NKG2D Ligands Expression and NKG2D-Mediated Cytotoxicity in Human Laryngeal Squamous Carcinoma Cells

Authors


X. M. Chen, Department of Otolaryngology, the Second Affiliated Hospital of Shandong University, 247 Beiyuan Road, Jinan 250033, China. E-mail: chenxuemeisd@yahoo.com.cn

Abstract

The NKG2D is an activating immunoreceptor expressed by NK cells and CD8+ T cells. Engagement of NKG2D by its ligands is critical for both innate and adoptive immunity. While the overexpression of NKG2D ligands on certain tumour cells has previously been demonstrated, little is known about NKG2D ligand expression on human laryngeal tumour cells. In this study, we first verified that the interaction between NKG2D and its ligands was critical for NK cell-based immune response to human laryngeal squamous carcinoma cells Hep-2. This NKG2D-mediated effect was observed by transfecting the recombinant eukaryotic expression vector pEGFP-N1/NKG2D as well as the NKG2D blockade. The mRNA and protein expression of NKG2D ligands, MHC class I-related chain molecules A (MICA) and UL16-binding proteins (ULBPs), in human laryngeal carcinoma cell line Hep-2 and fresh tumour tissues were evaluated. Compared with non-tumour tissues of vocal cords polyps, MICA and ULBP-3 were strongly overexpressed on both the human laryngeal carcinoma cell line Hep-2 and fresh human laryngeal carcinoma tissues. The mechanism and impact of NKG2D ligands overexpression on NK cell-mediated anti-laryngeal cancer immune response would require further investigation.

Introduction

Natural killer (NK) cells form a first line of defence against pathogens or host cells that are stressed or cancerous [1]. NK cells express surface receptors that receive signals from the environment and determine their response to foreign or malignant cells. The effector functions of NK cells are regulated by integrated signals across the array of stimulatory and inhibitory receptors engaged upon interaction with target cell surface ligands [2].

NKG2D represents a major activating receptor involved in the induction of cytotoxicity by NK cells and CD8+ T cells. Moreover, NKG2D is emerging as an important activating receptor that bridges the gap between innate and adoptive immunity and that can act as a co-stimulatory molecule in a similar manner as CD28 [3, 4]. MICA and ULBP-1, -2 and -3 are well-known ligands for NKG2D. These ligands not only activate NK cells but also deliver co-stimulatory signals to CD8+ T cells and γδ T cells [5, 6].

Although it has been recently demonstrated that MICA and ULBPs are specifically expressed by certain tumour cells and NKG2D-dependent cytotoxicity strictly correlates with the expression of MICA and ULBPs on tumours [2, 7], the expression of NKG2D ligands in human laryngeal squamous carcinoma cells has not been investigated. In this study, we demonstrated that the interaction between NKG2D and its ligands significantly increases the cytotoxicity to Hep-2 cells, a human laryngeal carcinoma cell line. By using reverse transcription-polymerase chain reactions (RT–PCR), flow cytometry (FACS) and western blot, we found that MICA and ULBP-3 mRNA and protein expression were significantly increased in both human laryngeal carcinoma cell line Hep-2 and fresh tumour tissues from the patients with human laryngeal squamous carcinoma. These results suggest that NKG2D ligands, MICA and ULBP-3 may play an immunoregulatory role in human laryngeal squamous carcinoma.

Materials and methods

Cells, cytokines, antibodies and cell culture.  YT, one type of the human NK cell lines, originally derived from a patient with acute lymphoblastic lymphoma and thymoma [8], was kindly provided by Dr. Jimin Wang from the Research Center of Molecular Immunoregulation, United States National Institutes of Health. YT/NKG2D cells are YT cells that were transfected with recombinant eukaryotic expression vector pEGFP-N1/NKG2D [9]. Both YT cells and YT/NKG2D were cultured in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS) and 200 U/ml IL-2. Hep-2 (ATCC, Manassas, VA, USA), the human larynx cancer cell line, was preserved in our laboratory and was maintained in RPMI 1640 supplemented with 10% heat-inactivated FCS.

Recombinant human IL-2 (1.5 × 107 IU/mg) was purchased from Changchun Changsheng Gene Pharmaceutical (Changchun, China). Neutralizing antibodies to NKG2D (Clone: 149810) were purchased from R&D Systems (Minneapolis, MN, USA). In the blocking NKG2D receptor experiments for examining the effect of NKG2D on NK cells, both YT cells and YT/NKG2D cells were incubated in the presence of anti-NKG2D antibodies (10 ug/ml) for 30 min before washing and adding to cytotoxicity assays.

