Inverse effects of Arabidopsis NPR1 gene on fusarium seedling blight and fusarium head blight in transgenic wheat

Authors


E-mail: yucailiao@mail.hzau.edu.cn

Abstract

In this study, the Arabidopsis thaliana NPR1 (non-expressor of PR genes) gene was integrated into an elite wheat cultivar, and the response of the transgenic wheat expressing NPR1 to inoculation with Fusarium asiaticum was analysed. With seedling inoculation, the transgenic lines showed significantly increased fusarium seedling blight (FSB) susceptibility, whereas floret inoculation resulted in enhanced fusarium head blight (FHB) resistance. Quantitative real-time PCR revealed that expression of two defence genes, PR3 and PR5, was associated with susceptible reactions to FSB and FHB, whereas the PR1 gene was activated in resistance responses. This inverse modulation by the constitutively expressed NPR1 gene suggests that NPR1 has a bifunctional role in regulating defence responses in plants. Therefore, it is unsuitable for improving overall resistance to FSB and FHB in wheat.

Introduction

Fusarium seedling blight (FSB) and fusarium head blight (FHB), caused by Fusarium spp., are economically important diseases of wheat and other small-grain cereal crops worldwide (Bai & Shaner, 2004; Li et al., 2010b). FSB in wheat occurs at germination and throughout the succeeding seedling development, and it provides a pathogen source for subsequent FHB infections, resulting in reddish and scabby spikes. Both FSB and FHB produce Fusarium mycotoxins, which are toxic to human and animal health. The same species from the Fusarium graminearum clade or Fusarium culmorum are capable of causing FSB and FHB in wheat (Simpson et al., 2004; Wu et al., 2005). Epidemics of FSB and FHB frequently occur in the middle and lower regions of the Yangtze River, and in Heilongjiang Province in northeastern China (Qu et al., 2008). FHB in wheat and barley has re-emerged as a serious threat to agriculture in Europe and North America since the mid-1990s (Bai & Shaner, 2004), resulting in huge losses.

The most effective control strategy for fungal diseases is the prevention of infection in the field and during storage by endogenous expression of resistance genes. However, innately FSB- and FHB-resistant germplasm is inadequate in nature, and it is a challenge to develop resistant wheat varieties with suitable agronomic traits (Dahleen et al., 2001). Current protective measures rely heavily on fungicides, generating undesirable environmental consequences and fungicide-resistant Fusarium isolates (Chen & Zhou, 2009). Therefore, it is necessary to protect plants against Fusarium pathogens and reduce mycotoxin production by introducing alien resistance genes into the wheat genome by transgenic approaches (Okubara et al., 2002; Anand et al., 2003; Peschen et al., 2004; Makandar et al., 2006; Hu et al., 2008; Li et al., 2008; Di et al., 2010).

The NPR1 (non-expressor of PR genes) gene codes for a key regulator involved in systemic acquired resistance (SAR) in Arabidopsis thaliana (Cao et al., 1997; Dong, 2004). Overexpression of NPR1 in A. thaliana results in enhanced resistance to bacterial and oomycete pathogens (Cao et al., 1998). Heterologous expression of NPR1 enhances disease resistance in various plants, including rice, tomato, cotton, carrot and citrus (Parkhi et al., 2010; Zhang et al., 2010). However, the expression of NPR1 in rice exerts negative effects in terms of viral infections and abiotic stress, whereas resistance against fungal and bacterial pathogens is improved (Quilis et al., 2008). Although NPR1 confers improved FHB resistance in transgenic wheat cv. Bobwhite (Makandar et al., 2006), little is known about the response of transgenic wheat plants expressing NPR1 to FSB.

In the present study, the NPR1 gene from A. thaliana was constitutively expressed in an elite wheat cultivar because no NPR1 gene homologue from wheat has been published. The responses of the transgenic lines to FSB and FHB were monitored through different generations and quantitative real-time polymerase chain reaction (PCR) analyses were used to investigate the association of defence-related genes with susceptibility to FSB and FHB. The findings and their implications for the use of NPR1 in resistance breeding are discussed.

