Phylogenetic relationships, pathogenicity and fungicide sensitivity of Greeneria uvicola isolates from Vitis vinifera and Muscadinia rotundifolia grapevines

Authors


E-mail: surensamuelian@yahoo.com

Abstract

Greeneria uvicola causes bitter rot on Vitis vinifera (bunch grapes) and Muscadinia rotundifolia (muscadine grapes) in warm moist temperate and subtropical regions. This study investigated the phylogenetic relationship of G. uvicola representatives from Australia (67 isolates), the USA (31 isolates), India (1 isolate) and Costa Rica (1 isolate) and compared their pathogenicity and fungicide sensitivity. Differences in cultural and conidial morphology were observed between the isolates from Australia and the USA. Phylogenetic relationships were determined based on three gene regions: the ribosomal DNA (rDNA) internal transcribed spacer 1 (ITS1–5∙8S–ITS2), 28S large subunit (LSU) nuclear rDNA and β-tubulin-2. Greeneria uvicola isolates were clearly differentiated into four groups: isolates from Australia and India; USA isolates from V. vinifera; USA isolates from M. rotundifolia; and the isolate from Costa Rica. All isolates were pathogenic on V. vinifera (cv. Chardonnay) berries although those originating from M. rotundifolia were not as aggressive as isolates from V. vinifera, irrespective of geographical origin. Sensitivity to pyraclostrobin and salicylhydroxamic acid (SHAM) was studied. Despite differences in fungicide applications, hyphal growth inhibition was not significantly different for geographical location, cultivar, tissue, year of collection or different spray regimes. For the Australian and USA isolates, fungal growth inhibition was significantly greater for pyraclostrobin than for SHAM, and was significantly greater for the combined treatment than for each of the fungicides applied singly. The aetiological and epidemiological knowledge of bitter rot collected through this study will aid better prediction and management strategies of this pathogen.

Introduction

Greeneria uvicola (syn. Melanconium fuligineum) causes bitter rot on Vitis vinifera (European bunch grape; Fig. 1a), Muscadinia rotundifolia (muscadine grape; Fig. 1b) and Vitis × labruscana (fox grape) in warm moist temperate and subtropical grape-growing regions throughout the world. It has been identified in Greece, Italy, Japan, Taiwan, China, India, Australia, Costa Rica, Brazil, South Africa and the USA (Critopoulos, 1961; Ridings & Clayton, 1970; McGrew, 1977; Sutton & Gibson, 1977; Abrahão et al., 1993; Wu & Chang, 1993; Yan et al., 1998; Castillo-Pando et al., 2001; Pfenning et al., 2005; Navarrete et al., 2009). The pathogen causes yield losses to the grapevine industry and has been reported to affect as much as 30% of the crop (Ridings & Clayton, 1970). It is also responsible for girdling and dead-arm dieback of shoots (Critopoulos, 1961; Prakash et al., 1974; Navarrete et al., 2009). All vinifera and muscadine cultivars examined are susceptible to infection by G. uvicola although differences in the levels of infection have been observed (Ridings & Clayton, 1970; Longland & Sutton, 2008). Production of wine from as little as 10% infected fruit results in a rather unpleasant product with a bitter taste (McGrew, 1977), hence the name bitter rot.

Figure 1.

Greeneria uvicola on Vitis vinifera (a), and Muscadinia rotundifolia (b).

The fungus reproduces asexually; a sexual stage has not been observed (Farr et al., 2001). Greeneria uvicola overwinters as a saprophyte on canes and mummified berries on the vine or on the ground (Kummuang et al., 1996b). Conidia are splash dispersed by moisture and can infect all parts of the plant (Luttrell, 1953). Humidity is vital for the development of the disease (Reddy & Reddy, 1983). The pathogen remains latent until the beginning of ripening (Kummuang et al., 1996a), as optimum temperatures for sporulation are between 8 and 24°C while optimum mycelial growth and infection occurs at 27–28°C (Ridings & Clayton, 1970; Steel et al., 2011). Penetration takes place through the berry epidermis via hyaline formation, appressorium and penetration peg (Kao et al., 1990) with hyphae colonizing the fruit tissue intracellularly (Kummuang et al., 1996a). Secondary infection may also occur through wounds caused by insects, birds and mechanical injuries. Characteristic black concentric rings of acervuli can be observed on infected berries that eventually shrivel to mummies.

Phylogenetic analysis based on molecular sequence data is used for reconstructing fungal evolutionary relationships at intraspecific and interspecific levels (James et al., 2006). Farr et al. (2001) placed G. uvicola into the order Diaporthales, class Pyrenomycetes, phylum Ascomycota based on morphological and molecular analyses of the 28S rDNA. Navarrete et al. (2009) compared G. uvicola isolates collected from wood tissues in Uruguay and their relationship to an isolate from Ohio described by Farr et al. (2001) on the basis of 28S rDNA. The authors also provided the first sequence data of the 5∙8S rDNA internal transcribed spacer 1 (ITS) of this species. The β-tubulin-2 gene sequence has also been used extensively during phylogenetic studies because it is slightly more informative than analysis of the ITS region as shown in a study of ripe rot Colletotrichum acutatum (Whitelaw-Weckert et al., 2007). However, β-tubulin-2 data for G. uvicola have not been reported.

