SEARCH

SEARCH BY CITATION

Keywords:

  • citrus;
  • flavonoid;
  • neohesperidoside;
  • rhamnosyltransferase;
  • regiospecificity;
  • bitter flavor

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Species of the genus Citrus accumulate large quantities of flavanones that affect fruit flavor and have been documented to benefit human health. Bitter species, such as grapefruit and pummelo, accumulate bitter flavanone-7-O-neohesperidosides responsible, in part, for their characteristic taste. Non-bitter species, such as mandarin and orange, accumulate only tasteless flavanone-7-O-rutinosides. The key flavor-determining step of citrus flavanone-glycoside biosynthesis is catalyzed by rhamnosyltransferases; 1,2 rhamnosyltransferases (1,2RhaT) catalyze biosynthesis of the bitter neohesperidosides, while 1,6 rhamnosyltransferases (1,6RhaT) catalyze biosynthesis of the tasteless rutinosides. We report on the isolation and functional characterization of the gene Cm1,2RhaT from pummelo which encodes a citrus 1,2RhaT. Functional analysis of Cm1,2RhaT recombinant enzyme was conducted by biotransformation of the substrates using transgenic plant cell culture. Flavanones and flavones, but not flavonols, were biotransformed into 7-O-neohesperidosides by the transgenic BY2 tobacco cells expressing recombinant Cm1,2RhaT. Immunoblot analysis established that 1,2RhaT protein was expressed only in the bitter citrus species and that 1,6RhaT enzyme, whose activity was previously documented in non-bitter species, was not cross-reactive. Expression of Cm1,2RhaT at the RNA level was prominent in young fruit and leaves, but low in the corresponding mature tissue, thus correlating well with the developmental pattern of accumulation of flavanone-neohesperidosides previously established. Phylogenetic analysis of the flavonoid glycosyltransferase gene family places Cm1,2RhaT on a separate gene cluster together with the only other functionally characterized flavonoid-glucoside rhamnosyltransferase gene, suggesting a common evolutionary origin for rhamnosyltransferases specializing in glycosylation of the sugar moieties of flavonoid glucosides.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Citrus fruit flavor and aroma derive from a complex combination of soluble and volatile compounds (Ranganna et al., 1983; Rouseff and Naim, 2000). The former group comprises mainly sugars, organic acids and flavanones, a flavonoid subgroup that includes compounds greatly responsible for the bitter flavor of grapefruit and other citrus species (Horowitz, 1986; Horowitz and Gentili, 1961). Flavanones are the dominant group of flavonoids in citrus and beyond their effect on citrus flavor, they have been implicated as important dietary components with a role in maintaining healthy blood vessels and bones, as cancer and mutagenesis-suppressing agents and as anti-allergic, anti-inflammatory and anti-microbial compounds (Benavente-Garcia et al., 1997; Chiba et al., 2003; Garg et al., 2001; Jagetia and Reddy, 2002; Kim et al., 2001; Manthey and Guthrie, 2002; Manthey et al., 2001). While some health-related effects may be caused by the anti-oxidant characteristics of these compounds, other effects are not well understood at the mechanistic level. Citrus species are notable for containing large quantities of flavanones and are one of the major sources of flavanones in the human diet and a major source of these compounds for the food and para-pharmaceutical industries (Harborne, 1967).

