The Arabidopsis transcription factor HY5 integrates light and hormone signaling pathways

Authors


For correspondence (fax +1 514 398 5069; e-mail christian.hardtke@mcgill.ca).

Summary

The role of the Arabidopsis transcription factor LONG HYPOCOTYL 5 (HY5) in promoting photomorphogenic development has been extensively characterized. Although the current model for HY5 action largely explains its role in this process, it does not adequately address the root phenotype observed in hy5 mutants. In our search for common mechanisms underlying all hy5 traits, we found that they are partly the result of an altered balance of signaling through the plant hormones auxin and cytokinin. hy5 mutants are resistant to cytokinin application, and double mutant analyses indicate that a decrease in auxin signaling moderates hy5 phenotypes. Microarray analyses and semiquantitative RT-PCR indicate that two negative regulators of auxin signaling, AUXIN RESISTANT 2 (AXR2)/INDOLE ACETIC ACID 7 (IAA7) and SOLITARY ROOT (SLR)/IAA14, are underexpressed in hy5 mutants. The promoters of these genes contain a putative HY5 binding site, and in line with this observation, HY5 can bind to the promoter of AXR2 in vitro. Increased AXR2 expression in a hy5 background partially rescues the elongated hypocotyl phenotype. In summary, it appears that auxin signaling is elevated in hy5 mutants because HY5 promotes the expression of negative regulators of auxin signaling, thereby linking hormone and light signaling pathways.

Introduction

An extensive molecular network controls the promotion of light-adapted (photomorphogenic) development in Arabidopsis. Upstream receptors transmit the light signal to downstream effectors, which ultimately control the expression levels of light-regulated genes (Hardtke and Deng, 2000; Nagy and Schäfer, 2000; Neff et al., 2000). The basic leucine tipper (bZIP) transcription factor LONG HYPOCOTYL 5 (HY5) is a positive regulator of photomorphogenesis (Koornneef et al., 1980), which acts downstream of the light receptor network and directly affects the transcription of light-induced genes (Ang et al., 1998; Chattopadhyay et al., 1998). HY5 activity is controlled by a key negative regulator, CONSTITUTIVE PHOTOMORPHOGENIC 1 (COP1), an ubiquitin ligase that targets HY5 for degradation in dark-grown conditions (Osterlund et al., 2000; Saijo et al., 2003). Several other transcription factors that interact with COP1 are likely to be regulated in the same manner and might act in a partially redundant or synergistic manner with HY5 (Holm et al., 2002).

A recessive hy5 null allele was originally identified because hy5 seedlings are defective in light-induced inhibition of hypocotyl elongation (Koornneef et al., 1980). However, a hy5 null allele has also been found in a screen for mutants with altered root morphology (Oyama et al., 1997). The hy5 mutation affects several aspects of root morphogenesis. The most obvious phenotype is that hy5 seedlings have an elevated number of lateral roots. These lateral roots also grow faster and they, as well as the primary root, are less responsive to gravitropic stimulus. Moreover, root hairs are longer in hy5 seedlings than in wild type.

The hy5 phenotypes might, at least in part, be because of altered hormone signaling, which could explain the role of HY5 in both photomorphogenesis and root development. Major traits affected in hy5 mutants, i.e. inhibition of hypocotyl elongation, greening, anthocyanin accumulation and lateral root formation, are known to depend to some degree on the action of hormones. For instance, application of cytokinin to Arabidopsis seedlings results in increased anthocyanin pigmentation (Deikman and Hammer, 1995). Elevated cytokinin doses can even mimic the phenotype of constitutive photomorphogenic (de-etiolated) mutants (Chory et al., 1994), i.e. mutants that display a light-grown morphology in darkness. Another hormone, auxin, influences the inhibition of hypocotyl elongation. In addition, the phenotypes of some mutants implicate the auxin signaling pathway in photomorphogenesis, e.g. the suppressor of hy2 (shy) mutants that display a partially de-etiolated morphology in darkness (Kim et al., 1996). Both SHY genes are members of the IAA gene family that encodes negative regulators of auxin signaling (Gray et al., 2001; Liscum and Reed, 2002; Tian and Reed, 1999; Tiwari et al., 2001; Zenser et al., 2001). Interestingly, the activity of several IAA proteins might be modified through phosphorylation by photoreceptors (Colon-Carmona et al., 2000). Also, the RESPONSE REGULATOR 4 protein, a possible mediator of cytokinin action, directly interacts with phytochrome B and stabilizes its active form (Sweere et al., 2001). In summary, physiological experiments and mutant analyses suggest a link between hormone and light signaling pathways; however, the mechanistic basis for this cross-talk is still poorly understood (Swarup et al., 2002).

In this study, we analyzed the effects of systemic hormone applications on hy5 mutants. We demonstrate that hy5 traits are partly the result of an altered balance of signaling through auxin and cytokinin. These perturbations of hormone signaling appear to be more profound in the root than in the shoot. Based on expression analyses, we suggest that auxin signaling is elevated in hy5 mutants because of decreased expression of two negative regulators of auxin signaling, the AUXIN RESISTANT 2 (AXR2)/IAA7 and SOLITARY ROOT (SLR)/IAA14 genes. Thus, HY5 is involved in promoting the transcription of light, as well as auxin signaling genes, thereby linking hormone and light signaling pathways.

Results

Lateral root formation in hy5 seedlings is accelerated

To better understand the relation between hy5 traits, we re-examined the root phenotype of hy5 mutants. In the following, we use the term ‘emerged lateral roots’ for lateral roots in or beyond stage VII, as defined by Malamy and Benfey (1997). By contrast, we use the term ‘lateral root primordium’ for developing lateral roots that are easily identifiable by light microscopy, from stage II through VI.