Best management programmes include a combination of sanitation measures and chemical control; however, the few epidemiological studies that have been conducted focused on commercially unimportant wine grape cultivars and species and the fungicides recommended are now outdated. For example, the benzimidazole fungicide benomyl, that was found to be the most effective for the chemical control of G. uvicola (Ridings & Clayton, 1970), is no longer registered.

Understanding the development of a fungal pathogen is essential to plan and execute effective control measures. Greeneria uvicola has been identified on different grape species around the world but the relationships between different populations have not been investigated. The aim of this study was to enhance our knowledge of the aetiology and epidemiology of G. uvicola by investigating representative isolates from different parts of the world. In order to fulfil these aims, the phylogenetic relationships among G. uvicola isolates from V. vinifera and M. rotundifolia from the USA, Australia, India and Costa Rica were analysed by genotyping three conserved nucleotide regions: the ribosomal DNA (rDNA) internal transcribed spacer regions (ITS1–5∙8S–ITS2), 28S large subunit (LSU) nuclear rDNA, and β-tubulin-2. In addition, the morphological features, pathogenicity and in vitro sensitivity to pyraclostrobin of G. uvicola were also studied.

Materials and methods

Fungal isolates

Sixty-seven G. uvicola isolates were collected from V. vinifera cultivars in subtropical grape-growing regions in eastern Australia (Table 1). Seventeen G. uvicola isolates were collected from V. vinifera cultivars, 13 from M. rotundifolia cultivars and one from the interspecific French–American hybrid Chambourcin, in southeastern USA. Two isolates, one from India and one from Costa Rica, were obtained from the Centre for Agricultural Bioscience International (CABI, www.cabi.org). Single-spore pure cultures were collected from berries and wood following a protocol established by Steel et al. (2007). Representative isolates are maintained at the National Wine and Grape Industry Centre (Wagga Wagga, NSW, Australia), North Carolina State University (Raleigh, NC, USA) and the Plant Pathology Herbarium (DAR), Department of Primary Industry (Orange, NSW, Australia). Morphological characterization was performed according to Sutton & Gibson (1977) and Kornerup & Wanscher (1984).

Table 1. Greeneria uvicola isolates included in this study
NameHerbarium accessionGeographic originaDate of isolationCultivarVine typebHost tissueGenBank accession
5.8S rDNA ITS1β-tubulin-228S LSU rDNA
  1. a

    NSW, New South Wales; QLD, Queensland; NC, North Carolina; MS, Missouri.

  2. b

    V, vinifera cultivar; M, muscadine cultivar; H, French–American hybrid.

  3. c

    Australian Scientific Collection Unit, Department of Primary Industry (Orange, NSW, Australia).

  4. d

    CABI (www.cabi.org).