Tissues.  Surgical fragments were collected from patients undergoing surgery for different stages of squamous carcinoma of the larynx. All tumours were histologically classified and graded according to the World Health Organization nomenclature. None of the patients had received chemotherapy or radiation therapy and no immunotherapy either within 2 months prior to surgery. Control non-neoplastic tissues consisted of samples of vocal cords polyps. The Ethical Committee of Shandong University School of Medicine approved the study, and all patients gave informed consent. Representative samples of tumours and controls vocal cord polyps were collected at surgery and embedded immediately in Eppendorf tubes and stored at −80 °C to avoid RNA and protein degradation until sectioning for analysis.

Twenty-one patients presented here were seen between July 2004 and November 2006 at the Department of Otolaryngology of The Second Hospital of Shandong University, Jinan, China. The patients fulfilled the criteria for laryngeal carcinoma, and the tumours were histocytologically proven (Table 1). Five cases of vocal cords polyps were selected as controls. The controls were diagnosed to have no other disease.

Table 1.   Patients characteristics.
CharacteristicsLaryngeal carcinomas
Median age (range)56.2 (39–75)
Gender
 Male15
 Female6
Histology
 Advanced differentiation squamous carcinomas7
 Middle differentiation squamous carcinomas8
 Poor differentiation squamous carcinomas6
TNM stage
 I–II13
 III–IV8

Cytotoxicity assay.  Hep-2 cells (104 cells/well), labelled with chromium 51Cr isotope, were incubated for 90 min in a total volume of 200 μl with effector cells YT or YT/NKG2D in 10% FCS-RPMI 1640 in 96-well round-bottom microtitre plates at various cell concentrations in order to achieve effector–target (E:T) ratios. Plates were incubated for 4 h after which they were centrifuged, and the supernatant harvested and counted in a gamma counter. The percentage of 51Cr release was calculated as follows: 100 × [(experimental release − spontaneous release)/ (maximum release − spontaneous release)]. Spontaneous release was less than 15% of the maximal release.

Semiquantitative reverse transcription–polymerase chain reaction.  The sequences of the primers used were listed in Table 2. β-actin controls were designed by us to be 18–24 nucleotides long and to have a 100% homology with particular regions of the gene. The gene sequences were obtained using the Oligo Primer Analysis Software, Version 5.0 (NBA, Software and Research Services for Tomorrow’s Discoveries, National Biosciences, Plymouth, MN, USA). PCR oligomers were synthesized by a DNA/RNA synthesizer (Applied Biosystems, Hefei, China) at the University of Science & Technology of China Oligonucleotide Synthesis Facility.

Table 2.   Oligonucleotide-specific primers used to demonstrate NKG2D ligands expression in laryngeal carcinoma specimens and Hep-2.
Aim geneOligonucleotide sequencebp length
  1. F, forward primer; R, reverse primer.

β-actin
 F5′gtggggcgccccaggcacca 3′539
 R5′ctccttaatgtcacgcacgattt 3′
MICA
 F5′cacagtcttcgttataacct 3′537
 R5′ tgttctcctcaggactacgc 3′
ULBP-1
 F5′ccgccagccccgccttcct 3′522
 R5′catccctgttcttctcccacttct 3′
ULBP-2
 F5′gtcacaacggcctggaaagcaca 3′479
 R5′ tgaagcaggggaggatgatgagga3′
ULBP-3
 F5′ cgggccgacgctcactct 3′454
 R5′ gtccgctatccttctcccacttct 3′

The RT–PCR method was used as previously described [10]. Briefly, RNA was extracted from tissues using the acid–guanidinium phenol–chloroform method. The quality of the RNA yield was assessed by electrophoresis on a 1.5% agarose gel in 0.5 m TBE buffer, demonstrating the typical 28S and 18S bands of the total RNA in all RNA yield from the tissues enrolled in this study. The amount of each RNA sample was measured by optical density reading, and only RNA samples showing an A260–A280 ratio from 1.8 to 2.0 were used to obtain cDNA. RT-PCR was performed using RNA PCR kit (Perkin-Elmer, Norwalk, CT, USA). Cellular RNA (1 μg) was reversely transcribed into cDNA in a reaction mixture containing 1 × buffer, 1 mm dNTP, 2.5 μm oligo (dT) primer, 1 U RNAse inhibitor, and 2.5 U reverse transcriptase. After incubation at 37 °C for 60 min, the reaction was terminated by heating at 95 °C for 5 min. PCR was performed using the forward and reverse primers described in Table 2. The PCR reaction buffer (25 μl), consisting of 2 mm MgCl2, 0.5 μm of each primer, and 1 U AmpliTaq DNA polymerase (5 μl of each reverse-transcriptase solution) was added to an amplification tube. PCR was run for 33 cycles. Each cycle consisted of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min. Twenty-microlitre aliquots of the amplified product were fractionated on a 1.5% agarose gel and visualized by ethidium bromide staining. The band intensity of ethidium bromide fluorescence was measured using NIH/1D Image Analysis Software Version 1.61 (National Institutes of Health, Bethesda, MD, USA). The relative intensity (RI) of each band was determined with the use of the ratio to β-actin. To exclude the possibility of carry-over contamination, reactions containing all RT-PCR reagents including cytokine PCR primers without sample RNA were used as negative controls. No contamination was detected.