Lateral root formation is, to a large degree, under environmental control. For instance, a high sucrose to nitrogen ratio in the medium suppresses lateral root formation (Malamy and Ryan, 2001). By contrast, we found that the addition of increasing amounts of sucrose (up to 3%) to Murashige and Skoog basal salt mixture medium stimulates lateral root formation. Notably, hy5 seedlings respond to these treatments, similar to wild type (e.g. Figure 1a), indicating that hy5 seedlings can correctly respond to environmental inputs that affect lateral root formation. In all cases tested, hy5 seedlings initially develop longer and more lateral roots than wild type, which is in line with previously reported findings (Oyama et al., 1997). Accordingly, the number of lateral root primordia in young seedlings without any emerged lateral roots is higher in hy5 than in wild type (Figure 1b). However, with the exception of plain agar medium, the total number of lateral roots after 10 days of growth was very similar in hy5 and wild type (Figure 1a).

Figure 1.

Lateral root formation in hy5 mutant seedlings.

(a) Number of emerged lateral roots in Ws wild type or hy5-KS50 seedlings 7–10 dag on indicated media.

(b) Number of lateral root primordia in Col wild type or hy5-215 seedlings 3 and 4 dag.

(c) Number of emerged lateral roots in intact Col wild type or hy5-215 seedlings (control) and seedlings from which the shoot was decapitated 4 or 7 dag. Lateral roots were counted 10 dag.

(d) Same as in (c), except that the number of lateral root primordia is given.

Between 8 and 24 seedlings were assayed for each data point. Error bars represent SEM.

Lateral root formation in hy5 seedlings is less dependent on shoot-derived auxin

Decapitating the shoots of seedlings at less than 6 days after germination (dag) results in strongly decreased root growth and lateral root emergence because of the lack of shoot-derived auxin (Bhalerao et al., 2002; Reed et al., 1998). When seedlings were decapitated 7 dag, the number of lateral roots visible 3 days later was roughly similar between hy5 and wild type; this is in line with our above observations (Figure 1a). However, when seedlings were decapitated earlier, no lateral roots emerged at all from wild-type seedlings, while several emerged in hy5 seedlings (Figure 1c). As shown in Figure 1(b), there were more lateral root primordia in hy5 than in wild type at 4 dag (Figure 1d). This relation is inversed in the seedlings cut at 4 dag and scored at 10 dag, because unlike the primordia of wild-type seedlings, those of hy5 seedlings had emerged. Therefore, lateral root emergence appears to be less dependent on auxin derived from the first true leaf primordia in hy5 than in wild type.

hy5 seedlings are slightly resistant to systemic auxin application

The possible involvement of auxin in the hy5 root phenotype prompted us to investigate whether other auxin responses in hy5 seedlings are altered in tissue culture experiments. The primary root growth of mutants affecting auxin homeostasis or signaling is often more resistant to externally applied auxin than that of wild type (Leyser, 2002). hy5 roots are indeed slightly resistant to low doses of auxin (Figure 2a); however, this resistance is rather weak when compared to mutants, such as axr4 or tir1 (transport inhibitor response) (Figure 2b). Furthermore, systemic application of high doses of auxin to hy5 seedlings does not result in the characteristic formation of thickened, callus-like lateral root tissue as in wild type (Figure 2c). In summary, the responses of hy5 roots to externally applied auxin are slightly disturbed.

Figure 2.

Hormone response phenotypes of hy5 mutants.

(a) Relative inhibition of primary root growth in Col wild type or hy5-215 mutant seedlings grown on medium containing 0.5× MS salts, 1% sucrose, and increasing concentrations of the auxin 2,4D.

(b) Comparison of auxin resistance between Col, hy5-215 and tir1-1 seedlings on medium containing 0.5× MS salts, 2% sucrose, and 15 nm 2,4D.

(c) Response of the primary roots of Col or hy5-215 seedlings after transfer onto medium containing 0.5× MS salts, 1% sucrose, and 1.0 µm 2,4D. Four-day-old seedlings were transferred and close-up pictures of roots were taken 7 days later.

(d) Relative inhibition of primary root growth in Col or hy5-215 seedlings grown on 0.5× MS salts, 1% sucrose, and increasing concentrations of the cytokinin benzylaminopurine (BA).

(e) Inhibition of shoot growth in plants germinated and maintained on medium containing 0.5× MS salts, 1% sucrose, and 0.1 µm of the cytokinin, kinetin, 14 dag. Ws wild type, hy5-KS50, and hy5-KS50 plants carrying a 35S::HY5 transgene are shown.

(f) Relative content of auxin and cytokinin in Ws and hy5-KS50 seedlings (average of four independent samples). Hormone content was determined by colorimetric immunoassays; the absorption in relation to wild type is indicated (inverse correlation, i.e. a higher value equals less hormone).

A minimum of 12 seedlings were assayed for each data point. Error bars represent SEM.

hy5 seedlings are strongly resistant to systemic cytokinin application

Development in Arabidopsis is in many instances influenced by the balance between signaling through auxin and cytokinin (e.g. Chatfield et al., 2000), which is consistent with the idea that cytokinin antagonizes auxin action (Skoog and Miller, 1957). Therefore, we also tested the response of hy5 mutants to cytokinin application. Just as for auxin, externally applied cytokinin inhibits primary root growth. Strikingly, the roots of hy5 seedlings are considerably resistant to this treatment (Figure 2d). Moreover, hy5 is also resistant to application of inhibitory cytokinin concentrations in other assays, such as shoot growth inhibition (Figure 2e). Notably, transgenic rescue of hy5 mutants with a 35S:HY5 construct restores wild-type traits (e.g. Figure 2e; Hardtke et al., 2000).

Callus formation from hy5 tissue is attenuated

To test whether the auxin- and cytokinin-related phenotypes of hy5 are a result of alterations in the endogenous levels of these hormones, we determined the levels of native auxin and cytokinin in hy5 and wild-type seedlings by immunoassays. In these tests, hormone levels were comparable between wild-type and mutant seedlings, with a possibly slightly lower auxin level in hy5 (Figure 2f).