Isolates from Australiac
 AU01DAR77258Upper Hunter Valley, NSW2002ChardonnayVBerry JN381031 JN561305 JN547720
 AU02DAR77260Hastings Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU03DAR77261Hastings Valley, NSW2004ChambourcinVBerry JN381031 JN561305 JN547720
 AU04DAR77262Hastings Valley, NSW2004Cabernet sauvignonVBerry JN381031 JN561305 JN547720
 AU05DAR77263Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU06DAR77264Upper Hunter Valley, NSW2004ChardonnayVBerry GU907101 JN561304 JN547720
 AU07DAR77265Upper Hunter Valley, NSW2004ChardonnayVBerry GU907101 JN561304 JN547720
 AU08DAR77266Upper Hunter Valley, NSW2004ChardonnayVBerry GU907101 JN561304 JN547720
 AU09DAR77267Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU10DAR77268Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU11DAR77269Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU12DAR77270Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU13DAR77271Upper Hunter Valley, NSW2004Cabernet sauvignonVBerry GU907101 JN561304 JN547720
 AU14DAR77272Upper Hunter Valley, NSW2004Cabernet sauvignonVBerry GU907101 JN561304 JN547720
 AU15DAR77273Upper Hunter Valley, NSW2004Cabernet sauvignonVBerry JN381031 JN561305 JN547720
 AU16DAR77274Upper Hunter Valley, NSW2004Cabernet sauvignonVBerry JN381031 JN561305 JN547720
 AU17DAR77275Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU18DAR77276Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU19DAR77277Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU20DAR77278Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU21DAR77279Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU22DAR77280Upper Hunter Valley, NSW2004ChardonnayVBerry GU907101 JN561304 JN547720
 AU23DAR77281Upper Hunter Valley, NSW2004ChardonnayVBerry JN381031 JN561305 JN547720
 AU24DAR77259Hastings Valley, NSW2004ChambourcinVBerry JN381031 JN561305 JN547720
 AU25DAR81469Lower Hunter Valley, NSW2006ShirazVWood JN381031 JN561305 JN547720
 AU26DAR81470Lower Hunter Valley, NSW2006ChardonnayVWood JN381031 JN561305 JN547720
 AU27DAR81471Lower Hunter Valley, NSW2006SemillonVWood JN381031 JN561305 JN547720
 AU28DAR81472Upper Hunter Valley, NSW2006ChardonnayVWood JN381031 JN561305 JN547720
 AU29DAR81473Upper Hunter Valley, NSW2006Cabernet sauvignonVWood JN381031 JN561305 JN547720
 AU30DAR81474Upper Hunter Valley, NSW2006Cabernet sauvignonVWood JN381031 JN561305 JN547720
 AU31DAR81475Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU32DAR81476Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU33DAR81477Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU34DAR81478Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU35DAR81479Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU36DAR81480Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU37DAR81481Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU38DAR81482Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU39DAR81483Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU40DAR81484Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU41DAR81485Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU42DAR81486Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU43DAR81487Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU44DAR81488Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU45DAR81489Hastings Valley, NSW2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU46DAR80940Shire of Balonne, QLD2009ChardonnayVBerry JN381031 JN561305 JN547720
 AU47DAR80941South Burnett Region, QLD2010ChardonnayVBerry JN381031 JN561305 JN547720
 AU48DAR80942South Burnett Region, QLD2010ChardonnayVBerry JN381031 JN561305 JN547720
 AU49DAR80943South Burnett Region, QLD2010SemillonVBerry GU907101 JN561304 JN547720
 AU50DAR80944South Burnett Region, QLD2010SemillonVBerry GU907101 JN561304 JN547720
 AU51DAR80945South Burnett Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU52DAR80946South Burnett Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU53DAR80947South Burnett Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU54DAR80948South Burnett Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU55DAR80949Southern Downs Region, QLD2010Pinot grisVBerry GU907101 JN561304 JN547720
 AU56DAR80950Southern Downs Region, QLD2010Pinot grisVBerry GU907101 JN561304 JN547720
 AU57DAR80951Southern Downs Region, QLD2010ChardonnayVBerry GU907101 JN561304 JN547720
 AU58DAR80952Southern Downs Region, QLD2010ChardonnayVBerry GU907101 JN561304 JN547720
 AU59DAR80953Southern Downs Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU60DAR80954Southern Downs Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU61DAR80955South Burnett Region, QLD2010ChardonnayVBerry GU907101 JN561304 JN547720
 AU62DAR80956Southern Downs Region, QLD2010ViognierVBerry GU907101 JN561304 JN547720
 AU63DAR80957Southern Downs Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU64DAR80958Southern Downs Region, QLD2010SemillonVBerry JN381031 JN561305 JN547720
 AU65DAR80959Southern Downs Region, QLD2010ViognierVBerry JN381031 JN561305 JN547720
 AU66DAR80960Southern Downs Region, QLD2010ViognierVBerry JN381031 JN561305 JN547720
 AU67DAR80961Southern Downs Region, QLD2010ChardonnayVBerry JN381031 JN561305 JN547720
Isolates from USA
 US01 Forsyth County, NC2010Sauvignon blancVBerry JN547707 JN561306 JN547723
 US02 Forsyth County, NC2010Sauvignon blancVBerry JN547708 JN561307 JN547723
 US03 Forsyth County, NC2010Sauvignon blancVBerry JN547709 JN561308 JN547723
 US04 Forsyth County, NC2010Sauvignon blancVBerry JN547708 JN561307 JN547723
 US05 Forsyth County, NC2010Sauvignon blancVBerry JN547708 JN561309 JN547723
 US06 Forsyth County, NC2010Sauvignon blancVBerry JN547707 JN561306 JN547723
 US07 Forsyth County, NC2010Sauvignon blancVBerry JN547710 JN561310 JN547723
 US08 Forsyth County, NC2010Sauvignon blancVBerry JN547707 JN561306 JN547723
 US09 Forsyth County, NC2010ChardonnayVBerry JN547711 JN561311 JN547723
 US10 Forsyth County, NC2010ChardonnayVBerry JN547712 JN561311 JN547723
 US11 Forsyth County, NC2010ChardonnayVBerry JN547712 JN561311 JN547723
 US12 Forsyth County, NC2010ChardonnayVBerry JN547713 JN561312 JN547722
 US13 Forsyth County, NC2010ChardonnayVBerry JN547714 JN561313 JN547722
 US14 Forsyth County, NC2010ChardonnayVBerry JN547714 JN561314 JN547723
 US15 Forsyth County, NC2010ChardonnayVBerry JN547714 JN561314 JN547723
 US16 Forsyth County, NC2010ChardonnayVBerry JN547714 JN561315 JN547723
 US17 New Hanover County, NC2010CarlosMBerry JN547715 JN561316 JN547721
 US19 New Hanover County, NC2010CarlosMBerry JN547716 JN561317 JN547721
 US20 New Hanover County, NC2010TriumphMBerry JN547716 JN561317 JN547721
 US22 New Hanover County, NC2010TriumphMBerry JN547716 JN561318 JN547721
 US23 New Hanover County, NC2010Sweet JennyMBerry JN547716 JN561317 JN547721
 US24 New Hanover County, NC2010Sweet JennyMBerry JN547717 JN561317 JN547721
 US25 New Hanover County, NC2010Sweet JennyMBerry JN547716 JN561317 JN547721
 US26 New Hanover County, NC2010Sweet JennyMBerry JN547718 JN561319 JN547721
 US27 New Hanover County, NC2010FryMBerry JN547716 JN561320 JN547721
 US28 Bladen County, NC2002CarlosMBerry JN547719 JN561321 JN547721
 US29 Wake County, NC2002NesbittMBerry JN547716 JN561322 JN547721
 US30 Pearl River County, MS2002CarlosMBerry JN547716 JN561317 JN547721
 US31 New Hanover County, NC2002CarlosMBerry JN547716 JN561317 JN547721
 US32 Chatham County, NC2002ChambourcinHBerry JN547716 JN561316 JN547721
 US33 Forsyth County, NC2002ChardonnayVBerry JN547708 JQ346796 JN547723
Isolates from other parts of the worldd
 CABI 256052256052Costa Rica1981unknownV  JQ346798 JQ346797 JN547720
 CABI 214095214095India1977unknownV  JN381031 JN561305 JN547720