The sensation of bitterness in citrus products emanates from different causes. The bitterness caused by flavanone-glycosides (often referred to as ‘primary’ bitterness) is common only to the bitter citrus species (i.e. grapefruit –Citrus paradisi; bitter orange –C. aurantium; pummelo –C. maxima; and others) and should not be confused with the bitterness caused by the triterpene limonin that occurs in both bitter and non-bitter species (McIntosh and Mansell, 1997). Limonin-based bitterness is often referred to as ‘delayed’ bitterness as much of the limonin in intact citrus fruit tissues (except for the juice sacs) occurs as a tasteless precursor, limonoate A-ring monolactone, which is extracted with the juice and gradually converts to limonin under the prevailing acidic conditions (Hasegawa and Hoagland, 1977; Maier and Beverly, 1968; McIntosh and Mansell, 1997; McIntosh et al., 1982). Compositional studies on the profile of flavonoids affecting the so-called ‘primary bitterness’ in various citrus species have established that the bitter species contain mostly flavanone neohesperidosides [which are bitter; e.g. naringin (NRG), Figure 1] while the non-bitter species contain mostly flavanone rutinosides, which are tasteless (e.g. narirutin, Figure 1; Rousseff et al., 1987). Both flavanone classes are diglycosides consisting of a rhamnose-glucose disaccharide O-linked at position 7 to the flavanone skeleton. However, in the bitter neohesperidosides the disaccharide consists of a rhamnose attached via the hydroxyl at the C-2 position of the glucose moiety, while in the tasteless rutinosides the rhamnose is attached via the hydroxyl group at the C-6 position of the glucose moiety (Figure 1). Thus, the position of rhamnose attachment is the determinant of the bitter flavor.

image

Figure 1. Citrus flavanone biosynthesis pathway. Three molecules of malonyl-CoA and one of p-coumaryl-CoA are condensed in a reaction catalyzed by chalcone synthase to create naringenin chalcone (Ebel and Hahlbrock, 1982; Lewinsohn et al., 1989a; Moriguchi et al., 2001). A stereospecific ring closure isomeration step catalyzed by chalcone isomerase converts chalcone to naringenin. The latter serves as a junction in the pathway and is converted by methylations or hydroxylations to other flavanone aglycones such as hesperetin, eriodictyol, and isosakuranetin (Moriguchi et al., 2001). In citrus, flavanones are glucosylated at position 7 to create flavanone-7-O-glucosides, such as NG (McIntosh et al., 1990). Flavanone-7-O-glucosides are further glycosylated by either a 1–6 rhamnosyltransferase to yield tasteless 7-O-rutinosides (such as naringenin-7-O-rutinoside; Lewinsohn et al., 1989b) or a 1–2 rhamnosyltransferase to yield bitter 7-O-neohsperidosides (such as naringenin-neohesperidoside; Bar-Peled et al., 1991). Enzymes of the pathway are underlined. Flavanone product names appear in bold.

Download figure to PowerPoint

Flavanones, like all flavonoids, are synthesized via one of the branches of the phenylpropanoid pathway (see Figure 1 for pathway and relevant references). The first committed step is catalyzed by the enzyme chalcone synthase followed by chalcone isomerase. The flavanone naringenin, the dominant flavanone in grapefruit, undergoes two glycosylation steps. The first step involves an O-linked glucosylation at position 7 of the flavanone catalyzed by a 7-O-glucosyltransferase (7GlcT). The second step involves one of two rhamnosyltransferases: most of the naringenin-7-O-glucoside (NG) is metabolized in grapefruit into the bitter neohesperidoside NRG by a 1-2 rhamnosyltransferase (1,2RhaT), while the rest is metabolized into the tasteless rutinoside narirutin by a 1-6 rhamnosyltransferase (1,6RhaT). In other citrus species the glycosylation process is essentially the same, but involves other flavanones such as hesperetin in oranges. The concentration of flavanone- neohesperidoside end products, in any given citrus fruit species, is a major determinant of the level of fruit bitterness.

Enzyme activities catalyzing citrus flavanone glycosylation (7GlcT, 1,2RhaT and 1,6RhaT) were previously described, but none of the corresponding genes had been isolated. Lewinsohn et al. (1989a,b) demonstrated 7GlcT and 1,2RhaT activity in pummelo cell-free extracts as well as 7GlcT and 1,6RhaT activity in bitter orange cell cultures. McIntosh et al. (1990) purified the enzyme 7GlcT from grapefruit to homogeneity and determined its substrate specificity, and Berhow and Smolensky (1995) quantified levels of activity of the corresponding enzyme in lemon (C. limon) tissues. Bar-Peled et al. (1991) purified the enzyme 1,2RhaT from pummelo to homogeneity and conducted enzyme kinetic studies and substrate preference studies within the limitations imposed by the lack of a readily available source of UDP-rhamnose. Developmental studies on the accumulation of flavanone-glycosides in citrus and the corresponding glycosyltransferase enzyme activities show that flavanone-glycosides are synthesized in large quantities only in young tissue (leaves, flowers and fruit), and are later diluted in fruit to their final concentration during the process of development and ripening (Bar-Peled et al., 1993; Castillo et al., 1992; Jourdan et al., 1985; Ortuno et al., 1995). It is not clear whether the flavanone-glycosides accumulating in fruit are synthesized solely in fruit or whether some flavanones synthesized in young leaves are eventually transported to the fruit (Berhow and Vandercook, 1991). In addition, the biological role of these abundant compounds in citrus fruit has not been proved, although increasing evidence points to a role in plant defense (Del Rio et al., 1998, 2004; Ortuno et al., 2002).