To determine whether the hy5 phenotypes are because of changes in hormone signaling, we tested the responses of hy5 tissue in regeneration experiments. We cut hypocotyl and root segments from 4-day-old wild-type and hy5 seedlings and incubated them on tissue culture medium that favored callus formation. At the optimum callus-inducing auxin and cytokinin concentrations for wild-type tissue in our conditions, hypocotyl tissue from hy5 seedlings formed roots rather than callus (62.5 ng ml−1 2,4D (2,4-Dichlorophenoxyacetic acid); 50 ng ml−1 kinetin; Figure 3a; calli shown in Figures 3a–d and 4a are representative of >90% of explants). Root explants from hy5 seedlings were hardly ever able to form callus in our hands. Thus, hy5 tissues failed to correctly respond to callus-inducing medium, and this defect was more pronounced in root tissue rather than in shoot tissue (Figure 3a).

Figure 3.

Phenotype of hy5 and cop1 mutants in tissue culture.

(a) Response of Ws and hy5-KS50 tissue explants to callus-inducing tissue culture conditions. Hypocotyl and root explants of 4-day-old seedlings were transferred onto the indicated media, and pictures were taken 4 (hypocotyl) or 6 (root) weeks later.

(b) Response of Ws and hy5-KS50 tissue explants to tissue culture media containing kinetin and increasing amounts of the lipid-soluble auxin NAA. Hypocotyl and root explants of 4-day-old seedlings were transferred onto the indicated media, and pictures were taken 4 (hypocotyl) or 6 (root) weeks later.

(c) Response of Ws and hy5-KS50 tissue explants to shoot-inducing tissue culture conditions. Hypocotyl explants of 4-day-old seedlings were transferred onto callus-inducing medium for 1 week, then transferred to shoot-inducing medium containing increasing amounts of cytokinin (isopentenyladenine), and pictures were taken 4 weeks later.

(d) Response of Col, cop1-4, and hy5-215 tissue explants to callus-inducing tissue culture conditions. Hypocotyl and root explants of 4-day-old seedlings were transferred onto the medium, and pictures of both tissues were taken 4 weeks later.

(e) Expression of HY5 in callus tissue. Protein from 3-week-old callus tissue regenerated from hypocotyls of the indicated genotypes was separated by SDS–PAGE, and corresponding Western blots were probed with anti-HY5 antibody. The upper band (asterisk) indicates a cross-hybridizing protein previously noted by Osterlund et al. (2000).

A minimum of 12 samples were assayed for each data point. Error bars represent SEM.

Figure 4.

Double mutant analyses.

(a) Response of wild type, hy5-215, axr4-1, tir1-1, hy5-215/axr4-1, and hy5-215/tir1-1 tissue explants to callus-inducing culture conditions (62.5 ng ml−1 2,4D; 400 ng ml−1 kinetin). Hypocotyl and root explants of 4 day-old seedlings were transferred, and pictures were taken 4 (hypocotyl) or 6 (root) weeks later.

(b) Number of emerged lateral roots in wild type, hy5-215, tir1-1, and hy5-215/tir1-1 seedlings 7 and 9 dag. A minimum of 12 seedlings were assayed for each data point. Error bars represent SEM.

(c) Hypocotyl length of the seedlings analyzed 7 dag in (b).

As hy5 seedlings display strong cytokinin resistance, we tried to enhance callus growth from hy5 tissue by elevating the dose of cytokinin in the medium. Indeed, this treatment resulted in callus formation from hypocotyl tissue, while a much weaker effect was observed on root tissue. However, these calli grew much slower than wild-type calli and displayed a strong reduction in greening (Figure 3a). We also tested whether the reduced callus formation of hy5 tissues could be rescued by the application of increasing amounts of auxin. Among others, we also tested a lipid-soluble auxin, NAA, to rule out any defects in auxin uptake as the source of the phenotype (Figure 3b). No enhancement of callus formation by hy5 tissue was obtained with this treatment. Rather, elevated auxin levels progressively suppressed callus formation in the wild type.

Finally, in line with the cytokinin resistance of hy5 seedlings, the ability of hy5 tissue to form shoots in the presence of high levels of cytokinin versus auxin is strongly decreased as well (Figure 3c).

The cop1 mutant phenotype is opposite to hy5, not only in photomorphogenesis but also in root and tissue culture traits

The cop1 mutant phenotype is opposite to hy5 in photomorphogenesis, i.e. cop1 mutants develop a light-grown morphology in darkness and are hyperphotomorphogenic in light. Just as for photomorphogenesis, the phenotype of cop1-4 mutants in lateral root and callus formation is opposite to that of hy5. cop1-4 seedlings form very few lateral roots (data not shown) and callus from cop1-4 tissue grows faster than wild type in tissue culture (Figure 3d). HY5 expression is steadily maintained in callus tissue as judged from Western analysis and is overexpressed relative to wild type in a cop1-4 mutant background (Figure 3e). Thus, the level of HY5 protein correlates with the responsiveness of tissue to callus-inducing medium.

Decreasing auxin signaling moderates hy5 phenotypes

The inability of hy5 to respond correctly in our tissue culture experiments could be because of either decreased cytokinin perception or signaling, or increased auxin perception or signaling. To differentiate between these two possibilities, we investigated the phenotype of double mutants between hy5-215 and two recessive auxin-resistant mutants, axr4-1 and tir1-1 (Hobbie and Estelle, 1995; Ruegger et al., 1998). Unlike hy5 tissue, both hypocotyl and root tissue from axr4 and tir1 mutants can easily form callus, implying that auxin resistance does not necessarily preclude callus growth (Figure 4a). In hy5;axr4 and hy5;tir1 double mutants, the ability to form callus is ameliorated as compared to hy5 single mutants (note the occurrence of small greenish callus on the double mutant roots; Figure 4a). The ability of tir1 to suppress hy5 phenotypes is even more pronounced in a whole seedling context, where the lateral root formation is restored to wild type (Figure 4b). However, this suppression appears to be specific to the root and is not apparent with respect to the hypocotyl phenotype (Figure 4c).

Auxin signaling is elevated in hy5 seedlings because of decreased expression of negative regulators

We concluded that the accelerated lateral root formation in hy5 seedlings, the response of hy5 tissue in regeneration experiments, and the phenotype of hy5;tir1 double mutants might be best explained by an elevated level of auxin signaling in hy5 mutants. To test this hypothesis at the molecular level, we sought to monitor global gene expression levels in hy5 mutant tissue and to compare it to wild-type tissue.

