplasma-infected tomatoes cv. Ailsa Craig, semiquantitative RT-PCR experiments were carried out using RNA from healthy, stolbur C-, and stolbur PO-infected tomato buds, and SlDEF-specific primers SlDEF-F5 and SlDEF-R2. PCR amplification using the phytoplasma-specific primers fU5 and rU3 (Ahrens & Seemüller, 1992) was used as the control for measuring infection of tomato plants by the stolbur phytoplasma. Infected plants all yielded similar amplification signals, indicating similar infection levels (Fig. 2c). As expected, given its role in flower development, SlDEF was expressed in flower buds but not in leaves of healthy and stolbur C-infected plants, while its expression was down-regulated in buds from stolbur PO-infected plants (Fig. 2a). Indeed, whereas the SlDEF transcript was clearly detected in healthy (H) and stolbur C-infected (C) buds, it was not or very faintly detected in buds from stolbur PO-infected tomatoes (PO), indicating that stolbur PO-infection results in a major down-regulation of SlDEF. The same results were obtained regardless of bud size (1, 3 or 5 mm), i.e. flower developmental stage (Fig. 2a).

Figure 2.

 Expression of SlDEF gene. Semiquantitative RT-PCR using gene-specific primers was performed on total RNA extracted from leaves or 1-, 3- or 5-mm flower buds of either healthy tomato plants (H), or plants infected by stolbur phytoplasma isolate C or PO. RNA was extracted from non-treated tomato plants (panel a) or from normal flower buds of azacytidine-treated plants (panel d). The constitutively expressed EF-1α gene is shown as a control for non-treated (panel b) or azacytidine-treated (panel e) plants. Panel c: Detection of stolbur phytoplasma using fU3-rU5 primers.

Partial restoration of expression of SlDEF in flower buds of stolbur PO-infected plants by 5-azacytidine treatment

Tomato seedlings were submitted to DNA demethylation through Aza-C treatment prior to being graft-inoculated with stolbur C or PO phytoplasmas. Symptom production (leaf yellowing and deformation) was then recorded as a function of time after grafting (Table 2). In the case of stolbur PO, untreated plants did not show any symptoms up to 12 days post-grafting. In contrast, five and seven out of the 10 plants treated with Aza-C (10 and 50 μm, respectively) showed symptoms 12 days post-grafting. All 10 stolbur PO-infected plants treated with 50 μm Aza-C showed leaf yellowing at 27 days post-grafting, while 39 days were required for all 10 untreated plants to show symptoms. Similarly, accelerated appearance of leaf symptoms was also observed in stolbur C-infected plants.

Table 2. Number of tomato plants presenting leaf yellowing symptoms 34 days after infection with stolbur C (C) or PO (PO) phytoplasma by side-grafting and treatment with 0 (aza-0), 10 (aza-10) or 50 μm (aza-50) azacytidine
 Number of days after grafting
012222733373946
Stolbur POaza-000268910 
aza-10057891010 
aza-5007810101010 
Stolbur Caza-0000246810
aza-100223671010
aza-500136771010

The effect of Aza-C treatment on flowers of stolbur C- and PO-infected tomatoes, as well as on healthy controls, is summarized in Fig. 3. In healthy plants, the Aza-C treatment (50 μm) had a limited effect, as the average number of bunches per plant was four, as compared to 5·5 (< 0·005) in the untreated plants. By contrast, in stolbur PO-infected plants, Aza-C treatment resulted in an increased number of bunches (from one to four, < 1·10−4). Interestingly, when treated with 50 μm Aza-C, healthy, stolbur C- and stolbur PO-infected plants had identical numbers of bunches, suggesting that DNA demethylation might in some way circumvent the effect of stolbur phytoplasma infection.

Figure 3.

 Number of bunches of flower buds per tomato plant following treatment with azacytidine (Aza). Tomatoes were healthy or infected with stolbur C (Stol-C) or stolbur PO (Stol-PO) phytoplasma. **< 0·005 (treated vs. non-treated for each group).

Stolbur PO-infected tomatoes are characterized by flower malformations including hypertrophied sepals and aborted petals and stamens. Similar phenotypes were observed on Aza-C treated plants, irrespective of the concentration used. By contrast, Aza-C treated plants harboured a few (approximately 2%) apparently normal flowers, which were never observed in untreated plants.