Glycosyltransferases involved in plant secondary metabolism are a large group of enzymes classified as glycosyltransferase family 1 (Coutinho and Henrissat, 1999a,b; Vogt and Jones, 2000). Flavonoid glycosyltransferases have been studied in many species, and a growing number of genes have been isolated and functionally characterized (reviewed in Vogt and Jones, 2000). In addition, the Arabidopsis and rice genomes as well as various EST projects have provided insight into the number of genes involved (Bowles, 2002; Li et al., 2001), although most have not been assigned functions as yet. The emerging evolutionary picture is that of similarity of enzymes based on regiospecificity, rather than intraspecies specificity. However, the picture is still partial because the vast majority of the genes functionally characterized are glucosyltransferases and all are involved in direct O-linked glycosylation of the flavonoid skeleton. Therefore, the data on flavonoid glycosyltransferases that transfer sugars other than glucose, and on enzymes that specialize in glycosylation of the sugar moieties of flavonoid-glucosides are still lacking.

We describe the isolation and functional characterization of the gene Cm1,2RhaT, which encodes a flavanone-7-O-glucoside-1,2-rhamnosyltransferase, the key enzyme directing biosynthesis of the bitter flavonoid compounds in citrus. Functional characterization of the recombinant enzyme was demonstrated by biotransformation of its substrate using a transgenic plant cell-culture line overexpressing the gene Cm1,2RhaT. Substrate specificity of the recombinant enzyme included flavanones and flavones, but not flavonols. Phylogenetic analysis of the flavonoid glycosyltransferase family places the gene Cm1,2RhaT in a separate cluster together with the only other functionally characterized flavonoid-glucoside rhamnosyltransferase in the plant kingdom (Brugliera et al., 1994; Kroon et al., 1994), thus suggesting a separate evolutionary branch for rhamnosyltransferases specializing in glycosylation of the sugar moieties of flavonoid glycosides.

Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

While grapefruit is the edible citrus species most associated with bitterness, we chose to isolate the gene encoding the enzyme flavanone 7-O-glucoside-1,2 rhamnosyltransferase (1,2RhaT) from pummelo, as this species does not possess any 1,6RhaT activity that could complicate the purification process. 1,2RhaT from pummelo was purified to homogeneity as previously described (Bar-Peled et al., 1991) and subjected to partial proteolysis. The resulting peptides were purified and N-terminally sequenced (Figure 2a). Degenerate primers in sense and antisense orientations were designed based on the peptide sequences (Figure 2a) and used in different combinations to isolate cDNA fragments via RT-PCR on mRNA isolated from young pummelo leaves. One cDNA fragment was confirmed as relevant based on the presence of an internal sequence (EKMTIEEA), corresponding to one of the Asp-N partial peptide sequences (Figure 2a). Specific primers based on the partial cDNA fragment were used to isolate a complete cDNA termed Cm1,2RhaT (C. maxima 1,2 rhamnosyltransferase; Figure 2b) using 5′ and 3′– RACE (Eyal et al., 1999; Experimental procedures). Cm1,2RhaT gene-specific primers were also used to amplify and clone the complete coding region of the corresponding grapefruit cDNA found to be 98% identical at the decoded amino acid level (Figure 2b). Cm1,2RhaT was found to contain the conserved domain signature characteristic of UDP-glycosyltransferases (Coutinho and Henrissat, 1999b; Ross et al., 2001; Figure 2c). When compared with sequences of characterized glycosyltransferases, Cm1,2RhaT was most similar to a petunia anthocyanidin-3-O-glucose 1,6 rhamnosyltransferase (28% identity at the deduced amino acid level; 45% similarity), the only previously characterized flavonoid-glucoside rhamnosyltransferase in the plant kingdom (Brugliera et al., 1994; Kroon et al., 1994). Sequence analysis software calculated the molecular weight of the protein encoded by Cm1,2RhaT to be 51 kDa, similar to the molecular mass determined by gel filtration (52 kDa) and the observed mobility on SDS-PAGE (50 kDa) (Bar-Peled et al., 1991), and predicted its localization to the cytoplasm.