To compare global expression patterns, specifically labeled cDNA from each genotype was simultaneously hybridized to DNA microarrays representing c. 14 000 Arabidopsis genes, and the ratio between expression levels in wild type and hy5 was determined. For this analysis, we focused on callus tissue derived from hypocotyl explants. In addition to callus, we also investigated expression levels in root tissue. Moreover, in one experiment, we compared the expression levels in cop1-4 mutant and wild-type callus, because genes that might be underexpressed in hy5 callus might be overexpressed in cop1 callus because of their antagonistic phenotypes. This is, for instance, true for chalcone isomerase (CHI), a gene previously found to be oppositely regulated in cop1 versus hy5 mutants (Ma et al., 2002).

In our analysis of microarray data, we concentrated on genes that are known or suspected to be involved in auxin or cytokinin signaling (Kieber, 2002). Some of these genes appear to be consistently expressed at a lower level in hy5 tissue. Based on the ratios we obtained for our positive control, the CHI gene, and the variation seen with negative control genes, we considered a gene to be underexpressed in hy5 if the average ratio of wild type to hy5 was above 1.5 in at least one of the two tissues and the ratio of cop1 versus wild type was above 1.5 as well. Only 6 out of 110 genes fulfilled these criteria (Table 1). They include four genes that are thought to be involved in auxin signaling. These are the four well-characterized IAA genes: SLR, also known as IAA14; IAA28; AXR2, also known as IAA7; and SHY1, also known as IAA6 (Fukaki et al., 2002; Kim et al., 1996; Liscum and Reed, 2002; Nagpal et al., 2000; Rogg et al., 2001). In addition, two genes potentially involved in cytokinin biosynthesis and signaling, AtIPT6 (isopentenyltransferase 6) and an ethylene-response element-binding factor, also appear to be underexpressed in hy5.

Table 1.  Analysis of Col wild type, hy5-215, and cop1-4 callus or root tissue in microarray hybridization experiments
Gene nameGene IDCol/hy5 calluscop1/Col callusCol/hy5 rootsG-box (CCACGTG) in promoter?
  1. Genes implicated in auxin or cytokinin pathways and represented on the microarray, as well as representative negative controls, are shown. The ratios between the normalized expression levels are given. Values represent the mean of two replicates for two to three experiments (i.e. individual RNA preparations) in the case of Col versus hy5-215 callus, two experiments in the case of Col versus hy5-215 roots, and one experiment in the case of cop1-4 versus Col callus. Genes that are consistently affected in hy5-215 (see text) and contain a HY5 binding site in their promoters are highlighted in bold.

Auxin-related genes
Auxin carriers
 AUX1At1g776900.971.001.00No
 EIR1/PIN2At5g570901.960.991.63No
 LAX1At5g012401.111.901.32No
 LAX2At2g210501.091.041.15No
 PIDAt2g346501.011.010.81Yes
 PIN1At1g735900.971.020.74No
 REH1/PIN3At1g709400.831.091.28No
 At2g014201.580.541.36Yes
Auxin response factors
 ARF1At1g597500.851.090.97No
 ARF4At5g604500.780.771.06No
 ARF6At1g303301.311.560.84No
 ARF8At5g370200.771.061.82No
 ARF9At4g239800.910.591.36No
 ARF18At1g237501.091.561.11Yes
At1g352401.432.160.89No
At1g355401.471.301.01No
At2g465301.272.001.10No
At3g618300.960.690.86No
At1g192201.110.750.94No
 MPAt1g198500.960.640.81No
IAA genes
 IAA1At4g145600.840.471.52No
 IAA2At3g230300.840.901.37No
 IAA3/SHY2At1g042401.191.080.95No
 IAA4At5g437000.950.611.64No
 IAA5At1g155801.031.041.12Yes
 IAA6/SHY1At1g528301.672.300.61No
 IAA7/AXR2At3g230501.362.212.15Yes
 IAA8At2g226700.880.801.25No
 IAA9At5g656700.880.521.66No
 IAA10At1g041001.331.350.96No
 IAA12/BDLAt1g045501.471.180.90No
 IAA13At2g333100.890.651.12No
 IAA14/SLRAt4g145502.562.081.51Yes
 IAA15At1g803901.301.141.29No
 IAA16At3g047300.770.841.25No
 IAA17/AXR3At1g042500.950.941.60Yes
 IAA18At1g519501.001.660.80No
 IAA19/MSG2At3g155401.180.650.87Yes
 IAA20At2g469900.860.551.01Yes
 IAA26/PAP1At3g165000.780.681.54No
 IAA27/PAP2At4g290800.981.062.39No
 IAA28At5g258901.851.621.77No
 IAA30At3g621000.920.620.56Yes
 IAA31At3g176001.471.670.42No
Other (putative) auxin signaling genes
 AXR1At1g051800.930.831.00No
 AXR6/CUL1At4g025700.900.721.19No
 DFL1At5g545100.770.821.51No
 ECR1At5g191800.841.031.93No
 LEPAt5g139101.320.681.41No
 NAC1At1g560101.151.230.68No
 FIN219At2g463700.910.970.94No
 GH3-likeAt1g231601.202.280.90No
 GH3-likeAt1g281300.991.630.73No
 GH3-likeAt4g034000.971.000.83No
 GH3-likeAt4g272600.920.781.33No
 SAUR-AC1-likeAt2g244001.261.690.90No
 SAUR-AC1-likeAt3g038501.421.580.95No
 SAUR-AC1-likeAt3g606900.913.090.93Yes
 SAUR-AC1-likeAt3g619001.541.410.82No
 SAUR-AC1-likeAt4g095301.271.280.67No
 SAUR-AC1-likeAt4g388101.340.721.87No
 TIR1At1g128200.810.781.11No
 TIR3/BIG/DOC1At3g022600.870.761.23No
Cytokinin-related genes
Cytokinin biosynthesis
 ACS1At3g615101.351.601.31No
 ACS2At1g014801.081.320.92No
 ACS6At4g112801.340.800.97No
 ACS9At3g497001.161.660.62No
 AtIPT1At1g684601.401.840.72No
 AtIPT2At2g277600.980.910.96No
 AtIPT3At3g631101.311.940.81No
 AtIPT6At1g254101.531.980.75No
 AtIPT7At3g236301.441.530.91No
 AtIPT8At3g191601.395.380.94No
Cytokinin oxidases
 CKX1At2g415101.141.130.71No
 CKX2At2g195001.451.821.29No
 CKX5/6At1g754500.800.680.91No
 CKX7At3g634400.990.790.46No
Cytokinin + ethylene receptors
 CKI1At2g474301.471.142.07No
 EIN4At3g045800.971.321.26No
 ERS1At2g409400.940.871.25Yes
 ERS2At1g043100.971.091.17No
 ETR1At1g663400.951.140.96No
 ETR2At3g231501.181.081.37No
Phosphorelay proteins
 AHK1At2g178200.820.480.97No
 AHP1At3g215101.570.661.44No
 AHP2At3g293500.951.081.19No
 AHP3At5g393401.710.901.58No
 AHP4At3g163601.511.200.88No
 APHP1At1g801001.301.650.89No
Response regulators
 ARR3At1g599400.841.901.31No
 ARR4At1g104701.331.370.79No
 ARR5At3g481000.941.220.85No
 ARR6At5g629200.560.881.26No
 ARR7At1g190501.611.400.68No
 ARR8At2g413101.062.001.18No
 ARR9At3g570400.950.921.09No
 ARR11At1g677101.432.531.02No
 ARR12At2g251800.981.231.08No
 ARR14At2g017601.431.121.09No
 ARR15At1g748901.371.56n.d.No
 ARR16At2g406701.421.780.58No
 ARR19At1g491901.492.400.98No
 ARR22At3g042801.231.251.03No
Other (putative) cytokinin signaling genes
 ESR1At1g129801.131.570.89No
At1g245901.742.050.76No
At1g281601.452.201.02No
 AtERF11At1g283701.130.371.20Yes
 AtERF12At1g283601.321.261.12Yes
 AtERF3At1g506400.980.891.43No
 AtERF7At3g203101.130.930.99No
 PEPAt5g104800.820.871.33No
Controls
 ACTINAt1g131801.110.830.97No
 TUB1At1g200100.940.781.33No
 CDC2At1g037401.281.020.53No
 CDC2At1g102700.960.800.87No
 CDC2At1g180401.331.341.11Yes
 CDC2At1g765401.341.971.08No
 CDC2At5g649600.951.202.33No
 CHIAt3g551203.632.351.41Yes
 CYCD3At3g500701.121.030.91Yes