Materials and methods

Plant and fungus materials

An elite hexaploid wheat cultivar, Yangmai 11 (Y11), which is grown widely in the middle and lower regions of the Yangtze River, was used for transformation. Fusarium asiaticum 5035 was isolated from a scabby wheat spike in Wuhan (Zhang et al., 2007) and used for inoculation throughout this study. An FSB-resistant wheat cultivar, Annong 8455, and an FSB-susceptible wheat cultivar, Sumai 3, were used as controls. Arabidopsis thaliana ecotype Columbia was used for mRNA extraction in order to clone the NPR1 coding sequence.

Plasmids

Table 1 shows the primers, NPR1P1 and NPR1P2, used to clone the coding sequence of the A. thaliana NPR1 gene. cDNA was reverse-transcribed from mRNA extracted from leaves of A. thaliana ecotype Columbia, which had a sequence identical to that reported by Cao et al. (1997). The 1792-bp fragment of the NPR1 gene was obtained by digestion with endonucleases SmaI and SacI (Takara), and was then ligated into a pMBL-PMI vector (Zhang et al., 2006) pre-cut by SmaI and SacI. The resulting vector, carrying a phosphomannose isomerase (PMI) gene derived from Escherichia coli DH5α for selection in the presence of mannose, was named pBML-PMI-NPR1 (Fig. 1a).

Table 1. Primer sequences used for PCR, RT-PCR and qRT-PCR analyses
NameGene descriptionAccession numberSequences (5′–3′)Size (bp)
  1. aPMI gene-specific fragment was generated with the primers UbiF/PmiR.

  2. bBAR gene-specific fragment was generated with the primers UbiF/BarR.

  3. cNPR1 gene-specific fragment was generated with the primers UbiF/NPR1R.

NPR1P1 AtNPR1 NM_105102.2 GATCCCGGGATGGACACCACCATTGATGG1792
NPR1P2ATAAGTGCCTCTGATAGAGAGTAATTAATT
UbiFMaize Ubiquitin1 promoter GTTTCTTTTGTCGATGCTCACCC 
PmiRPhosphomannose isomerase M15380 TCCGGCTTGTGGTTAGGATC448a
BarR BAR  CTGCCAGAAACCCACGTCAT542b
NPR1R AtNPR1 NM_105102.2 CGGCGGTGTTGTTGGAGCTTTCT424c
NPR1-RTF AtNPR1 NM_105102.2 GAGGACACATTGGTTATACTC750
NPR1-RTRCAAGATCGAGCAGCGTCATCTT
ActinFActin AB181991 GCTGTTCCAGCCATCTCATGT156
ActinRCGATCAGCAATTCCAGGAAAC
PR1F PR1.2,
basic PR-1 proteins
AJ007349 CGTCTTCATCACCTGCAACTA144
PR1RCAAACATAAACACACGCACGTA
PR2Fβ-1,3-glucanases AF112965 CCGCACAAGACACCTCAAGATA167
PR2RCGATGCCCTTGGTTTGGTAGA
PR3FClass-VII acidic chitinases AF112963 CAGGAAAATCAACAGTGGCGA139
PR3RGCGTCGATCAAGAATCTAGCAA
PR4FPathogenisis-related protein AJ006098 CGAGGATCGTGGACCAGTG128
PR4RGTCGACGAACTGGTAGTTGACG
PR5FThaumatin-like protein AF442967 ACAGCTACGCCAAGGACGAC91
PR5RCGCGTCCTAATCTAAGGGCAG
PR6FProteinase inhibitor related protein DR752088 TTCAGGGCTTCAGGCTCAG141
PR6RATTGACCAAGACACGACGATAG
TaPEROFPeroxidase precursor X56011 ACAACGACACCACCGACAACA168
TaPERORCGTCTATCAATCACGAGTTCACC
Figure 1.