Although the Aza-C treated, stolbur PO-diseased plants possessed a limited number of normal flower buds, these results clearly show that Aza-C treatment (i.e. DNA demethylation) does interfere with the plant response to stolbur phytoplasma infection and partially counteracts the down-regulation of floral development. Consistent with these results, the expression of SlDEF was restored in the buds from bunches of Aza-C treated, stolbur PO-infected plants showing normal flowers (Fig. 2d). These data support a role for DNA methylation in down-regulation of SlDEF in the flower buds of stolbur phytoplasma-infected tomatoes.

Down-regulation of methylase and demethylase gene expression by stolbur phytoplasma-infection

To investigate the mechanism by which infection by the stolbur phytoplasma has an effect on the methylation status of the host-plant DNA, the expression of genes involved in cytosine methylation was studied by semiquantitative RT-PCR. Transcript levels of the DNA methyltransferase genes were determined in leaves and flower buds of healthy, stolbur C-, and stolbur PO-infected tomato plants. The seven genes tested (SlMET1, SlCMT2, SlCMT3, SlCMT4, SlDRM5, SlDRM7 and SlDRM8) encode distinct DNA methyltransferases ranging within the three main classes (methyltransferases, METI; chromomethylases, CMT; and domain rearranged methyltransferases, DRM) described in arabidopsis (Finnegan et al., 1998; Teyssier et al., 2008). The results presented in Table 3 show that MET1 expression was not significantly altered upon stolbur C or PO infection. In contrast, expression of the chromomethylase genes SlCMT 2, 3 and 4 was strongly down-regulated in both leaves and flower buds of stolbur PO-infected plants, but not in those infected with stolbur C. Indeed, the RGE, compared with healthy plants, varied from 0·09 (SlCMT2 in 5-mm buds) to 0·22 (SlCMT2 in 3-mm buds). Concerning the DRM, expression of SlDRM5 was slightly down-regulated in stolbur PO-infected plants, but was not changed in stolbur C-infected ones. On the contrary, expression of SlDRM7 and SlDRM8 was significantly affected by stolbur phytoplasma infection. Whereas SlDRM7 was up-regulated in stolbur PO- but not in stolbur C-infected plants, SlDRM8 was found to be over-expressed in stolbur C- but not in stolbur PO-infected plants.

Table 3. Determination of expression of tomato DNA methyltransferase genes by semiquantitative RT-PCR and demethylase genes by real-time RT-PCR using gene-specific primers. Total RNA was extracted from leaves or 1-, 3- or 5-mm flower buds of either healthy plants (H), or those infected by stolbur phytoplasma isolate C or PO. The constitutively expressed EF-1α gene was used as a reference gene
  1. Values are normalized ratios ± SE with *< 0·05 for methyltransferase genes, and relative gene expression ± SE for demethylase genes with **< 0·01.

Gene1- mm Flower buds3-mm Flower buds5-mm Flower budsLeaves
HCPOHCPOHCPOHCPO
Methyltransferases
 SlMET1 11·00 ± 0·050·97 ± 0·0811·02 ± 0·021·10 ± 0·2510·82 ± 0·110·94 ± 0·0411·49 ± 0·680·98 ± 0·52
 SlCMT2 11·88 ± 0·540·11 ± 0·03*11·21 ± 0·100·22 ± 0·14*10·68 ± 0·170·09 ± 0·05*11·92 ± 0·570·13 ± 0·10
 SlCMT3 11·27 ± 0·08*0·26 ± 0·11*11·38 ± 0·500·57 ± 0·2210·72 ± 0·180·38 ± 0·02*11·30 ± 0·290·17 ± 0·10*
 SlCMT4 11·73 ± 0·27*0·45 ± 0·20*11·34 ± 0·640·53 ± 0·17*10·98 ± 0·570·56 ± 0·2312·21 ± 0·680·09 ± 0·06*
 SlDRM5 11·28 ± 0·210·87 ± 0·2010·84 ± 0·180·66 ± 0·02*10·69 ± 0·220·76 ± 0·1412·05 ± 1·500·44 ± 0·27*
 SlDRM7 11·59 ± 0·393·71 ± 1·5211·39 ± 0·161·93 ± 1·1011·11 ± 0·101·92 ± 0·4011·05 ± 0·140·10 ± 0·01
 SlDRM8 13·63 ± 0·971·77 ± 0·8812·10 ± 0·521·23 ± 0·1711·51 ± 0·810·62 ± 0·4712·79 ± 0·520·66 ± 0·05
Demethylases
 DML729 11·64 ± 0·100·80 ± 0·02**11·21 ± 0·180·33 ± 0·10**10·98 ± 0·160·48 ± 0·15**11·32 ± 0·270·06 ± 0·01**
 DML728 11·72 ± 0·380·55 ± 0·03**11·48 ± 0·01**0·50 ± 0·03**11·41 ± 0·280·58 ± 0·17**11·76 ± 0·520·03 ± 0·02**
 DML325 11·95 ± 0·15**0·96 ± 0·4011·36 ± 0·010·67 ± 0·1011·10 ± 0·730·21 ± 0·02**10·90 ± 0·53**0·10 ± 0·10**