Conidia measurements

Greeneria uvicola isolates were grown on potato dextrose agar (PDA; Oxoid) at 27°C in the dark for 2 or more weeks until conidia were formed. Conidia from each isolate were mounted on a microscope slide and fixed in 85% lactic acid. Images of conidia from each isolate were captured using Olympus colorview analySIS LS Research software (Soft Imaging System) with an Olympus AX70 True Research System microscope. The length and width of 50 conidia per isolate were measured.

Molecular characterization

Fungal DNA was extracted and molecular identification of pure cultures was achieved by PCR amplification of three highly conserved consensus regions using standard oligonucleotides as previously described (Table 2; Samuelian et al., 2011). Amplified PCR fragments were purified with the QIAquick PCR purification kit (QIAGEN) and ligated into the pGEM-T vector (Promega) following the manufacturers' instructions. Colonies with recombinant plasmids were grown in 3·5 mL liquid LB media containing ampicillin overnight at 37°C. Plasmids were purified with the QIAprep Spin Miniprep Kit (QIAGEN) following the manufacturer's protocol and sequenced in both directions with the M13 forward and reverse universal primers at the Australian Genome Research Facility (University of Queensland, Australia). DNA sequence chromatograms were analysed with chromas v. 1.45 (http://www.technelysium.com.au/chromas.html). Multiple sequence alignments, contig assembly and comparison of nucleotide sequences were performed with dnastar (DNASTAR Inc.). Nucleotide homology searches and comparison of identical sequences were performed with blast (http://www.ncbi.nlm.nih.gov). Genetic distances were calculated and maximum parsimony trees constructed for the three genes with mega v. 5.0 (Tamura et al., 2007). Nucleotide sequences obtained during this study were deposited at the National Center for Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov). Where several isolates had the same DNA sequence, only one accession number was generated to represent identical isolates.

Table 2. Oligonucleotide primers used to amplify three conserved DNA regions from Greeneria uvicola
GenePrimers (5′–3′)Reference
ForwardReverse
5∙8S ITS rDNAITS1: TCCGTAGGTGAACCTGCGGITS4: TCCTCCGCTTATTGATATGCWhite et al., 1990
28S rDNA (large subunit)LR0R: ACCCGCTGAACTTAAGCLR7: TACTACCACCAAGATCTNavarrete et al., 2009
β-tubulin-2Bt1a: AACATGCGTGAGATTGTAAGTBt1b: ACCCTCAGTGTAGTGACCCTTGGCGlass & Donaldson, 1995

Berry infection studies

Three Australian isolates (AU01, AU67 and AU49) and 12 USA isolates (US01, US04, US06, US09, US12 and US16 from V. vinifera cultivars; US17, US19, US20, US24, US25 and US26 from M. rotundifolia cultivars) were analysed for their pathogenicity on V. vinifera cv. Chardonnay berries. These isolates were selected based on their differences within the three genomic regions analysed (Table 1; Fig. 2). AU67 is a representative of subgroup 1; AU49 is a representative of subgroup 2 (Fig. 2). US12 was chosen because this isolate, together with US13, was different from all other isolates based on the 28S LSU rDNA sequence (Fig. 2a). Disease-free mature berries (21·8°Bx) were collected from the Charles Sturt University vineyard, Orange Campus, NSW, in February 2011 and placed individually into microtitre plate wells (24-well, flat-bottom, Iwaki microplates) with pedicels facing downwards. Inoculation with G. uvicola spores was performed as previously described (Steel et al., 2007). Berries were incubated for 7 days at 27°C under a 12-h light/12-h dark photoperiod and examined for fungal infection with a dissecting microscope. Results were presented as the mean percentage of berries infected and were analysed by anova using GenStat (VSN International Ltd).

Figure 2.

Phylogenetic relationship between Greeneria uvicola isolates based on (a) 28S large subunit (LSU) nuclear rDNA, (b) 5·8S rDNA internal transcribed spacer 1 (ITS), and (c) β-tubulin-2. Consensus trees were inferred using the neighbour-joining method. Isolates with identical genomic sequences were analysed as a single sequence. All Australian isolates and the isolates from India and Costa Rica have the same 28S sequence (AU, India, Costa Rica_28S); the same is valid for all muscadine isolates (US_28S, muscadine). All US vinifera isolates with the exception of US12 and US13 (US12_13_28S) are presented as US_28S. The Australian isolates were divided into two subgroups based on their ITS and β-tubulin-2 sequences (subgroup I and subgroup II). Sequences available at public databases were incorporated in the study. Greeneria uvicola isolates from Uruguay were reported by Navarrete et al. (2009). Numbers at nodes represent 1000 bootstrap replications. Only values above 70% are indicated. Statistically significant clades are indicated in (b) and (c). The trees were rooted to Gaeumannomyces graminis var. avenae. Scale bars represent genetic distances.