 (a) Structure of vectors pBML-PMI-NPR1 (above) and pAHC25-NPR1 (below) used for transformation, integration and expression of Arabidopsis thaliana NPR1 gene in transgenic wheat. Ubi-P, maize ubiquitin1 promoter; PMI, phosphate isomerase gene; BAR, BAR gene. (b) PCR products amplified with DNA isolated from the leaves of transgenic wheat lines R2 and L9 (NPR1, T2), and non-transgenic wheat cv. Yangmai 11 (Y11) by primers UbiF/NPR1R (NPR1), UbiF/PmiR (PMI) and UbiF/BarR (BAR). (c) RT-PCR products amplified with RNA extracted from the leaves of plants in (b) by primers NPR1-RTF/NPR1-RTR (NPR1). Expression of actin gene served as a control. (d) DNA extracted from the leaves of T3 transgenic lines R2 and L9, and the non-transgenic Yangmai 11, digested with SacI, resolved on an agarose gel, transferred to a nylon membrane and probed with a NPR1 gene probe. Positions of molecular weight markers (in kilobases) are indicated on the right.

In order to clone NPR1 into a vector for bialaphos/phosphinothricin (PPT) selection, the NPR1 sequence was digested with SmaI and SacI, then inserted into the vector pAHC25 (Christensen & Quail, 1996) containing a BAR gene (Fig. 1a).

Transformation and tissue culture

Wheat cv. Yangmai 11 was grown in an experimental field in Wuhan, Hubei, China. Spikes were tagged at anthesis, and immature caryopses were isolated as explants at 14–16 days post-anthesis (DPA). Transformation and selection of transgenic calli were carried out in the presence of mannose essentially as previously described (Wright et al., 2001). Selection of transgenic calli was performed in the presence of bialaphos/PPT as previously described (Li et al., 2008). Embryos were isolated from the seeds and then placed with the embryo scutellum-side-up onto callus-induction medium containing MS medium supplemented with 2 mg L−1 2,4-D. Calli were subcultured for 5 days and used for transformation by biolistic particle bombardment (Wright et al., 2001; Li et al., 2008). Subsequent culture, selection and growth were carried out as previously described (Wright et al., 2001; Li et al., 2008).

DNA and RNA extraction

Genomic DNA was extracted from young leaves of wheat (Li et al., 2008). Total RNA was extracted from leaves using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. In order to minimize the genomic DNA contamination, purified RNA was treated by RNase-free DNase I (Takara) before the final ethanol precipitation.

Reverse-transcription PCR (RT-PCR) and quantitative real-time PCR analyses

A primer pair of UbiF and PmiR (Table 1) was used for PCR analysis of transgenic plants, by which a 448-bp DNA segment, spanning the ubiquitin promoter and PMI sequence, was amplified. A 542-bp DNA fragment, spanning the sequences of the ubiquitin promoter and BAR gene, was amplified with the primers UbiF and BarR. A 424-bp NPR1-specific product was amplified using primers UbiF and NPR1R (Table 1) designed according to the sequences of the A. thaliana NPR1 and ubiquitin promoter. Subsequently, amplicons were separated on 1·2% agarose gels.

For RT-PCR analyses of transgenes, 5 μg total RNA purified from wheat leaves was reverse-transcribed into cDNA with reverse transcriptase (Takara) and an oligo-dT20 primer (Sangon). The NPR1 gene was amplified from transgenic wheat using the primers NPR1-RTF/NPR1-RTR (Table 1) with a thermal cycling instrument (MyCycler; Bio-Rad). Briefly, the amplification was carried out with 30 cycles at a melting temperature of 94°C for 1 min, an annealing temperature of 60°C for 1 min and an extension temperature of 72°C for 1 min.