As DNA methylation status results from both methylation by DNA methyltransferases and demethylation by DNA glycosylase lysases (e.g. the arabidopsis demethylase DEMETER) (Morales-Ruiz et al., 2006), the effect of phytoplasma infection on the expression of tomato demethylase genes was also studied. The RGE of three genes (SlDML728, SlDML729 and SlDML325) were determined by real-time RT-PCR in stolbur C- and stolbur PO-infected plants as compared to healthy ones (Table 3). The results showed that expression of all three genes was down-regulated in stolbur PO-infected tissues, especially in leaves, where the RGE ranged from 0·06 for SlDML729 to 0·17 for SlDML325. In the flower buds, lower RGE values were obtained in the 3- and 5-mm flower buds. In the case of SlDML325, no significant variation was detected in 1-mm flower buds. In contrast, expression of the demethylase genes was generally up-regulated in stolbur C-infected plants, with the highest RGE being reached in the 1-mm flower buds.

Altogether, these results clearly show that stolbur phytoplasma infection is associated with down-regulation of genes involved in DNA methylation and that up-regulation or down-regulation of gene expression is dependent on the phytoplasma isolate, C or PO.

DNA methylation status of repeated DNA sequences in healthy and stolbur phytoplasma-infected tomatoes

To further investigate the effect of stolbur phytoplasma-infection on host-plant DNA methylation, the methylation status of repetitive DNA in flower buds and leaves of healthy, stolbur C- and PO-infected tomato plants was compared (Fig. 4c). The results showed that the 5S rDNA region was highly resistant to digestion by HpaII, indicating a high level of methylation, irrespective of the infection status. When digested by MspI, DNA samples from healthy, stolbur C- and stolbur PO-infected buds all yielded identical ladder profiles, indicating that the methylation level and pattern at this locus were not significantly changed after stolbur C or PO infection. Similar data were obtained when DNA was extracted from leaves (data not shown).

Figure 4.

 Panel a: scheme of SlDEF gene organization; A and B are the two GATC sites. Panel b: MSRE-PCR performed on DNA extracted from healthy (H), or stolbur phytoplasma isolate C- or PO-infected tomato flower buds; primers are situated on both sides of the MboI/Sau3AI site in the second exon (A); amplification was performed on DNA digested by MboI or Sau3AI; control is non-digested DNA (Non-dig). Panel c: Southern blot showing CCGG methylation at repeated loci in 1-mm flower buds from healthy (H), or stolbur C- or PO-infected tomatoes; DNA was digested by MspI or HpaII; hybridization was done with a 5S rDNA probe. Panel d: Histogram showing percentage of methylated cytosine in SlDEF promoter sequence in healthy or stolbur PO-infected tomato 3-mm flower buds.