In vitro assessment of fungicide sensitivity

An in vitro pilot study performed with a small number of isolates and a range of fungicides and concentrations determined that the most effective fungicide to suppress G. uvicola development at 50% compared to the control (ED50 value) was pyraclostrobin (Cabrio; Sigma-Aldrich). (The fungicides tested in the pilot study belonged to the anilide (boscalid), anilinopyrimidine (pyrimethanil), chlorophenyl (chlorothalonil), dicarboximide (iprodione), dinitroaniline (fluazinam), phthalimide (captan) and strobilurin (azoxystrobin, pyraclostrobin, trifluxystrobin) chemical groups.) Based on these findings all G. uvicola isolates were screened for sensitivity to pyraclostrobin at 4 μg L−1 and salicylhydroxamic acid (SHAM; Sigma-Aldrich) at 100 μg mL−1 as these exhibited the most effective combination and doses to reduce mycelium growth. Amended PDA plates (Mondal et al., 2005) were prepared by diluting active ingredients in acetone and adding 1 mL L−1 of each to molten agar. The centre of each plate was inoculated with a 5-mm agar plug of mycelium obtained from the edge of an actively growing culture on PDA, with three replicates per treatment. Plates were maintained in the dark at 25°C. Measurements of fungal growth were performed simultaneously for all four treatments (i.e. no-fungicide control, SHAM, pyraclostrobin and pyraclostrobin × SHAM) and for each individual isolate, when mycelium of the no-fungicide control cultures of that individual isolate covered approximately 65–85% of the plates. Colony diameter was measured across two perpendicular axes for each plate and the two diameters averaged. The experiment was conducted twice as each isolate was evaluated in triplicate. Results were expressed with respect to the percentage inhibition of growth compared to the controls.

Statistical analyses

The statistical software R (R Development Core Team, 2010) was used to perform statistical analyses. anova techniques were used to quantify statistical differences in baseline sensitivities with regard to fungicide treatment application at and between geographical locations, cultivars, collection dates and host tissue. The linear mixed model approach ASREML-R (restricted maximum likelihood) (Butler et al., 2007) was employed to account for the random variation associated with sets (replicates) and thus minimize residual variability. Tukey's HSD all-pairwise comparisons test was used for comparison of means of fungal growth at = 0·05.

Results

Morphological characteristics

The mycelium of most G. uvicola isolates grown on PDA was creamy white at the outer edge of the colony, turning to greyish brown at the centre; however, isolates AU13, AU32, AU35, AU55 and AU65 were uniformly dark brown, and isolates US17, US26 and US29 were uniformly black (Fig. 3; Table S1). The mycelium of the USA isolates was much raised and ropey to slightly ropey while mycelium of the remaining isolates remained flat and appressed to the agar. Average lengths and widths of the conidia of G. uvicola populations are presented in Table 3 (conidia measurements of all isolates are presented in Table S2). The conidia of the Australian isolates were the smallest (Fig. 4). USA isolates identified on vinifera cultivars were significantly longer and broader than all other isolates. In addition, the conidia of the USA isolates identified on muscadine cultivars and the Indian and Costa Rican isolates were similar but significantly different from the other isolates.

Figure 3.

Morphological differentiation of Greeneria uvicola on potato dextrose agar plates.

Figure 4.

Conidia of representative Greeneria uvicola isolates. AU27, isolate from Vitis vinifera, Australia; US15, isolate from V. vinifera, USA; US29, isolate from Muscadinia rotundifolia, USA.

Table 3. Conidia dimensions of the Greeneria uvicola isolates analysed in this studya
GroupMean (μm)Max (μm)Min (μm)
LengthWidthLengthWidthLengthWidth
  1. Mean, mean value for all conidia of the corresponding group; Max, mean of the maximum values for all isolates; Min, mean of the minimum values for all isolates. Standard errors are presented in brackets. Values with the same upper case letters indicate significantly similar groups, based on conidia length and width using Tukey's HSD all-pairwise comparisons test at a 5% similarity confidence level.

  2. a

    Lengths and widths of 50 conidia were measured for each isolate.

Australia7·75 (± 0·02)A3·00 (± 0·01)A10·06 (± 0·14)3·97 (± 0·06)5·81 (± 0·09)2·21 (± 0·04)
USA, vinifera8·99 (± 0·04)C4·25 (± 0·01)C11·12 (± 0·21)4·89 (± 0·08)6·75 (± 0·19)3·23 (± 0·07)
USA, muscadine8·48 (± 0·03)B3·36 (± 0·02)B10·48 (± 0·15)3·91 (± 0·06)6·66 (± 0·16)2·53 (± 0·07)
India and Costa Rica8·47 (± 0·10)B3·29 (± 0·04)B10·97 (± 0·34)4·34 (± 0·57)6·81 (± 0·33)2·55 (± 0·09)

Phylogenetic studies

Amplification of the three genes resulted in fragments of approximately 600 bp for the ITS sequences, 1410 bp for 28S rDNA and 960 bp for β-tubulin-2. blast analyses revealed homology to several G. uvicola isolates from Uruguay (Navarrete et al., 2009) and one from Ohio (Farr et al., 2001) in the 28S rDNA and ITS sequences. Homology to β-tubulin-2 sequences from other studies was not found in the public databases.