For quantitative real-time PCR (qRT-PCR), total RNA was extracted from wheat spikes and seedlings at 12, 24, 48, 72 and 96 h post-inoculation (hpi). Subsequently, 5 μg total RNA was reverse-transcribed into cDNA. qRT-PCR was performed in a 25-μL reaction system containing Sybr Green I PCR Master Mix (Toyobo), 10 pmol each of the forward and reverse gene-specific primers (Table 1) and 10 μL diluted cDNA (1:100). Gene-specific primers (Table 1) were designed using primer premier5 software (Premier Biosoft International). The wheat actin gene was selected as an internal control, and it was co-amplified to normalize the total amount of cDNA present in each reaction. PCR amplification was performed in an iQ5 Cycler (Bio-Rad) according to the manufacturer’s instructions. Briefly, following a denaturation step at 95°C for 4 min, the amplification was carried out with 40 cycles at a melting temperature of 94°C for 15 s, an annealing temperature of 62°C for 20 s and an extension temperature of 72°C for 20 s. The plate read was at 72°C for 30 s. A melting curve was performed to determine the specificity of each PCR primer by maintaining the reaction at 95°C for 20 s, cooling to 55°C for 10 s and heating to 95°C at a rate of 0·5°C per 10 s. The qRT-PCR experiments were performed in triplicate.

Southern blot analysis

A total of 15 μg DNA from each sample were digested with 60 U restriction enzyme SacI (Takara) overnight, and digested DNA was electrophoresed on 0·8% agarose gels. DNA fragments were transferred onto a nylon membrane (Hybond-N+; Amersham) and then hybridized with α-[32P]-dCTP-labelled DNA fragments, which were derived from the coding sequence of NPR1 as described (Li et al., 2008). Autoradiography was conducted using a Fujifilm imaging plate and cassette, and analysed with a Fuji BAS1800-II system (BAS1800-II; Fujifilm).

FSB and FHB resistance assay

For seedling inoculation, the macroconidial suspension of F. asiaticum strain 5035 (Zhang et al., 2007) was adjusted to a concentration of 5 × 105 spores mL−1 using water. Wheat seeds were sterilized with 0·1% HgCl2 for 1 min and washed twice with sterile distilled water. After incubation on moist filter papers at 20°C for 3 days, the top 2–3 mm of coleoptiles were cut off, and the tip-cut apices were covered with a piece of filter paper (1 cm2) soaked in conidial suspension (Wu et al., 2005; Li et al., 2010b). For each genotype, 60 coleoptiles were inoculated. The fungus-inoculated coleoptiles were cultured in a growth chamber at 25°C with 95% relative humidity and 12 h fluorescent light per 24 h. The brown lesions of diseased stems were measured at 7 days post-inoculation (dpi). Water was used in mock-inoculated coleoptiles.

For single-floret inoculation, a macroconidial suspension of F. asiaticum strain 5035 was used at the same concentration. At anthesis, a single central floret of the spikelet on each spike was inoculated with 10 μL macroconidial suspension, and a total of 60 spikes per line were inoculated. The fungus-inoculated plants were bagged in plastic and kept humid for 3 days. The fungal spreading rate was evaluated for type II disease reaction at 21 dpi (Li et al., 2008). Mock-inoculations were carried out as described above.

Statistical analysis

Student’s t-test was used to reveal significant differences in plant resistance to FSB and FHB between the NPR1 transgenic line and non-transgenic control Yangmai 11 using sas software v. 8.1 (SAS Institute).

Results

Transformation and characterization of transgenic wheat plants

In this study, immature embryos from an elite wheat cultivar, Yangmai 11, were cultured to induce calli, which were bombarded with vector pMBL-PMI-NPR1 and vector pAHC25-NPR1. Transgenic calli were selected on media supplemented with either mannose or PPT.