HY5 might directly affect the transcription of the AXR2 and SLR genes

Conceivably, some of the variations observed could be a result of indirect effects. Therefore, we applied another criterion to identify genes that are potentially directly regulated by HY5. The HY5 DNA binding activity is well characterized, and two target genes of HY5 have been previously identified and verified in vivo (Ang et al., 1998; Chattopadhyay et al., 1998). In these genes, HY5 binds to an essential G-box motif that has the core sequence CCACGTG. To test for the presence of this sequence, we retrieved 500 base pairs (bp) upstream of the start codon of all genes of interest. Apart from the CHI gene, only two of the auxin- or cytokinin-related genes underexpressed in hy5 contain a HY5 binding site, AXR2 and SLR (Table 1; Figure 5a). To test the expression level of AXR2 and SLR in hy5 by an independent method, we performed semiquantitative RT-PCR with RNA prepared from 4-day-old hy5 and wild-type seedlings. Corroborating the results obtained from microarray hybridizations, AXR2 and SLR were underexpressed in hy5 as compared to wild-type seedlings (Figure 5b). By contrast, the negative control IAA1 was expressed equally in hy5 and wild type. In line with the presence of a HY5 binding site, recombinant HY5 fusion protein can bind to the DNA fragment of the AXR2 promoter in band-shift assays (Figure 5c), unlike an unrelated control protein with the same fusion tag. By contrast, no binding of HY5 to a fragment of the equivalent region of the IAA1 promoter was observed (Figure 5d).

Figure 5.

Control of AXR2 and SLR transcription by HY5.

(a) Sequence alignment of the AXR2 promoter fragment used in (c) and (d), and the corresponding promoter region of SLR. The HY5 binding site is indicated in bold print. The last residue in the AXR2 sequence represents the −65 position with respect to the transcript start.

(b) Representative semiquantitative RT-PCRs of AXR2, SLR, and IAA1 with RNA isolated from 4-day-old Col wild-type or hy5-215 seedlings. The same RNA preparation of each genotype was used in all reactions shown. The dilution of the RT reaction used as PCR template is indicated.

(c) Electrophoretic mobility shift assay of an AXR2 promoter fragment containing a HY5 binding site. 32P-labeled promoter fragment was incubated with increasing amounts of bacterially expressed recombinant His6-T7-tagged HY5 or ubiquitin conjugating enzyme 8 (UBC8) protein. Free and bound probes are indicated by an arrow and asterisk, respectively.

(d) Electrophoretic mobility shift assay of an IAA1 promoter fragment. 32P-labeled promoter fragment was incubated with increasing amounts of bacterially expressed recombinant His6-T7-tagged HY5.

Elevated AXR2 expression partially rescues the hypocotyl phenotype of hy5 mutants

If AXR2 is indeed a direct target of HY5, restoration of AXR2 expression in a hy5 background should at least rescue some aspects of the hy5 phenotype. To test this possibility, we constructed transgenic wild-type and hy5 plants, expressing the AXR2 cDNA under the control of the 35S CaMV promoter. Several independent transgenic lines were produced, and phenotypes were quantified for four lines of each genotype. These observations indicate that elevation of AXR2 expression is sufficient to significantly reduce the excessive hypocotyl elongation of hy5 mutants (Figure 6a). It seems unlikely that this represents a neomorphic effect as the same construct has no equivalent influence on the hypocotyl of wild-type seedlings (Figure 6b). Although elevated AXR2 expression partially rescues the hy5 hypocotyl phenotype, it does not rescue the accelerated lateral root formation (Figure 6c).