image

Figure 2. Isolation of a citrus 1,2 rhamnosyltransferase gene based on partial peptide sequences. (a) Purified pummelo 1,2 rhamnosyltransferase (Bar-Peled et al., 1991) was digested with endoproteinase Asp-N, endoproteinase Lys-C or trypsin as described in Experimental procedures. N-terminal sequences of the resulting peptides are presented. Degenerate oligonucleotide sequences used for gene isolation appear opposite the relevant peptide sequences. S, oligonucleotide designed in the ‘sense’ orientation; AS, oligonucleotide designed in the ‘antisense’ orientation. (b) Alignment of functionally characterized plant flavonoid-glucoside rhamnosyltransferases. Displayed are deduced amino-acid sequences of Petunia hybrida anthocyanin-3-O-glucose: 1,6 rhamnosyltransferase (Petunia-RhaT; accession no. CAA50376; Kroon et al., 1994) and pummelo (Citrus maxima) flavanone-7-O-glucose: 1,2 rhamnosyltransferase (Pummelo-RhaT; accession no. AY048882; this work). Also included (in brackets below sequence) are the amino acids which were found to differ in grapefruit (Citrus paradisi) from the pummelo-RhaT. Sequences conserved among the rhamnosyltransferases are highlighted in black (identical) or in gray (similar). Dashed lines represent spaces allowing for optimal alignment. Amino acid sequences that were generated by partial peptide sequencing of the purified pummelo 1,2RhaT are underlined. (c) Conserved UDP-glycosyltransferase signature domain of pummelo 1,2 RhaT (accession no. AY048882) and additional flavonoid-glycosyltransferases: Petunia hybrida RhaT (CAA50376); Scutellaria baicalensis 7GlcT (BAA83484); Zea mays 3GlcT (P16166); Perilla frutescens 5GlcT (BAA36421). GlcT, glucosyltransferase; RhaT, rhamnosyltransferase. Anterisks appear above amino acids that are completely conserved among UDP-glycosyltransferases.

Download figure to PowerPoint

Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Recombinant Cm1,2RhaT enzyme function was analyzed in vivo by biotransformation of its substrate, NG, in transgenic tobacco BY2 cell culture. The coding region of Cm1,2RhaT was cloned into a PME504 binary vector (see Experimental procedures) under the control of a CAMV-35S promoter. The resulting plasmid was used to transform a tobacco BY2 cell suspension culture, to derive a transgenic cell line (BY2-1,2RhaT). Wild-type (BY2) and transgenic (BY2-1,2RhaT) cells were fed the substrate NG (the natural substrate of the 1,2RhaT enzyme in pummelo and grapefruit; Bar-Peled et al., 1991; Figure 1) for 48 h. Flavonoids were extracted and analyzed by TLC. Extracts of both wild type and transgenic cells contained a spot co-migrating with NG as well as a slower migrating spot (Figure 3a). However, only the transgenic cell line BY2-1,2RhaT contained a third spot co-migrating with NRG (Figure 3a, compare lanes 4 and 5). The putative NRG spot was extracted from the silica gel plate and confirmed to be NRG by comparison with commercial standards using LC-MS (Figure 4e).