Flow cytometry.  Monoclonal anti-human MICA antibody (Clone: 159227) and anti-human ULBP-3 antibody (Clone: 166510) were obtained from R&D Systems. PE-conjugated goat anti-mouse IgG was purchased from BD Phamingen (San Diego, CA, USA). Immunofluorescence staining was conducted using standard protocols. Briefly, cultured cells (Hep-2 cells) were washed twice in washing buffer (PBS with 5% FCS) and resuspended in 100 μl staining buffer (PBS with 0.5% BSA and 0.1% NaN3) at 106/ml. Cells were added to individual wells of U-bottom 96-well plates to be blocked with mouse serum for 30 min at 4 °C, and were stained first with anti-MICA or ULBP-3 antibody (murine IgG) and then stained with anti-mouse IgG-PE incubated for 1 h at 4 °C; the cells were then washed three times in washing buffer and fixed with PBS containing 1% (w/v) paraformaldehyde. The samples were examined on a one-colour flow cytometry FACScan (Becton Dickinson, Franklin Lakes, NJ, USA) and the data were analyzed with WinMDI software.

Western blot.  Tissues or cells were performed for 30 min at 4 °C with lysis buffer containing 25 mm HEPES (pH 7.6), 1% Triton X-100, 150 mm NaCl, 3 mmβ-glycerophosphate, 3 mm EDTA, 0.1 mm sodium orthovanadate, 1 mm phenyllmethylsulfonyl fluoride, and lysates were centrifuged at 15 000 rpm for 20 min at 4 °C to remove nuclei and undisrupted tissues or cells. Protein concentration was determined using Bio-Rad protein assay solution with BSA as standard. Membrane proteins were loaded and run on standard 10% SDS–polyacrylamide gel in Tris-glycine electrophoresis buffer [25 mm Tris, 200 mm glycine (pH 8.3) and 0.1% SDS]. Proteins were transferred to nitrocellulose membrane in 200 mm glycine, 25 mm Tris (pH 8.3), and 20% methanol at 100 V for 2 h in a water-cooled transfer apparatus. The membrane was blocked in a blocking buffer, PBS containing 5% non-fat milk, at room temperature for 1 h. The membrane was then probed overnight at 4 °C with monoclonal antibodies against NKG2D, MICA, ULBP-3 and α-Smooth Muscle Actin (Clone: 1A4, R&D Systems) in the blocking buffer. After the membrane was washed three times at 5-min intervals in PBS-T, the membrane was subsequently incubated with goat anti-mouse IgG-HRP (R&D Systems) diluted to 1:1000 in the blocking buffer for 2 h at room temperature. After the membrane was washed three times at 5-min intervals in PBS-T, the bound antibodies were detected using a chemiluminescent substrate kit (Amersham, Piscataway, NJ, USA).

Statistical analysis.  To determine whether significant differences existed in the killing effection between the transfected and untransfected YT cell with recombinant eukaryotic expression vector pEGFP-N1/NKG2D, a paired Student’s t-test was performed using spss (Version 11.5; SPSS Inc., Chicago, IL, USA). A value of P < 0.05 was considered statistically significant. The Independent-Samples T-test was used to determine the significance between the average mRNA expression of each NKG2D ligand in fresh tumour tissues and controls. Differences were considered significant when the P-value was <0.05.

Results

YT cells transfected with NKG2D significantly enhanced cytotoxicity to Hep-2 cells

YT cells are a human NK cell line with minimal NKG2D expression [11]. In order to investigate whether human laryngeal squamous carcinoma cells are sensitive to NKG2D-mediated cytotoxicity, we transfected the recombinant eukaryotic expression vector pEGFP-N1/NKG2D into YT cells to examine the NKG2D-mediated cytotoxicity to Hep-2 cells. As shown in Fig. 1A, the NKG2D protein expression of YT/NKG2D cells was stronger than YT cells and a little more higher than naive NK cells too. Line YT/NKG2D in four different E:T ratios (1.25:1, 2.5:1, 5:1 and 10:1) were all increased significantly (P < 0.05, P < 0.01, P < 0.01 and P < 0.01, respectively) as shown in Fig. 1B, suggesting that an adequate amount of NKG2D ligands exist on Hep-2 cells for triggering human NK cytotoxicity through NKG2D.