The positive T0 transgenic plantlets and succeeding generations were identified by PCR and RT-PCR techniques. A PMI gene-specific fragment was amplified using the primers UbiF/PmiR, whereas a BAR gene-specific fragment was amplified using the primers UbiF/BarR (Fig. 1b). An NPR1 gene-specific fragment was amplified using the primers UbiF/NPR1R (Fig. 1b). RT-PCR analyses confirmed the presence of NPR1 transcripts in the transgenic lines using the primers NPR1-RTF/NPR1-RTR (Fig. 1c). Two transgenic lines (R2 and L9), expressing NPR1, were normal in terms of morphology and agronomical traits compared to the non-transgenic Yangmai 11, and were selected for further characterization. R2 carried a PMI selection marker, whilst L9 contained a BAR gene in addition to the NPR1 gene (Fig. 1b).

Southern blot analyses confirmed that the NPR1 gene was integrated into the wheat genome, suggesting the presence of three and five copies in R2 and L9 transgenic lines (Fig. 1d), respectively.

FSB susceptibility in transgenic wheat

The response of two transgenic lines to FSB was evaluated by seedling inoculation using macroconidia of F. asiaticum strain 5035. Homozygous transgenic lines were selected for the FSB and FHB assays. Non-transgenic Yangmai 11, FSB-resistant cv. Annong 8455 and FSB-susceptible cv. Sumai 3 served as controls (Table 2). The two transgenic lines demonstrated a high susceptibility compared with the non-transgenic controls (Table 2). The lesion length of the transgenic line R2 from the T2 to T4 generations was 1·0, 1·10 and 1·01 cm, respectively. In contrast, the lesion length of the non-transgenic control Yangmai 11 (CK1, Y11) used for the T2, T3 and T4 generations was 0·31, 0·34 and 0·36 cm, respectively (Table 2; Fig. 2a), and thus the transgenic line R2 showed 2·23-, 2·24- and 1·81-fold increases in disease severity compared with the non-transgenic control Yangmai 11. Similarly, lesion length of the transgenic line L9 in the T2 and T3 generations was 0·94 and 0·96 cm, respectively, showing increased disease severity of 2·03- and 1·82-fold compared with the non-transgenic Yangmai 11. These results indicated that NPR1 mediated a stably enhanced susceptibility to FSB at seedling stages in transgenic wheat lines.

Table 2. Fusarium seedling blight (FSB) and fusarium head blight (FHB) resistance in T2 to T4 generations of transgenic wheat (lines R2 and L9), compared with non-transgenic controls
GenotypeFSBFHB
Lesion length (cm)Infected spikelets (%)
T2T3T4T2T3T4
  1. –: not determined.

  2. Values followed by different letters within a generation are significantly different (< 0·01).

  3. xCK1, non-transgenic control cv. Yangmai 11 (Y11).

  4. yCK2, FSB-resistant control cv. Annong 8455 (An).

  5. zCK3, FSB-susceptible control cv. Sumai 3 (S3).

R21·00 ± 0·08 a1·10 ± 0·08 a1·01 ± 0·07 a5·89 ± 0·09 b6·31 ± 0·08 b6·09 ± 1·14 b
L90·94 ± 0·08 a0·96 ± 0·06 a6·65 ± 1·63 b6·70 ± 2·28 b
CK1 (Y11)x0·31 ± 0·08 b0·34 ± 0·09 b0·36 ± 0·08 b19·33 ± 1·55 a19·82 ± 4·39 a21·31 ± 3·22 a
CK2 (An)y1·06 ± 0·081·15 ± 0·091·12 ± 0·1042·31 ± 13·8139·63 ± 6·1039·96 ± 6·79
CK3 (S3)z2·20 ± 0·112·32 ± 0·102·42 ± 0·137·40 ± 0·736·77 ± 0·387·08 ± 2·97
Figure 2.

 Disease symptoms of the T4 transgenic wheat line R2 (NPR1) and non-transgenic wheat cv. Yangmai 11 (Y11) after inoculation with Fusarium asiaticum. (a) Seedlings at 7 days post-inoculation (dpi); (b) spikes at 21 dpi of a single floret.