image

Figure 3. Biotransformation of flavonoids using transgenic BY2 cell culture (TLC analysis). (a) Biotransformation of naringenin-7-O-glucoside (NG) into naringin (NRG). Naringenin-7-O-glucoside was added to BY2 wild-type and transgenic cell culture lines, during the logarithmic phase of growth, as described in Experimental procedures. Cells were harvested after 48 h and the flavonoids were extracted and separated by TLC as follows: (1) naringenin-7-O-glucoside standard; (2) naringin standard; (3) extract of BY2-1,2RhaT cells not fed flavonoids; (4) extract of BY2-1,2RhaT cells fed naringenin-7-O-glucoside; (5) extract of BY2 cells fed naringenin-7-O-glucoside; (6) extract of BY2 cells not fed flavonoids. Plates were developed and photographed under UV-light as described in Experimental procedures. (b) Biotransformation of naringenin into naringin. Naringenin was added to BY2 wild-type and transgenic cell culture lines, during the logarithmic phase of growth, as described in Experimental procedures. Cells were harvested after 48 h and the flavonoids were extracted and separated by TLC as follows: (1) naringenin standard; (2) naringenin-7-O-glucoside standard; (3) naringin standard; (4) extract of BY2-1,2RhaT cells not fed flavonoids; (5) extract of BY2-1,2RhaT cells fed naringenin; (6) extract of BY2 cells fed naringenin; (7) extract of BY2 cells not fed flavonoids. Plates were developed and photographed under UV-light as described in Experimental procedures. Arrow denotes direction of migration. (c) Biotransformation of diosmetin into neodiosmin. Diosmetin was added to BY2 wild-type and transgenic cell culture lines during the logarithmic phase of growth as described in Experimental procedures. Cells were harvested after 48 h and the flavonoids were extracted and separated by TLC as follows: (1) diosmin standard; (2) neodiosmin standard; (3 and 4) extract of BY2-1,2RhaT cells not fed flavonoids; (5 and 6) extract of BY2-1,2RhaT cells fed diosmetin; (7 and 8) extract of BY2 cells fed diosmetin; (9 and 10) extract of BY2 cells not fed flavonoids; (11) diosmetin standard. Plates were developed and photographed under UV-light as described in Experimental procedures. (d) Summary of biotransformation results of flavonoid substrates and their respective structures. The conventional numbering and letter identification of flavonoid rings is superimposed on the structure of the flavanone.

Download figure to PowerPoint

image

Figure 4. Flavanone biotransformation product identification by LC-MS. Biotransformation product identities were verified by comparison of retention time and mass-spectra to known standards using LC-MS. Each panel presents the chromatography data and mass spectra (boxes with arrows pointing to the relevant peaks) of a known standard or biotransformation sample. (a) Narirutin (naringenin-7-O-rutinoside; NRT) standard. (b) Naringin (naringenin-7-O-neohsperidoside; NRG) standard. (c) Naringenin-7-O-glucoside (NG) standard (contaminated with naringenin). (d) Naringenin (N) standard. (e) Putative naringin spot from TLC (lane no. 4 Figure 3a) extracted from the silica plate. (f) Extract of BY2 cells fed naringenin-7-O-glucoside (same as TLC lane no. 5, Figure 3a). (g) Extract of BY2-1,2RhaT cells fed naringenin-7-O-glucoside (same as TLC lane no. 4, Figure 3a). (h) Extract of BY2 cells fed naringenin (same as TLC lane no. 6, Figure 3b). (i) Extract of BY2-1,2RhaT cells fed naringenin (same as TLC lane no. 5, Figure 3b). N, naringenin; NG, naringenin-7-O-glucoside; NGG, naringenin-diglucoside; NRG, naringin; NRT, narirutin.

Download figure to PowerPoint

To confirm these results, direct LC-MS analysis of the biotransformed flavonoid products was performed (Figure 4f,g). Two flavanone peaks were detected in extracts from both BY2 and BY2-1,2RhaT cell lines fed NG and were identified, based on retention time and mass spectra, to be: NG and naringenin-diglucoside (NGG). An additional peak was detected only in extracts of the transgenic cell line BY2-1,2RhaT (Figure 4, compare panels f and g), and was identified as NRG.

Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Recent work (Taguchi et al., 2000) has shown the presence of a broad substrate specificity 7GlcT enzyme activity in tobacco cell culture. The spectrum of substrates was found to include coumarins and flavonols. It was therefore reasonable to assume that the enzyme would work on flavanones as well, allowing a two-step biotransformation of naringenin to NRG (see Figure 1) in the transgenic BY2 cell line. To test this possibility, biotranformation experiments with naringenin as the substrate were carried out. Analysis of extracted flavonoid products by TLC revealed that all the naringenin was converted into glycosides (Figure 3b). Extracts of both BY2 and BY2-1,2RhaT cell lines contained a spot co-migrating with NG as well as a slower migrating spot. Only the transgenic cell line BY2-1,2RhaT contained a third spot co-migrating with NRG (Figure 3b, compare lanes 5 and 6). Similar results were obtained by analysis of the biotransformed flavonoid products using LC-MS (Figure 4h,i). Two flavanone peaks were detected in extracts of both BY2 and BY2-1,2RhaT cell lines fed naringenin and were identified, based on retention time and mass spectra, to be NG and NGG. An additional peak was detected only in extracts of the transgenic cell line BY2-1,2RhaT (Figure 4, compare panels h and i), and was identified as NRG.

Cm1,2RhaT substrate specificity is not limited to flavanones

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Flavanone-7-O-glucosides are the main substrates of the 1,2RhaT enzyme in citrus (Bar-Peled et al., 1991), but may not be the only substrates in planta. We extended the substrate specificity study of recombinant Cm1,2RhaT by biotransformation of representative compounds of two additional flavonoid sub-groups; quercetin and kaempferol, which represent the flavonol subgroup (see structures in Figure 3d), were found to be glucosylated by wild type (BY2) and transgenic (BY2-1,2RhaT) cell lines, but not further rhamnosylated by the transgenic cell line (data not shown). In contrast, diosmetin and luteolin, which represent the flavone subgroup (see structures in Figure 3d), were biotransformed in two steps into neodiosmin and luteolin-7-O-neohesperidoside, respectively, by the transgenic BY2-1,2RhaT cell line (Figure 3c and data not shown). The results analyzed by TLC were confirmed with the relevant standards by HPLC (not shown).

Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

We chose to study the phylogenetic relationship between Cm1,2RhaT and other functionally characterized glycosyltransferases that catalyze the glycosylation of flavonoids (including enzymes that naturally glycosylate other substrates). Phylogenetic analysis of the deduced amino acid sequences of Cm1,2RhaT and other characterized flavonoid glycosyltransferases divides this family of enzymes into four clusters (Figure 5): (i) A cluster of enzymes catalyzing glucosylation at position 5 of substrate flavonoids (5GlcT cluster); (ii) A cluster of enzymes catalyzing glycosylation (glucosylation, galactosylation and rhamnosylation) at position 3 of substrate flavonoids (3GlcT, 3GalT and 3RhaT cluster); (iii) A cluster of enzymes catalyzing glucosylation at position 7 of substrate flavonoids (7GlcT cluster; some enzymes in this group maintain other site-specificities as well); (iv) A cluster consisting of Cm1,2RhaT and the only other characterized flavonoid-glucoside rhamnosyltransferase in plants (petunia anthocyanidin-3-O-glucuose-1,6 rhamnosyltransferase; Brugliera et al., 1994; Kroon et al., 1994).