SlDEF methylation status in healthy and stolbur PO-infected tomatoes

Methylation status of the SlDEF regulatory region was first examined using MSRE-PCR with two CGATC sites as the targets, one being located in exon 2 and the other in intron 2 at the N-terminal part of SlDEF (Fig. 4a). DNA from healthy, stolbur C- and stolbur PO-infected flower buds was digested with MboI and Sau3AI prior to PCR amplification with primer pairs Fme2-Rme2 and Fme3-Rme3 flanking the CGATC restriction sites A (Fig. 4b) and B (not shown), respectively. When digested by Sau3AI, all three DNA samples yielded relatively low amounts of amplification products as compared to undigested DNAs, indicating that only a small fraction of the CGATC sites were methylated and hence resistant to Sau3AI digestion. When DNAs were digested by MboI (control), the amplification products were not or poorly detected, depending on the presence or absence of residual undigested DNA. Interestingly, in most cases (four out of six repetitions), Sau3AI-digested DNA from stolbur PO-infected flower buds was more efficiently amplified than that from healthy and stolbur C-infected samples, suggesting an increase in the methylation status (Fig. 4b).

To further investigate the SlDEF methylation status, parts of the regulatory region surrounding the TATA box and the 5′ end of the coding sequence were analysed. DNAs from flower buds of healthy, stolbur C- and stolbur PO-infected tomatoes were submitted to bisulphite treatment, which converts unmethylated cytosines to uracyl, while methylated cytosines remain unchanged. The treated DNAs were then PCR-amplified and the products cloned and sequenced. The two PCR products encompassed a region starting 650 bp upstream and finishing 504 bp downstream of the ATG start codon. For the first region (comprising the CAAT and the TATA boxes), 51 clones from healthy and 46 from stolbur PO-infected flower buds from three distinct sets of plants were sequenced. For the second region, six clones from healthy and 10 from stolbur PO-infected flower buds were analysed.

The percentages of methylated cytosine residues at each cytosine position of the TATA box region for both healthy (black) and stolbur PO-infected (grey) flower buds are presented in Figure 4d. The figure clearly shows that methylated cytosines were not randomly distributed but instead grouped within two regions with very frequently methylated positions (positions 494 and 534; and 613, 622, 648, 650, 652, 667, 672, 675, 677 and 679). However, although significant variations in cytosine methylation level in the stolbur PO-infected material (compared with healthy material) were detected at several positions (for example, 534 and 613), some of these variations proved to be inconsistent from one experiment to the other. As an example, the percentage of methylated cytosine residues at position 534 was found to decrease in this experiment, but to increase in another one (not shown). On the contrary, similar methylation patterns of SlDEF were obtained in both experiments in the case of healthy flower buds.

Discussion

The tomato floral gene SlDEF (or TAP3) is an orthologue of AtAPETALA3, a MADS box transcription factor required for specifying petal and stamen identities (Mazzucato et al., 2008). Consistent with this role, it was shown previously that floral abnormalities in stolbur PO-infected tomatoes (aborted petals and stamens) are associated with strong down-regulation of SlDEF (Pracros et al., 2006). In the present study, comparing two distinct isolates C and PO of the stolbur phytoplasma revealed that, in spite of similar multiplication rates, they induce clearly distinguishable symptoms. Stolbur C-infected plants showed small (chlorotic) leaves and developed nearly normal flowers. Although of a slightly reduced size, these flowers possessed typical reproductive organs. By contrast, stolbur PO-infected plants exhibited leaves of regular size curling outwards, and flowers with abnormal phenotypes, including sepal hypertrophy and aborted petals and stamens. Interestingly, the results showed these phenotypes to be associated with down-regulation of SlDEF. Indeed, whereas expression of SlDEF was specifically down-regulated in the flower buds of stolbur PO-infected plants, expression in stolbur C-infected buds was identical to that in healthy ones. These data are consistent with previous studies showing a strong down-regulation of SlDEF in stolbur PO-infected buds of tomato cv. Micro-Tom (Pracros et al., 2006). The finding that stolbur PO- but not stolbur C-infection was associated with down-regulation of SlDEF reinforces the hypothesis of a direct correlation between the expression level of SlDEF and flower malformations such as the petal and stamen abortion observed in stolbur PO-infected plants. In addition, these results suggest that the two isolates of the stolbur phytoplasma, C and PO, might have evolved distinct pathogenicity mechanisms.