Figure 6.

Effects of a 35S::AXR2 transgene in wild-type and hy5 mutant background.

(a) Col wild type, hy5-215, and respective transgenic seedlings carrying a 35S::AXR2 expression construct 7 dag.

(b) Hypocotyl length of Col wild type, hy5-215, and respective transgenic seedlings scored 7 dag. A minimum of 10 seedlings were assayed for each line. Error bars represent SEM. Four independent transgenic lines were analyzed for each genotype.

(c) Number of emerged lateral roots observed in the seedlings analyzed in (b).

Discussion

The role of HY5 in promoting photomorphogenesis has been characterized in great detail. Constitutively, nuclear localized HY5 promotes the transcription of light-induced genes, such as chalcone synthase or RBCS1A (ribulose biphosphate carboxylase 1A small subunit), by binding to a G-box motif in their promoters (Ang et al., 1998; Chattopadhyay et al., 1998). HY5 activity is controlled by the ubiquitin ligase COP1, which is nuclear localized only in darkness (von Arnim and Deng, 1994; Osterlund et al., 2000; Saijo et al., 2003). HY5 interacts with COP1 through a domain in its N-terminus (Holm et al., 2001), resulting in HY5 degradation via the ubiquitin–proteasome pathway. The strength of HY5–COP1 interaction is, in addition, modulated by casein kinase II-mediated phosphorylation of HY5's COP1 interaction domain (Hardtke et al., 2000).

It has been reported that COP1 is nuclear localized in root tissue, even when the roots are grown in light (von Arnim and Deng, 1994). However, despite the nuclear presence of COP1, HY5 expression is stable in root tissue (C.P.C and C.S.H., unpublished results). This finding indicates that additional factors, which might be absent from root cells, could be required for COP1 ubiquitin ligase activity, as has been suggested by Hardtke et al. (2002) and Saijo et al. (2003). It also indicates that the root phenotype of hy5 mutants might not simply be an indirect consequence of decreased photomorphogenic development of hy5 shoots. Thus, we re-visited the root phenotype of hy5 mutants to search for common mechanisms underlying all hy5 traits.

Lateral root formation is accelerated in hy5 mutants

The formation of lateral roots is a process that depends on environmental as well as internal stimuli. For instance, it is strongly influenced by the ratio of carbon to nitrogen sources in the medium (Malamy and Ryan, 2001). In our hands, lateral root formation in hy5 mutants reacts normally to changing environmental conditions, implying that they are correctly perceived.

An important internal stimulus for lateral root formation at the early seedling stage is the polar transport of the plant hormone auxin from the shoot tip to the root tip (Bhalerao et al., 2002; Lomax et al., 1995; Reed et al., 1998). Only later in development does the root system become auxin self-sufficient. hy5 mutants display accelerated formation of lateral roots rather than an increase in number. This appears to be because of a reduced dependence of hy5 seedlings on shoot-derived auxin. Alternatively, polar auxin transport could be accelerated in hy5, a possibility which we did not explore. However, when the shoot was removed at 4 dag, hy5 seedlings still formed several lateral roots. At the time of decapitation, the presumed sources of auxin – the primordia of the first true leaves – were not yet formed. Therefore, it appears more likely that an intrinsic elevation of auxin signaling in hy5 is responsible for the accelerated lateral root formation, which is in line with our findings discussed below.

Imbalance between auxin and cytokinin signaling in hy5 mutants

Cytokinin was implicated in light signaling in Arabidopsis because treatment of dark-grown wild-type seedlings with high cytokinin doses induces de-etiolation (Chory et al., 1994). This treatment has the same effect on hy5 seedlings (C.P.C and C.S.H., unpublished results), consistent with the absence of phenotypes in dark-grown hy5 seedlings and strongly reduced HY5 abundance in dark-grown wild-type seedlings. This finding suggests that cytokinin-induced de-etiolation does not require HY5 action.

The effects of auxin on plant development are highly dosage-dependent (Leyser, 2002; Skoog and Miller, 1957). For instance, with regard to root growth, low levels are stimulatory while higher levels are inhibitory (Thimann, 1936, 1937). Such dosage-dependent effects can impede the interpretation of whole plant responses to systemic auxin application, an issue further complicated by the cross-talk of auxin with other hormone signaling pathways. For instance, cytokinin is considered a classic antagonist of auxin action. Accordingly, the balance between exogenously applied auxin and cytokinin is crucial for the regeneration of plant tissues in culture (Skoog and Miller, 1957). In general, a high auxin to cytokinin ratio favors the formation of root tissue, whereas high cytokinin to auxin ratio promotes the formation of shoots. Finally, comparable levels of auxin and cytokinin result in the growth of undifferentiated callus tissue. These features make tissue regeneration an ideal system to detect imbalances between the two signaling pathways. Indeed, we found that the competence to form callus tissue is strongly reduced when hy5 hypocotyl explants are used, and this phenotype is even more pronounced with root explants. Only the addition of excess cytokinin, which shifts the auxin to cytokinin ratio, can partially mend this defect. By contrast, increasing the auxin content of the medium has no beneficial effect on callus formation from hy5 tissue. Consistent with the idea that high auxin levels favor root formation, callus formation from wild-type tissue is suppressed as the level of auxin in the medium is increased (Figure 3b). Therefore, hy5 tissue behaves in callus culture like wild-type tissue on medium containing too much auxin, and thus the inability of hy5 to respond correctly in these experiments might be because of either a defect in cytokinin perception or an increased perception of auxin. We were not able to detect a significant difference in auxin or cytokinin content between wild-type and hy5 seedlings. Therefore, the alternate possibility that cytokinin or auxin content is decreased or increased, respectively, in hy5 seems less likely. Our finding that negative regulators of auxin signaling are underexpressed in hy5, which is discussed below, supports this conclusion.