All of the Australian isolates and the isolates from India and Costa Rica had the same 28S rDNA sequence (‘AU, India, Costa Rica_28S’ in Fig. 2a). All muscadine isolates also had the same 28S rDNA sequence (‘US_28S, muscadine’, Fig. 2a). Most of the North American vinifera isolates possessed identical sequences in that region (‘US_28S’, Fig. 2a) with two exceptions – US12 and US13 (‘US12_13_28S’, Fig. 2a). Only one 28S rDNA sequence from USA (Farr et al., 2001) was available from NCBI and it had higher homology with the sequences from Uruguay compared with the isolates identified in this study.

The phylogenetic trees based on ITS and β-tubulin-2 regions were largely consistent with each other. However, the tree based on the β-tubulin-2 region (Fig. 2c) was more informative than the one based on the ITS regions (Fig. 2b). Isolates US05, US13, US16, US22, US27, US29 and US33 have unique β-tubulin-2 sequences; however isolate US09 has a unique ITS sequence but the same β-tubulin-2 region as two other isolates. Three well-defined clusters were formed based on all analysed genomic regions: (i) a population identified on muscadine grapes, (ii) a population identified on US vinifera grapes, (iii) a population from Australia, India and Costa Rica (Fig. 2). Interestingly, the two USA groups were more closely related to the third group and the isolates from Uruguay than to each other. The differences in the ITS and β-tubulin-2 regions among the Australian isolates were only one and two nucleotides, respectively, and the isolates were combined in two subgroups. The isolate from India was 100% identical to one of the Australian subgroups. According to the genes analysed, there were no differences between the Australian isolates with regards to different geographic regions and host tissues (berries/wood). The isolate from Costa Rica was clustered independently based on the ITS, but was close to the Australian and Indian isolates based on the β-tubulin-2 genes. The isolates from Uruguay were also grouped together for both 28S rDNA and ITS. Unfortunately, more conclusive comparisons with these sequences could not be performed as the sequences available at GenBank are incomplete at their 5′ and 3′ ends with a number of unknown (‘N’) nucleotides.

Berry infection studies

Symptoms of fungal infection, including skin cracks, oozing, splitting, browning, bleaching, mycelial growth and presence of black acervuli were noted. All G. uvicola isolates infected Chardonnay berries at 27°C and a relative humidity of c. 100% (Fig. 5). Infection rates of isolates identified on vinifera cultivars from Australia and the USA were not significantly different (< 0·05). The number of berries infected by the muscadine isolates was slightly higher at the third day after inoculation compared to the Australian and USA vinifera isolates but was significantly lower at the end of the observation period.

Figure 5.

Pathogenicity of Greeneria uvicola isolates from USA and Australia on Vitis vinifera (cv. Chardonnay) berries. Results are presented as means for the Australian isolates (AU vinifera), the USA isolates from V. vinifera (US vinifera) and the USA isolates from Muscadinia rotundifolia (US muscadine). Error bars represent standard deviations.

In vitro assessment of fungicide sensitivity

The sensitivity of all isolates was similar for each individual treatment: SHAM, pyraclostrobin and pyraclostrobin × SHAM (Table 4). Pyraclostrobin and SHAM significantly reduced colony growth of all isolates. Fungal inhibition by pyraclostrobin × SHAM (75·6 ± 9·2%) was significantly higher than pyraclostrobin alone (38·7 ± 10·3%), which was significantly higher than SHAM alone (20·4 ± 8·1%). Thus, the inhibitory effect of pyraclostrobin was increased significantly by SHAM.

Table 4. In vitro sensitivity of Greeneria uvicola to pyraclostrobin (4 μg L−1) and salicylhydroxamic (SHAM; 100 μg mL−1)
IsolateSHAMPyraclostrobinPyraclostrobin × SHAM
MeanaSDbMeanSDMeanSD
  1. n.d., no data.

  2. a

    Percentage inhibition of radial growth.

  3. b

    Standard deviation.