FHB resistance in transgenic wheat

In order to further investigate the response of the transgenic lines to FHB, the two transgenic lines assayed above were also subjected to single-floret inoculation using the same pathogen. The percentage of infected spikelets from the T2 to T4 generations in the transgenic line R2 was 5·89%, 6·31% and 6·09%, respectively, at 21 dpi (Table 2). In contrast, the percentage of infected spikelets in the non-transgenic control Yangmai 11 (CK1, Y11) for the T2, T3 and T4 generations was 19·33%, 19·82% and 21·31%, respectively, under the same conditions (Table 2; Fig. 2b), i.e. the transgenic line showed significant reductions of 69·53%, 68·16% and 71·42% in the three respective generations. Transgenic line L9 had 6·65% and 6·7% infected spikelets at 21 dpi in the T2 and T3 generations, respectively, demonstrating disease reductions of 65·60% and 66·20%, respectively, compared with the non-transgenic control Yangmai 11. These results indicated that the NPR1 gene conferred FHB resistance in spikes in the transgenic wheat.

Association of wheat susceptibility with activation of PR3 and PR5 genes

qRT-PCR was performed to analyse the T5 plants from transgenic line R2 after seedling inoculation and T4 plants of the same line after floret inoculation. The results indicated that two defence-related genes, PR3 and PR5, were highly activated in wheat plants that were susceptible to FSB and FHB after inoculation with Fusarium pathogens. For instance, the expression of PR3 and PR5 was significantly increased in the FSB-susceptible transgenic line R2 at 24 hpi (Fig. 3a,c), up to 3·7- and 27·9-fold, respectively, compared with the non-transgenic control Yangmai 11 resistant to FSB. The expression of PR3 in the non-transgenic Yangmai 11 susceptible to FHB was 2·3- and 2·6-fold that of the transgenic line R2 at 48 and 72 hpi, respectively (Fig. 3b). Furthermore, the expression of PR5 in the non-transgenic cv. Yangmai 11 susceptible to FHB was 3·2-fold at 72 hpi compared with that in the transgenic line R2 (Fig. 3d). Moreover, the expression of NPR1 was comparable in Fusarium-inoculated and mock-inoculated controls in the transgenic line (data not shown). Therefore, these two genes displayed a susceptibility-associated expression pattern in wheat.

Figure 3.

 Quantitative real-time PCR analyses of the PR3 (a, b) and PR5 (c, d) genes in the transgenic wheat line R2 and non-transgenic Yangmai 11 (Y11) after inoculation with Fusarium asiaticum. Amounts of gene transcripts were calculated relative to mock inoculations.

Association of wheat resistance with activation of a PR1 gene

Expression of another defence-related gene, PR1, was associated with the resistance response to Fusarium pathogens. There was a significant induction of up to 8·6-fold PR1 transcripts in the non-transgenic Yangmai 11 at 72 hpi compared with the transgenic line R2 (Fig. 4a). Furthermore, the expression of this PR1 gene was highly activated in the transgenic line R2. There was a 5·2-fold up-regulation in the transgenic line R2 at 96 hpi compared with the non-transgenic control Yangmai 11 (Fig. 4b). Therefore, the activation of PR1 was associated with the resistance response to FSB and FHB in wheat.

Figure 4.

 Quantitative real-time PCR analyses of the PR1 gene in the transgenic wheat line R2 and non-transgenic wheat cv. Yangmai 11 (Y11) after inoculation with Fusarium asiaticum. Amounts of gene transcripts were calculated relative to mock inoculations.