image

Figure 5. Phylogenetic tree of functionally characterized flavonoid glycosyltransferases. Deduced amino acid sequences of Cm1,2RhaT (Citrus maxima 7-O-glucose:1,2RhaT; this study) and selected functionally characterized glycosyltransferases that catalyze the glycosylation of flavonoids. Alignment and un-rooted phylogenetic tree programs used were BIOEDIT (Hall, 1999) and TREEVIEW (Page, 1996). Accession numbers of the sequences used were as follows: CAA50376 (Petunia hybrida 3-O-glucose:1,6RhaT); AC006282 (Arabidopsis thaliana 7GlcT); BAA83484 (Scutellaria baicalensis 7GlcT); CAB56231 (Dorotheanthus bellidiformis 7GlcT, 4′GlcT); AAB36653 (Nicotiana tabacum 7GlcT, 3GlcT); P16166 (Zea mays 3GlcT); AF360160 (Arabidopsis thaliana 3RhaT); AAB81683 (Vitis vinifera 3GlcT); AAD55985 (P. hybrida 3GalT); BAA36972 (Vigna mungo 3GalT); BAA89008 (P. hybrida 3GlcT); BAA19659 (Perilla frutescens 3GlcT); BAA36423 (Verbena hybrida 5GlcT); BAA36421 (P. frutescens 5GlcT). Sequence clusters are circled by dotted lines. GlcT, glucosyltransferase; GalT, galactosyltransferase; RhaT, rhamnosyltransferase.

Download figure to PowerPoint

Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

We studied the correlation between Cm1,2RhaT expression and the presence of flavonoid-7-O-neohesperidosides in citrus and related species (Figure 6). Antibodies raised against purified pummelo 1,2 rhamnosyltransferase recognized an approximately 50 kDa protein in leaves of the flavonoid-7-O-neohesperidoside containing citrus species (i.e. pummelo, grapefruit, sour-orange). A similar-sized protein was detected in leaves of poncirus (Poncirus trifoliata) and kumquat (Fortunella margarita), which are flavanone-7-O-neohesperidoside-containing citrus relatives. No proteins were detected by the antibodies in the flavonoid-7-O-rutinoside exclusive species (i.e. orange, citron and mandarin) (Figure 6), where flavonoid-7-O-neohesperidosides are absent (Berhow et al., 1998).

image

Figure 6. Immunological detection of 1,2 rhamnosyltransferases in Citrus and related species correlated with the presence of flavonoid-7-O-neohesperidoside products. Proteins extracted from actively growing young leaves of different species were separated by SDS-PAGE, electroblotted onto nitrocellulose, and reacted with anti-pummelo 1,2 rhamnosyltransferase serum. Typical results from one of several similar experiments are shown. Protein samples loaded on the gel were from: pummelo (Citrus maxima), grapefruit (C. paradisi), bitter-orange (C. aurantium), poncirus (Poncirus trifoliata), kumquat (Fortunella margarita), orange (C. sinensis), citron (C. medica) and mandarin (C. reticulata). Data on the composition of flavonoid-7-O-neohesperidosides and rutinosides in these species was previously published (Berhow et al., 1998).

Download figure to PowerPoint

Cm1,2RhaT mRNA is detected in young fruit and leaves

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Previous work has shown that native 1,2RhaT enzyme activity is prominent in young fruit, but barely detectable in mature fruit (Bar-Peled et al., 1993). Similarly, immunoblot analysis has shown that 1,2RhaT enzyme was present in young leaves but was not detected in mature leaves (Bar-Peled et al., 1993), suggesting that expression is generally limited to young tissue. In order to complete the picture at the gene expression level, we investigated tissue specificity and temporal expression of Cm1,2RhaT at the RNA level by RT-PCR analysis on total RNA extracted from fruit peel and leaves of grapefruit, the edible citrus fruit species mostly associated with bitterness (Figure 7). The experiment was designed to avoid amplification of genomic DNA contaminations in the total RNA samples by amplification using one gene-specific primer combined with a tail-primer associated with the poly-T end of the cDNA (see Experimental procedures). Cm1,2RhaT transcript was amplified from samples of young fruit and young leaves (YF and YL respectively), but was barely detectable in samples of mature fruit and mature leaves (MF and ML respectively) (Figure 7). RT-PCR using an additional gene-specific primer employed independently displayed identical results (data not shown).