Consistent with our observation that HY5 is involved in callus growth, the level of HY5 protein correlates with the responsiveness of tissue to callus-inducing medium. However, just as for photomorphogenic traits (Hardtke et al., 2000), HY5 overexpression is not sufficient to enhance callus formation (C.P.C and C.S.H., unpublished results), which is in line with the idea that additional transcription factors are rate-limiting for HY5 activity (Holm et al., 2001, 2002).

Reduced expression of IAA genes disturbs auxin signaling in hy5 seedlings

Supporting evidence for the idea that auxin signaling is elevated in hy5 seedlings comes from double mutant analysis. By decreasing auxin perception in hy5 through introduction of the auxin-resistant axr4 or tir1 mutations, the hy5 phenotype is moderated. The identity of the gene encoding AXR4 is not known. The TIR1 gene, however, encodes an F-box protein that is involved in the degradation of IAA proteins, which are negative regulators of auxin signaling, by the ubiquitin–proteasome pathway (Gray et al., 2001). The stabilization of IAA proteins in tir1 mutants results in a decrease of auxin signaling and therefore resistance to externally applied auxin, as well as reduced lateral root formation.

In order to identify hormone signaling genes differentially regulated in hy5 and wild type, we performed microarray analyses. In these experiments, we concentrated on the steady state gene expression levels in a uniformly growing hormone-exposed tissue, i.e. callus. We chose this approach to eliminate the background that may be observed in a more diversified tissue source with presumably more dynamic fluctuations in gene expression, such as young seedlings. Because our approach differs in several aspects, comparison of our microarray data with previously published data (Holm et al., 2002; Ma et al., 2002) is limited. First, we used different tissues as RNA sources, i.e. callus or roots, rather than whole seedlings. Second, we concentrated our analysis on callus tissue, which had been exposed to plant growth regulators over an extended time. Third, we were using a different microarray, i.e. the Agilent Arabidopsis 14K (non-redundant) oligomer microarray rather than the Keck c. 6K (non-redundant) EST microarray. Notably, most of the genes we were interested in are missing from the Keck 6K microarray.

Based on our microarray analyses of hy5 mutant tissues, it appears that some IAA genes are underexpressed in hy5. IAA proteins are considered negative regulators of auxin signaling as gain-of-function mutations that make them less susceptible to auxin-triggered degradation render plants less sensitive to externally applied auxin (Leyser, 2002). Gain-of-function mutants in all four IAA genes affected in hy5 have been described. Strikingly, they have all been implicated in lateral root formation and/or photomorphogenic traits. For instance, lateral root formation is suppressed in slr, also known as iaa14 and iaa28 mutants (Fukaki et al., 2002; Rogg et al., 2001), while axr2, also known as iaa7 and shy1, also known as iaa6 mutants display partially de-etiolated phenotypes in darkness, implicating them in the promotion of photomorphogenesis (Kim et al., 1996; Liscum and Reed, 2002; Nagpal et al., 2000). Moreover, shy1 loss-of-function mutants have slightly elongated hypocotyls. Conceivably, aspects of the hy5 phenotype might reflect the combinatorial effects of a decrease in the activity of the affected IAA genes. These might act in various auxin responses, possibly in a tissue-specific manner (Liscum and Reed, 2002).

Some of the variation observed in our microarray analyses could be because of indirect effects. For instance, feedback regulation between IAA genes has been suggested (Liscum and Reed, 2002), and hormone pathways might react to alterations in each other as a result of cross-talk. Our results indicate that IAA28 and SHY1 are likely not under direct control of HY5 as no target site for HY5 binding is found in their promoters. By contrast, AXR2 as well as SLR contain a HY5 binding site close to their transcription initiation site. We confirmed that these two genes are underexpressed in hy5 seedlings by semiquantitative RT-PCR, and demonstrate that HY5 can bind the AXR2 promoter in vitro. Moreover, elevated AXR2 expression partially rescues the hy5 hypocotyl phenotype, consistent with previously described roles of AXR2 in development (Nagpal et al., 2000; Timpte et al., 1994). The combined evidence from our experiments suggests that AXR2, and probably SLR as well are indeed direct targets for HY5-mediated transcriptional activation. We propose that decreased expression of AXR2 and SLR is at least partially responsible for the observed imbalance between auxin and cytokinin signaling in hy5 seedlings, by causing an elevation of auxin signaling. Notably, the phenotype of axr2 and slr gain-of-function mutants in hypocotyl elongation and lateral root formation, respectively, is opposite to hy5. Thus, the decreased expression of these negative regulators of auxin signaling likely contributes to the root and shoot phenotype of hy5 seedlings.

Conclusion

In summary, our results provide evidence that HY5 has an important role in promoting the transcription of auxin signaling genes in addition to light-regulated genes. Conceivably, the activity of different HY5 target genes is context-dependent, possibly in a tissue-specific manner. This is already apparent from the absence of expression of several HY5-dependent light signaling genes in the root. The difference in severity of the hormone-related phenotypes of hy5 hypocotyls versus roots in our tissue culture assays further supports diverse tissue-specific roles of HY5 target genes, i.e. some auxin signaling genes targeted by HY5 might be of greater importance in root than in shoot development. Here, it is important to note that HY5 contains no activation domain (Ang et al., 1998) and depends on auxiliary factors to promote transcription. In fact, transcription factors interacting with HY5 have been identified, such as HYH (Holm et al., 2002). It will be interesting to see whether differential activity of HY5 target genes correlates with tissue-specific activity of these other factors, and whether the latter have a role in hormone signaling. This can at least be expected for HYH, which has been shown to act in synergistic fashion with HY5 in photomorphogenesis (Holm et al., 2002). Finally, the factors involved in post-translational regulation of HY5 activity act in parallel on IAA proteins (Schwechheimer et al., 2002). Therefore, subsets of the light and hormone signaling pathways seem to be integrated at the transcriptional as well as the post-translational level, allowing their optimal synchronization.

Experimental procedures

Plant material

For our studies, we used two different hy5 null alleles: hy5-215 was induced in the Col background and isolated as an extragenic suppressor of cop1 (Ang et al., 1998), and hy5-KS50 was induced in the Ws background (Oyama et al., 1997). Unless otherwise stated, all our results have been confirmed both with mutant alleles and with wild-type backgrounds.