AU0122·801·2037·682·3381·852·95
AU0218·013·7934·612·0667·562·15
AU0317·234·4333·273·4271·668·19
AU0418·232·9433·212·4566·054·24
AU0530·021·9543·281·6887·785·38
AU0630·141·0245·583·3373·943·98
AU0726·595·1025·5512·6890·713·75
AU0831·674·1441·132·4477·262·15
AU0918·762·1333·174·1065·791·54
AU1023·411·3341·012·1069·873·33
AU1119·683·3033·081·4966·272·88
AU1225·641·3436·844·5768·180·73
AU13 9·443·1028·423·9892·081·40
AU14 4·124·8147·5811·1470·643·05
AU1530·851·1743·761·3184·943·89
AU1629·891·7444·392·7692·552·43
AU1711·1812·2823·1815·2359·6511·16
AU1831·640·6637·831·6794·031·15
AU1917·082·4931·431·8472·364·82
AU2018·302·8850·331·8990·973·50
AU2128·382·6645·804·9683·998·70
AU2227·941·9839·311·8885·238·58
AU2326·473·3834·538·0871·949·16
AU2415·850·5834·152·8368·568·02
AU2521·472·6535·244·3177·2910·11
AU2614·345·7928·986·9581·729·68
AU2713·972·1429·713·6368·045·33
AU2817·297·7529·9210·4070·3613·32
AU2921·303·4633·832·1079·9414·80
AU3021·142·2434·641·9675·847·68
AU3123·163·3051·662·1170·183·70
AU3214·162·5926·964·7165·334·41
AU334·415·1276·094·6188·784·73
AU3420·203·1931·609·2470·654·79
AU3525·1612·5132·029·0658·856·15
AU3614·899·7027·394·9968·998·54
AU3715·465·2227·821·2572·8221·10
AU3812·892·9029·451·1471·776·99
AU3913·862·7626·181·0965·014·87
AU4012·015·4631·395·2267·593·92
AU4114·001·4028·584·4361·793·45
AU4214·410·9533·766·1765·264·13
AU43 9·371·3629·631·3663·400·65
AU4411··431·9731·121·4561·921·93
AU4514·641·8231·864·2963·161·98
AU4620·720·7833·502·4367·001·22
AU4723·541·0039·442·0370·272·43
AU4821·711·1543·1424·868·691·13
AU4928·634·0638·834·3380·046·46
AU5030·381·4041·051·8586·659·05
AU5130·141·4324·821·4784··872·07
AU5222·150·9931·192·2768·020·75
AU5327·962·3637·842·4882·9513·13
AU5427·911·8233·502·3568·792·19
AU5524·203·1935·652·5980·519·09
AU5630·811·6740·890·7685·138·22
AU5732·751·9141·450·9880·230·42
AU5832·731·2043·960·7481·391·66
AU5917·425·4729·821·8267·691·00
AU6021·451·6233·860·7779·735·24
AU6127·362·2643·503·3575·572·57
AU6228·982·5842·432·7374·003·43
AU639·1210·5927·272·6670·8115·97
AU6412·973·0436·722·8370·486·71
AU6515·832·3030·882·9372·044·22
AU6618·551·8440·742·4570·913·70
AU6716·523·0536·151·9367·212·53
US0118·384·4239·243·3178·764·49
US0227·313·1651·666·3390·134·90
US0336·825·0043·065·6180·8218·76
US0436·062·2655·255·1388·942·26
US0525·0316·7642·874·6086·584·89
US0611·356·9230·503·4287·233·56
US0730·041·5352·564·5983·563·65
US0818·884·4042·036·2388·914·45
US0931·833·8271·757·9191·373·68
US1021·491·7247·122·6379·616·36
US1119·642·7043·832·5775·572·30
US1225·732·5744·723·3385·464·77
US1316·474·2046·132·8071·861·40
US1415·972·3651·653·7481·294·03
US1528·051·8765·972·4393·572·73
US1634·4313·7065·034·8590·172·91
US175·471·4647·064·7570·593·09
US192·815·8334·028·3968·7313·13
US208·605·6038·764·5064·781·88
US226·543·6649·343·9474·454·55
US2313·402·0544·334·0267·014·72
US2420·104·6428·934·4767·453·59
US256·571·4543·901·3864·034·03
US2611·011·7232·974·9475·8910·27
US2722·862·8630·002·5870·241·80
US2825·428·8042·406·3765·606·51
US292·843·9143·947·5464·403·52
US30n.d.n.d.n.d.n.d.n.d.n.d.
US3123·951·4731·455·8181·324·31
US3211·856·3165·795·1479·262·47
US3324·172·5835·833·8773·542·76
CABI 21409530·881·1435·182·6072·271·34
CABI 25605223·594·9315·743·3491·6311·79

Discussion

Greeneria uvicola isolates from subtropical regions of Australia, the USA, Costa Rica and India were studied for their morphology on artificial media, fungicide sensitivity, pathogenicity to V. vinifera and intraspecific variation based on three gene regions. Isolates from Australia, Costa Rica and India were all obtained from V. vinifera. The isolates from the USA were from either V. vinifera or the endemic M. rotundifolia. Muscadines are native to North America and currently only grown in southeastern USA under hot and humid conditions unsuitable for vinifera cultivars. Information regarding the V. vinifera cultivars from which G. uvicola were collected in India and Costa Rica was not available.

Phylogenetic analyses of β-tubulin-2 and ITS regions differentiated G. uvicola isolates in much more detail than the 28S rDNA sequences. The β-tubulin-2 tree had a slightly higher resolution than the ITS tree. This is in agreement with phylogenetic studies of Ophiostoma minus (Gorton et al., 2004) and C. acutatum (Whitelaw-Weckert et al., 2007). Characterization of G. uvicola populations by sequencing three genome regions clearly distinguished isolates into those from V. vinifera and those from M. rotundifolia cultivars. The Australian isolates were not differentiated by 28S rDNA sequences and divided only into two subgroups by β-tubulin-2 and ITS sequences. In addition, one of the Australian subgroups was identical to the isolate from India but not to the isolates from the USA and Costa Rica based on two genomic regions. A much higher intraspecific variation was observed amongst the USA isolates based on β-tubulin-2 and ITS sequences, suggesting that G. uvicola may have originated from North America and has arrived and spread within Australia from a single source. In addition, the finding that G. uvicola could be differentiated into vinifera and muscadine populations, even though they were collected from neighbouring vineyards raises additional questions as to how G. uvicola spreads.