In ‘Candidatus Phytoplasma asteris’ several secreted proteins have proved to be pathogenicity effectors (Bai et al., 2009; Hoshi et al., 2009; Sugio et al., 2011). Among these, protein SAP11 of ‘Ca. Phytoplasma asteris’ strain AY-WB targets the host plant nuclei and destabilizes plant CIN-TCP transcription factors, causing morphological changes as well as decreased synthesis of jasmonic acid (JA), a phytohormone involved in the plant defence response (Sugio et al., 2011). When expressed in transgenic arabidopsis plants, two other secreted proteins, SAP54 from ‘Ca. Phytoplasma asteris’ strain AY-WB and TENGU from strain OY-M, were shown to induce a variety of morphological alterations, such as branching and phyllody, similar to those exhibited by the phytoplasma-infected plants (Hoshi et al., 2009; MacLean et al., 2011). Expression of TENGU, in particular, was associated with down-regulation of auxin-responsive genes. Whereas strains OY-M and AY-WB both possess the tengu gene, sap11 is present in the AY-WB genome only. Therefore, it is conceivable that, in the case of the stolbur phytoplasma, stolbur C and PO isolates could have distinct sets of virulence factors, leading to the different symptoms exhibited by the infected plants. The high variability of genome sizes among the various stolbur phytoplasma isolates (Marcone et al., 1999) is consistent with this view.

Many cases of floral abnormalities caused by phytoplasma infection have been reported. Changes in the transcription level of floral development genes have been described, first in the case of stolbur phytoplasma-infected tomatoes (Pracros et al., 2006), and then in various host plant–phytoplasma systems including Hydrangea spp./Japanese hydrangea phyllody phytoplasma (JHP) (Kitamura et al., 2009), Petunia hybrida/‘Ca. Phytoplasma asteris’ OY-W (Himeno et al., 2011) and Catharanthus roseus infected by periwinkle leaf yellowing (PLY) and peanut witches’-broom (PnWB) phytoplasmas (Su et al., 2011).

In hydrangea, JHP infection induces the homeotic conversion of sepals and/or pistils to leaves (phyllody) and triggers changes (increases or decreases) in the number of decorative florets depending on cultivar (lacecap or hortensia), as well as the formation of bracts on pedicels (Kitamura et al., 2010). These structural changes in floral organs of JHP-infected plants have been associated with down-regulation of class B and C floral development genes (Kitamura et al., 2009). Similar down-regulation of class B (CrDEF1, CrGLO1) and C (CrAG1) genes was also detected in PnWB phytoplasma-infected periwinkle (Su et al., 2011) and in ‘Ca. Phytoplasma asteris’ OY-W-infected petunia (Himeno et al., 2011). In this latter case, however, down-regulation was mostly detected in sepals where the expression of all four genes tested (PhGLO1, PhGLO2, PhDEF and PhTM6) was repressed. Indeed, no such down-regulation was detected in stamens, which displayed regular morphology despite their reduced size. In addition, the floral meristem identity gene ALF (orthologue of AtLEAFY) was also strongly down-regulated, suggesting that, in this case, phytoplasma infection interfered with early stages of flower development (Himeno et al., 2011). In this case, down-regulation of class B and C genes could be seen as the consequences of reduced expression of ALF, a meristem identity gene which plays a central role in the regulatory cascade of flower development (Kaufmann et al., 2005b).

In stolbur PO-infected tomato flowers which also displayed phyllody and virescence phenotypes, it was found that the SlDEF (or TAP3) orthologue of the hydrangea HmAP3 and the petunia PhDEF was down-regulated at stage 3 of floral development (Pracros et al., 2006; this study). However, in contrast to the situation in ‘Ca. Phytoplasma asteris’ OY-W-infected petunia, the meristem identity gene SlFA (orthologue of AtLEAFY) was not repressed but instead slightly up-regulated, suggesting that expression of SlDEF could be regulated through a SlFA-independent mechanism.

In plants, control of gene expression and genome stability is achieved by maintaining cytosine methylation at CG and non-CG residues. Recent evidence indicates that epigenetic mechanisms such as DNA methylation and histone modifications play critical roles in regulating gene expression in response to environmental stress (Choi & Sano, 2007; Boyko & Kovalchuk, 2008; Law & Jacobsen, 2010).