Tissue culture

Unless otherwise stated, seedlings were grown at 22°C under constant illumination on culture medium containing 0.5× MS salts, 0.5 g l−1 MES (morpholinoethane sulfonic acid), 1% sucrose (glucose for regeneration experiments), and 0.9% agar at pH 5.8, plus any indicated hormone supplement (Sigma-Aldrich, St Louis, MO, USA). Regeneration experiments were performed at 22°C under constant illumination on B5 culture medium, containing 2% glucose and 0.9% agar at pH 5.8, plus indicated hormone supplements (Sigma-Aldrich). All data points in tissue culture assays represent the mean of at least 8 and typically 12 individuals.

Hormone measurements

One to three gram FW 10-day-old seedlings were harvested from liquid culture and ground to a powder in liquid nitrogen. The powder was re-suspended in extraction buffer (70% MetOH, 3% acetic acid, 10 mg ml−1 butylated hydroxytoluene; using 3 ml g−1 FW), and was nutated in the dark at 4°C for 24 h. The extraction was repeated with 1 ml g−1 FW of buffer. The combined extract was dried, then the pellets were re-suspended in 1 ml 10% MetOH, and the suspension was loaded onto SepPakC18 columns (Waters, Milford, MA, USA) pre-wetted with 10% MetOH. The columns were washed with 0.5 ml of 10% MetOH, and bound molecules were eluted with 1 ml of 60% MetOH. The samples were dried again and re-suspended in 300 µl 10% MetOH. The samples were then adjusted relative to each other according to their FW. Relative auxin and cytokinin content was determined with the Phytodetek™–IAA and –tZR immunoassay kits (Agdia, Elkhart, IN, USA) according to the manufacturer's instructions. Samples were measured in duplicate and data were gathered from dilutions giving values within the linear detection range.

RNA isolation

Total RNA for microarray and RT-PCR analyses was prepared with the Rneasy™ kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.

Microarray hybridization

Total cDNA labeled by incorporation of either Cy3- or Cy5-dCTP (Perkin-Elmer, Wellesley, MA, USA) was produced from total RNA using a Fluorescent Direct Labeling kit (Agilent) following the manufacturer's instructions. Two differentially labeled samples were combined and purified with a PCR Purification kit (Qiagen), with the modifications outlined by Agilent. The samples were injected into a rotating bubble microarray hybridization chamber loaded with a 14.2-K Arabidopsis oligomer microarray (Agilent), hybridized for 18 h at 65°C, and washed according to the manufacturer's instructions. Typically, two microarrays were simultaneously hybridized with samples produced from identical RNA preparations, however, with swapped dyes. Hybridized microarray slides were scanned with an ArrayWorx™ Biochip Reader (Applied Precision, Issaquah, WA, USA) with settings optimized for signal to noise ratio and spot saturation. The generated images were analyzed using softworx tracker™ software (Applied Precision), applying standard normalization procedures.

RT-PCR

RT-PCR reactions were performed according to standard procedures using the Superscript II™ reverse transcriptase (Invitrogen, Carlsbad, CA, USA). PCR reactions were performed with 5 µl RT reaction or dilutions as a template. Results were verified in triplicate with independent RNA preparations.

Electrophoretic mobility shift assay

Fragments of the AXR2 and IAA1 promoters spanning the transcription initiation start and c. 200 bp 5′ upstream of it were amplified from genomic DNA, end-labeled with 32P-gamma-ATP according to standard procedures, and were purified. The primers used were TCAATATGTGACCTGATCCTC and GTGTAATTGCATGTGCATGTC for AXR2, and GAGACAAATCAGGACCGTTG and GTGTTGTGTAATGGTGAGGG for IAA1. Labeled fragment (c. 50 000 c.p.m.) was incubated with 1 µg poly dI::dC (Pharmacia, Uppsala, Sweden) and 50–150 ng of recombinant His6-tagged protein (purified from bacteria) in binding buffer (75 mm HEPES, 175 mm KCl, 5 mm EDTA, 40% glycerol, 5 mm DTT, 1 mm MgCl2). The reactions were incubated at RT for 20 min and then run on a 5% non-denaturing polyacrylamide gel (acrylamide:bisacrylamide = 75 : 1) in 0.25× Tris-borate EDTA (TBE) buffer. To detect labeled fragment, gels were dried and scanned with a storm phosphoimager (Molecular Dynamics, Sunnyvale, CA, USA).

Transgenic analysis

The AXR2 open-reading frame was amplified from an Arabidopsis cDNA library by PCR, cloned into the binary vector pTCSH1 (Hardtke et al., 2000), and verified by sequencing. Col or hy5-215 plants were transformed via the floral dip method, and transgenic lines were selected by screening the seed progeny for glufosinate ammonium resistance (BASTA; Sigma). Lines expressing the transgene were selected by RT-PCR. For phenotypic analyses, transgenic seedlings were grown in tissue culture in a 16-h light/8-h dark cycle for 1 week. The light intensity was approximately 140 µmol m−2 sec−1. The plantlets were then scanned to produce image files, and these were used to analyze quantitative aspects of hy5 traits using the nih image software (v. 1.63).

Acknowledgements

We would like to thank Dr X.-W. Deng for a gift of anti-HY5 antibody, E. Marazzo for HY5 fusion protein, the Arabidopsis Biological Resources Center for seeds, and Drs S. Aquin, T. Berleth, and V. Irish for helpful comments on our manuscript. Contributions: C.S.H. conceived this study, wrote the manuscript and contributed data for Table 1 and Figures 1a and 6. C.P.C. contributed data for Table 1 and Figures 1(b–d), 2–5(a–b). C.F.M. contributed the data for Figure 5(c,d). This work was funded by a National Sciences and Engineering Research Council (NSERC) Discovery Grant to C.S.H and an NSERC summer student fellowship to C.P.C. C.S.H. is a Strategic Professor of the Fonds Québécois de la Recherche sur la Nature et les Technologies.

Ancillary