Induction of wheat defence-related gene expression in seedlings and spikes in response to FHB pathogen

The data showed that the expression of a set of genes was relatively stable at the two stages in two wheat genotypes after inoculation with FHB pathogens. For instance, PR4 expression was profoundly activated at 72 hpi in both the transgenic line R2 and non-transgenic Yangmai 11 at the seedling and spike stages (Fig. 5c,d). The expression of PR2 (Fig. 5a,b) and PR6 (Fig. 5e,f) was sometimes slightly induced at 48 hpi or 72 hpi at the seedling and spike stages. The TaPERO gene encodes a peroxidase that has been implicated in the production of reactive oxygen species, especially H2O2 (Passardi et al., 2004). TaPERO expression was clearly induced at 72 hpi with comparable abundances in the spikes of both the transgenic line R2 and non-transgenic Yangmai 11, while a 38-fold up-regulation was observed at 72 hpi in the seedlings of transgenic line R2 compared with those of non-transgenic Yangmai 11 (Fig. 5g,h).

Figure 5.

 Quantitative real-time PCR analyses of defence-related gene transcripts with comparable accumulation patterns in seedlings and spikes of the transgenic wheat line R2 and non-transgenic Yangmai 11 (Y11) after inoculation with Fusarium asiaticum. Amounts of gene transcripts were calculated relative to mock inoculations. (a, b) PR2 gene; (c, d) PR4 gene; (e, f) PR6 gene; (g, h) TaPERO gene.

Discussion

The NPR1 gene from A. thaliana increased the susceptibility to FSB at seedling stages in the transgenic wheat lines. On the other hand, this gene enhanced FHB resistance at spike stages of the same transgenic lines when challenged with the same pathogen. These inverse responses of one genotype were associated with the activation of a set of genes involved in plant defence. These results suggest that the NPR1 gene plays both positive and negative roles in wheat in response to FHB pathogens.

NPR1 is a key transcription factor and important for regulating defences in plants, and it has been shown to confer enhanced disease resistance, including FHB resistance, in different plants (Cao et al., 1998; Makandar et al., 2006; Parkhi et al., 2010; Zhang et al., 2010). No NPR1 orthologue gene from wheat has been published. In order to evaluate the response of the transgenic wheat lines to FSB, the initial objective was to ascertain whether the A. thaliana NPR1 gene could improve FSB resistance in wheat. Unfortunately, the transgenic wheat lines showed a typical susceptible response to FSB although they displayed FHB resistance compared with the non-transgenic control. The susceptibility to FSB and resistance to FHB in the same transgenic wheat lines (Table 2; Fig. 2a,b) revealed an inverse resistance modulated by NPR1, reminiscent of resistance inversion between FSB and FHB in wheat cvs Sumai 3, Wangshuibai and Fanshanxiaomai (Wu et al., 2005; Li et al., 2010b). Plant resistance/susceptibility phenotype is the result of the intimate interaction between pathogen and host, accompanied by the activation of distinct defence genes in hosts in response to challenge with pathogens. In order to investigate the molecular basis underlying the inverse responses to Fusarium pathogens, qRT-PCR analyses of defence genes were performed and showed a preferential activation of PR3 and PR5 genes in a susceptible response, and of a PR1 gene for the resistance reaction in seedlings and spikes. The expression of PR3 and PR5 genes is induced by F. graminearum and Microdochium nivale in wheat (Li et al., 2001; Kuwabara et al., 2002). The expression of PR3 and PR5 was up-regulated in FSB- and FHB- susceptible phenotypes at 48 and 72 hpi, suggesting that these genes were associated with susceptible reactions to FSB and FHB. Fusarium hyphae grew quickly at 24 hpi, and invasion took place at 36 hpi in wheat tissues (Kang et al., 2004). Susceptible responses apparently are characterized by more rapid fungal invasion and greater fungal biomass and mycotoxin production in plant tissues. This may result in more direct confrontation and interaction between fungal hyphae and plant cellular components and signals, which in turn stimulates the activation of some host defence genes, such as PR3 and PR5.