In tobacco, for example, a close correlation with a cause–effect relationship has been established between methylation and expression of NtGPDL upon abiotic stresses. As DNA methylation is linked to histone modification, it has been proposed that demethylation at coding regions might induce alteration of chromatin structure, thereby enhancing transcription (Choi & Sano, 2007). In maize, transcription of the ZmMI1 gene (encoding part of a putative protein and part of a retrotransposon-like element) under a 4–8°C chilling treatment was associated with hypomethylation at both CpG and CpNpG sites (Steward et al., 2002). In tobacco cell culture, changes in heterochromatin CpNpG methylation occurred in response to osmotic stress. Likewise, environmental stimuli such as aluminum, heavy metals and water stress induce variations of the cytosine methylation patterns throughout the genome as well as at specific loci (Lukens & Zhan, 2007; Wang et al., 2010).

Changes of methylation pattern also occur in response to biotic stress. An active demethylation mechanism has been suggested in arabidopsis infected by Pseudomonas syringae pv. tomato and in TMV-infected tobacco (Wada et al., 2004; Pavet et al., 2006).

Besides biotic and abiotic stresses, DNA demethylation is also involved in regulating flower development genes. In oil palms showing flower abnormalities, called the mantled phenotype (Rival et al., 2000), analyses of leaf genomic DNA revealed substantial demethylation in severely diseased palms, raising the possibility of impairment of DNA-methyltransferase activity (Jaligot et al., 2011).

In the current study, results suggested that stolbur PO-infection might be associated with changes in the methylation status of the SlDEF regulatory region, leading to down-regulation of gene expression. However, the spatial distribution of these modifications, as assessed by bisulphite sequencing, could not be clearly established under the experimental conditions. Although the overall methylation patterns were conserved between two distinct experiments, the percentages of methylation at specific sites varied significantly for both healthy and infected samples. Such discrepancies between experiments may result from the difficulty of strictly controlling the plant environment and the phytoplasma infection process. Interestingly, however, it was shown that global DNA hypomethylation through Aza-C treatment restored the expression of SlDEF in flower buds along with the ability of stolbur-infected plants to produce normal flowers (i.e. with no aborted organs). Despite a limited number of normal flower buds, the results clearly showed that Aza-C treatment did interfere with the plant response to stolbur phytoplasma infection and partially counteracted the down-regulation of floral development.

In stolbur phytoplasma-infected tomatoes, the connection of SlDEF down-regulation to the methylation/demethylation process was further reinforced by the finding that expression of DNA methyltransferase and demethyltransferase genes was differentially regulated in stolbur PO- and stolbur C-infected plants. Indeed, whereas the expression of DNA methyltransferase genes SlMET1 and SlDRM5 was unchanged, expression of the chromomethylase genes SlCMT2–4 was severely repressed both in flower buds and leaves of stolbur PO- but not stolbur C-infected plants. Demethylase genes DML729, 728 and 325 also were down-regulated in stolbur PO- but not in stolbur C-infected tomatoes, suggesting that the two phytoplasma isolates, C and PO, may target distinct plant genes.

According to the regulatory cascade of flower development in arabidopsis (Theissen, 2001; Kaufmann et al., 2005a,b) the meristem identity gene AtLFY positively controls the class B organ identity gene AtAP3. In stolbur PO-infected tomatoes, the current studies showed that SlFA (or SlLFY) was up-regulated, whereas SlDEF (or SlAP3) was down-regulated, along with down-regulation of demethylase genes. From these results it can be hypothesized that stolbur PO infection, by blocking the expression of demethylases in flower buds, would prevent demethylation and thereby expression of SlDEF, resulting in flower abnormalities such as aborted petals and stamens. The finding that the demethylase genes and SlDEF were not repressed in stolbur C-infected tomatoes with normal flowers add support to this hypothesis.

Acknowledgements

Jam Nazeer Ahmad was in receipt of a grant from HEC by SFERE (Pakistan). This work was financially supported by INRA (SPE project and IFR103 project). We thank Kaëlig Guionneaud and Denis Lacaze for growing and grafting plants.

Ancillary