Figure 1.

 NKG2D protein expression and cytotoxicity assay of YT/NKG2D or YT to Hep-2 cells. (A) NKG2D protein expression of YT cells, YT/NKG2D cells and naive NK cells were determined by Western blot. The experiments were repeated three times. (B) YT/NKG2D or YT cells were incubated with target cells Hep-2 for 90 min in different E/T (effector–target ratio). The method used to detect cytolysis was the 4-h 51Cr-release assay. Coordinate axis X shows the different E/Ts to be 1.25:1, 2.5:1, 5:1 and 10:1. Coordinate axis Y shows the percentage of 51Cr release. All results are representative of four triplicate samples.

NKG2D blockade decreases the ability of YT/NKG2D cells to kill Hep-2 cells

In order to verify that the enhanced cytotoxicity of YT cells transfected with NKG2D is due to NKG2D–NKG2D ligands interaction, anti-NKG2D mAb were incubated with YT/NKG2D cells before testing for cytolysis against Hep-2 cells. As shown in Fig. 2, NKG2D blockade significantly inhibited NK cytolysis against Hep-2 cells, indicating that the interaction between NKG2D and NKG2D ligands is one critical factor for NK cell-based immune response.

Figure 2.

 The effects of blocking NKG2D receptors on cytotoxicity of YT/NKG2D cells to Hep-2. YT/NKG2D cells were first incubated with or without anti-NKG2D mAb for 30 min, then incubated with target cells Hep-2 for 90 min (E:T was 5:1). The method used to detect cytolysis was the 4-h 51Cr-release assay. All results shown were representative of four triplicate samples. Statistical significance of the data was determined by a paired Student’s t-test. P < 0.05 was considered significant.

MICA and ULBP-3 mRNA and protein predominant expression in human laryngeal carcinoma cell line Hep-2

Because of the importance of interaction between NKG2D and its ligands in the NK cell-mediated immune responses against human laryngeal carcinoma cell line Hep-2, we next evaluated the mRNA and protein expression of NKG2D ligands MICA and ULBPs in human laryngeal carcinoma cell line Hep-2. Total RNA from Hep-2 was determined by RT-PCR. The mRNA expressions of MICA and ULBP-1, -2 and -3 in Hep-2 were analyzed. MICA and ULBP-3 were detected at high levels while ULBP-1 and -2 had moderate expression (Fig. 3A,B). Subsequently, we analyzed the presence of MICA and ULBP-3 on the Hep-2 cell surface by flow cytometry. The mean fluorescence intensity was positive, which showed a good complement to the finding of the increased levels of mRNA (Fig. 3C,D).

Figure 3.

 MICA and ULBP-3 mRNA and protein expression in human laryngeal carcinoma cell line Hep-2. (A) The mRNA expression of NKG2D ligands in Hep-2 cells. RT–PCR was performed using RNA PCR kit (Perkin-Elmer, Norwalk, CT, USA). Twenty-microlitre aliquots of the amplified product were fractionated on a 1.5% agarose gel and visualized by ethidium bromide staining. All samples were determined immediately after collection. All experiments were repeated two times and each sample was triplicated in each experiment. 1, 1 kb DNA ladder; 2, β-actin; 3, MICA; 4, ULBP-1; 5, ULBP-2; 6, ULBP-3. (B) Graphical analysis of relative density on mRNA expression of NKG2D ligands in Hep-2 cells compared to β-actin control. (C,D) Surface expression of MICA or ULBP-3 on Hep-2 cells analyzed by histology with anti-MICA-PE or anti-ULBP-PE. All results are representative of four triplicate samples.

MICA and ULBP-3 mRNA and protein predominant expression in fresh tumour tissues from the patients with human laryngeal squamous carcinoma

As predominant expression of MICA and ULBP-3 mRNA and protein in the Hep-2 cells were observed, we next analyzed the fresh tumour tissues from the patients with human laryngeal squamous carcinoma for NKG2D ligands mRNA and protein expression. The clinical characteristics of each patient were given in Table 1. The mRNA for MICA and ULBPs in fresh tissues from laryngeal carcinoma and controls were determined by RT-PCR. The mRNA expressions of MICA and ULBP-1, -2, -3 in 21 isolates from laryngeal carcinoma patients were shown in Table 3. Significant increase of MICA and ULBP-3 mRNA expression was observed in fresh tumour tissues compared to controls, non-neoplastic tissues consisting of samples of vocal cords polyps (Fig. 4A,B). No significant difference was observed in mRNA expression among the pathological stage of human laryngeal carcinoma tissues (Fig. 4C). The predominant protein expression of MICA and ULBP-3 in fresh laryngeal carcinoma tissues determined by western blot was a good complement to the finding of the increased levels of the mRNA (Fig. 4D).