Most of the isolates were morphologically identical, with five exceptions from the Australian isolates and three exceptions in the muscadine isolates. This variation in morphology could be misleading for identification purposes. The reasons for such differences in fungal morphology are currently unknown.

Pathogenicity of G. uvicola was studied on Chardonnay fruit as this cultivar has been reported to be highly susceptible to bitter rot (Miranda, 2004). Isolates of G. uvicola obtained from V. vinifera, regardless of country of origin and cultivar, were significantly more aggressive on detached Chardonnay berries than isolates obtained from M. rotundifolia. This is in agreement with the study conducted by Miranda (2004) and might explain the higher level of losses in V. vinifera vineyards caused by bitter rot in contrast to M. rotundifolia vineyards (Clayton, 1975; Miranda, 2004). In addition, the vinifera G. uvicola isolates used to study the pathogenicity of the fungus on Chardonnay berries were able to infect M. rotundifolia berries (data not shown).

Recommendations for bitter rot control on both V. vinifera (Sutton & Burrack, 2012) and M. rotundifolia (Cline & Burrack, 2012) cultivars in North Carolina involve application of strobilurin and other fungicides up to 14 days prior to harvest. These management options are not available to wine grape growers in Australia due to restrictions on pesticide use for wine destined for European export markets. For example, pyraclostrobin cannot be used after bunch closure or within 63 days of harvest. Pyraclostrobin was introduced in the late 1990s in the USA, and is moderately to highly effective for the control of a number of fungal diseases. In Australia it was approved for use in 2003 (Australian Pesticide and Veterinary Medicines Authority, www.apvma.gov.au). However, frequent application of strobilurin may lead to resistance development (Timmer, 2004; Mondal et al., 2005). Several fungicides (azoxystrobin, boscalid, captan, chlorothalonil, fluazinam, iprodione, pyraclostrobin, pyrimethanil and trifluroxystrobin) were tested in a pilot study for their effectiveness against bitter rot, with pyraclostrobin being found to be one of the most effective inhibitors (data not shown). This current study tested whether there was an indication of G. uvicola developing resistance to pyraclostrobin based on longer and more frequent use of the fungicide in the USA. The results indicated that, despite differences in pyraclostrobin usage, there was no difference between the G. uvicola isolates even though some were collected before the introduction of pyraclostrobin in viticulture. Many fungi possess an alternative respiration pathway that avoids electron transport through the cytochrome b target site of pyraclostrobin fungicides. SHAM blocks this alternative respiration pathway and has been used to investigate fungal sensitivity to pyraclostrobin fungicides (Olaya & Köller, 1999; Sierotzki et al., 2000; Avila-Adame et al., 2003; Mondal et al., 2005). Mondal et al. (2005) found that a number of citrus pathogens including C. acutatum, Alternaria alternata, Elsinoe fawcettii, Diaporthe citri and Mycosphaerella citri do not use the alternative pathway to avoid the toxic effect of the strobilurin fungicides. Greeneria uvicola growth was inhibited by SHAM independently and in combination with pyraclostrobin, leading to the conclusion that G. uvicola is using the alternative respiration pathway and therefore has the potential to develop resistance to pyraclostrobin and other strobilurins. Interestingly, fungicide sensitivity to strobilurins studied in vitro may differ from actual sensitivity to these chemicals in vivo (Olaya et al., 1998; Olaya & Köller, 1999; Bartlett et al., 2002; Avila-Adame & Köller, 2003; Avila-Adame et al., 2003; Mondal et al., 2005) and further research is necessary to determine whether that is true for G. uvicola.

In this study, independent populations of G. uvicola were differentiated on the basis of region of distribution and/or host plant. Understanding the genetic diversity and origin of the fungus should be useful to regulatory agencies in helping to prevent the introduction of the pathogen into countries where it does not exist, or determining the origin of an introduction. The data may also help plant breeders select isolates when screening populations of grapes for resistance. Finally, it provides some evidence that fungicide control programmes developed in one area may be effective in others as well. For example, despite the greater applications of pyraclostrobin in the USA compared to the Australian vineyards, there was no significant difference in pyraclostrobin sensitivity between isolates from the two regions.

Acknowledgements

This work was conducted within the Winegrowing Futures Program, a joint initiative of the Grape and Wine Research and Development Corporation (GWRDC) and the National Wine and Grape Industry Centre, Charles Sturt University. We thank Jim Hardie for critical review of the manuscript; Chris Haywood (New South Wales Department of Industry and Investment) for managing the experimental sites; Rujuan Huang, Ekaterina Simova, Lisa Greer and Stacey Greer for technical assistance; Matthew Prescott and Leigh Schmidtke for help with statistical analyses; and the grape growers and winemakers of New South Wales, Queensland and North Carolina who provided access to their vineyards and participated in this study.

Ancillary