The PR1 gene is induced in wheat upon infection by Blumeria graminis (Molina et al., 1999) and FHB pathogens (Soltanloo et al., 2010). In A. thaliana, NPR1 is essential for regulating the expression of PR genes, including PR1 gene (Dong, 2004). The association of PR1 expression with the resistance phenotype in wheat suggests an important role of PR1 in the resistance response to F. graminearum. The FSB-susceptible transgenic R2 line demonstrated a more rapid induction of PR1 in seedlings at 24 and 48 hpi than the non-transgenic Yangmai 11, suggesting that the constitutive expression of NPR1 induced a quick signal for this defence gene. However, the FSB resistance response induced a massively higher expression of PR1 in the non-transgenic Yangmai 11 at 72 hpi than in the transgenic R2 line. These results implied that the PR1 gene played an important role in the defence response related to resistance to FSB and FHB. Moreover, both wheat seedlings and spikes shared common signal transduction pathways, which activated the defence genes, such as PR1 in response to Fusarium pathogens.

In order to dissect the mechanisms of the resistance inversion, it is necessary to comparatively study it in seedlings and spikes of transgenic wheat lines and in control wheat cv. Sumai 3 germplasm (Wu et al., 2005; Li et al., 2010b). Recent studies showed that different quantitative trait loci (QTL) are attributed to FSB and FHB resistances (Tamburic-Ilincic et al., 2009; Li et al., 2010a). Moreover, Sumai 3 is known to carry a major QTL on chromosome 3BS and other genetic loci for FHB resistance, but may also carry susceptible loci for FSB (Li et al., 2010b). It is conceivable that the relevant genetic loci present in Sumai 3 perceive signals at spike and seedling stages upon Fusarium infection, leading to a resistant or susceptible response. The transgenic wheat lines R2 and L9 constitutively expressed a defence-related transcription factor NPR1 gene. Therefore, a consistent resistance inversion between FSB and FHB might involve some signal transduction pathways similar to that in Sumai 3. It would be interesting to ascertain how the resistance inversion in Sumai 3 and that observed here activated their defence reactions in response to Fusarium pathogens. Further integrated investigation should focus on the regulation for the inverse role played by the NPR1 gene in transgenic wheat and inverse resistance in Sumai 3.

Previous study has suggested that NPR1 has multiple roles in cell growth and response to stress (Vanacker et al., 2001), and it exerts a negative effect in terms of viral infections and abiotic stress, as well as a positive effect on fungal and bacterial resistance (Quilis et al., 2008). An inverse modulation was observed in responses to the same pathogens at different developmental stages in wheat, suggesting that the functionality of NPR1 was dependent on the endogenous molecular signals associated with development in plants. The enhanced FHB resistance observed only at spike stages in the transgenic wheat lines indicated that the alien NPR1 gene regulated adult plant resistance (APR) to Fusarium pathogens. This phenomenon could be similar to that reported in the resistance of rice to bacterial blight (Mew et al., 1981) and of wheat to leaf rust (Barcellos et al., 2000), stripe rust (Yang & Ren, 2001) or powdery mildew (Liu et al., 2001). However, pathogens responsible for FHB and FSB in wheat are very different from obligate fungal pathogens that display high specificity toward their hosts. More research is required to study the regulation and mechanisms of the different responses in seedlings and spikes of wheat after challenge with Fusarium pathogens.

In this study, the data showed that both FSB susceptibility and FHB resistance were increased by the constitutively expressed A. thaliana NPR1 gene in transgenic wheat, with the concomitant activation of respective defence genes associated with the resistance or susceptibility. These results suggest that the NPR1 gene and its homologues are unsuitable for improving the overall resistance to FSB and FHB in wheat and other cereals, especially for regions favourable to FSB disease.

Acknowledgements

This work was supported by the National Basic Research Program of China (2009CB118806), the Ministry of Agriculture of China (2008ZX08002-001, 2009ZX08002-001B) and the Ministry of Education of China (20090146120013). The authors are thankful for a doctorial fellowship from the Chinese Exchange program (to ASIS).

Ancillary