Table 3.   The mRNA expression of NKG2D ligands in tissues specimens of 21 laryngeal cancer patients.
TumourMICAULBP-1ULBP-2ULBP-3
10.598<0.1<0.10.867
20.4850.156<0.10.465
30.2640.123<0.10.482
40.632<0.10.1460.289
50.7560.2870.2630.886
60.5110.3120.2150.798
70.568<0.10.3010.635
80.623<0.1<0.10.687
90.7130.1550.4350.809
100.256<0.10.5560.854
110.5180.4180.1280.502
120.341<0.1<0.10.611
130.8050.2310.2380.835
140.4310.179<0.10.968
150.189<0.1<0.10.227
160.5950.4320.4560.887
170.6540.5120.5320.912
180.7950.7850.7860.962
190.4260.1250.1340.796
200.5460.216<0.10.586
210.807<0.10.2080.934
Total (X ± S)0.548 ± 0.182 0.206 ± 0.195 0.228 ± 0.2110.714 ± 0.220
Figure 4.

 The mRNA and protein expression of NKG2D ligands in fresh tumour tissues from the patients with human laryngeal squamous carcinoma. (A) The average mRNA expression of MICA and ULBP-1, -2, -3 in fresh tumour tissues contrasted with controls. The P-values of both MICA and ULBP-3 were < 0.01 while that of ULBP-1, -2 were all > 0.05. The Independent-Samples T-test was used. All experiments were repeated two times and each sample was triplicated in each experiment. (B) NKG2D ligands mRNA expression of two representative laryngeal vocal cords polyps controls and four representative samples of the 21 laryngeal cancer patients. (C) The average mRNA expression of NKG2D ligands in tumours pathological stage I–II and III–IV. (D) MICA and ULBP-3 protein expression of one representative laryngeal vocal cords polyps control and two representative samples of the 21 laryngeal cancer patients determined by Western blot. The experiments were repeated three times.

Discussion

Engagement of NKG2D by its ligands is critical for immune responses against human tumours. The results presented here definitively demonstrate that predominant expression of MICA and ULBP-3 mRNA and protein in human laryngeal squamous carcinoma cells is an important characteristic feature, and interaction between NKG2D and its ligands is one critical factor for NK cell-based immune responses to human laryngeal squamous carcinoma cell line Hep-2.

Natural killer cells are an essential component of the innate immune system and play a critical role in tumour immune surveillance [12]. NK cells also establish crosstalk with dendritic cells (DCs) and promote a Th1-mediated immunity [13]. NKG2D is a pivotal receptor that directs the anti-tumour activity of NK cells through the recognition of ligands including MICA and ULBPs which are widely expressed on different tumours [14, 15].

Recent studies reveal that the expression of MICs and ULBPs on human tumour cells is sufficient to overcome the inhibitory effects of MHC class I expression on NK cell killing and indicate that NKG2D provides first line surveillance against stressed or abnormal cells that have been induced to express one of its ligands [16]. For example, ULBPs induce NK cells to produce multiple cytokines and chemokines, including GM-CSF, IFN-γ, TNF-α, MIP-1β and I-309. IFN-γ and TNF-α are important anti-viral cytokines, whereas GM-CSF, MIP-1β and I-309 function in vivo to recruit and activate NK cells, macrophages, and other components of both the innate and adoptive immune systems.

Besides inducing cytokine and chemokine production, ULBPs stimulate potent NK cytotoxicity against tumour targets [17–19]. Engagement of ULBPs or MICs expressed on target cells by NKG2D overcomes inhibitory signals generated by MHC class I recognition by NK cells and triggers granule exocytosis [20]. Impairment of NK cell cytolytic function by reducing activating receptors such as NKG2D is associated with increased disease progression [21].

Our data demonstrate that NK cells transfected with NKG2D significantly enhanced the cytotoxicity of Hep-2 cells, suggesting that further adoptive immunotherapy for human laryngeal squamous carcinoma might be tried by upregulating the expression of NKG2D.

Acknowledgment

This research is supported by Young Scientist Award (Q2006C10) by Natural Science Foundation of Shandong, China.

Ancillary