image

Figure 7. Developmental regulation of Cm1.2RhaT gene expression in grapefruit. mRNA encoding Cm1,2RhaT (a) and actin (b) were reverse transcribed and amplified (35 cycles) from 1 μg samples of total RNA extracted from grapefruit mature fruit (MF), young fruit (YF), mature leaves (ML) and young leaves (YL). PCR products (a and b) and 2 μg of the total RNA samples (c) were separated by electrophoresis and visualized by staining with ethidium bromide.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Based on the sequence data, the enzyme encoded by Cm1,2RhaT appears to belong structurally and functionally to subfamily 1 of the family of glycosyltransferases (Coutinho and Henrissat, 1999a,b). Studies correlating enzyme function and phylogenetic mapping reveal that regiospecificity is a primary characteristic of glycosyltransferases. Therefore, enzymes of distant species, but of the same specificity, group together phylogenetically (Jones and Vogt, 2001; Li et al., 2001; Ross et al., 2001; Vogt and Jones, 2000; Figure 5). In contrast to regiospecificity, the correlation between transferase sugar specificity and gene similarity has not been explored in depth, as the vast majority of the flavonoid glycosyltransferase genes functionally characterized were glucosyltransferases. Two 3-galactosyltransferases (3GalT) that were previously characterized appear to conform to the site specificity clusters of glucosyltransferases, and do not constitute a separate group by themselves (Figure 5). The recently characterized Arabidopsis thaliana flavonol 3-O-rhamnosyltransferase (3RhaT) gene (Jones et al., 2003) similarly maps to the 3GlcT and 3GalT gene cluster. In contrast, the two characterized flavonoid-glucoside rhamnosyltransferases (Petunia hybrida: Brugliera et al., 1994; Kroon et al., 1994; and C. maxima: this work) appear to create a cluster of their own, suggesting a common evolutionary origin for rhamnosyltransferases (or glycosyltransferases in general) specializing in glycosylation of the sugar moieties of flavonoid-glucosides. Both characterized rhamnosyltransferases catalyze the rhamnosylation of a glucose O-linked to the flavonoid skeleton; however, the specificities are significantly different. While the petunia enzyme functions on a 3-O-glucoside substrate and targets the rhamnose to position 6 of the glucose moiety, the citrus enzyme is specific for 7-O-glucoside substrates and targets the rhamnose to position 2 of the glucose moiety. Perhaps this major difference in specificity is reflected in the relatively low similarity between the two sequences, and the relatively ‘loose’ cluster (Figure 5). Functional characterization of additional rhamnosyltransferases catalyzing glycosylation of the flavonoid skeleton or previously bound glucose moieties will be required to establish the precise specificity-of-function significance of this ‘new’ cluster.

Biotransformation of natural compounds using ‘wild-type’ cell cultures has been demonstrated for various species including citrus (Lewinsohn et al., 1986). However, biotransformation using transgenic cell cultures has rarely been used to study the function of recombinant enzymes (Cooper et al., 2002). Bacteria and yeast have usually been the systems of choice to demonstrate recombinant enzyme activity of plant genes; however, plant cell cultures have some built-in advantages for the study of recombinant flavonoid rhamnosyltransferases: (i) the rhamnose source – UDP-rhamnose, which is not synthesized in yeast and bacteria and is not commercially available, is produced in plant cell cultures in sufficient quantities; and (ii) the in vivo analysis approach allows for production of relatively large quantities of the flavonoid-glycoside products, which facilitates non-radioactive analysis of product, and confirmation of identification by mass spectrometry.

Analyses of flavonoid products using TLC and LC-MS were complementary and provided a clear picture of the flavanone glycosylations occurring in the wild-type and transgenic cell lines. TLC provided a rapid system to analyze different conditions, to obtain a working biotransformation protocol, while LC-MS analysis provided confident identification of the compounds. Accordingly, identification of NRG by co-migration using TLC was confirmed by LC-MS, establishing the activity of the recombinant enzyme encoded by Cm1,2RhaT as a 1,2RhaT. The unidentified slow-migrating spot in the TLC (appearing in both wild-type and transgenic cell lines) was identified by LC-MS as an NGG, which appears to result from wide-substrate specificity of endogenous glucosyltransferases in the BY2 cell line (Taguchi et al., 2001).

Substrate specificity of native pummelo 1,2RhaT enzyme is limited to flavonoid-7-O-glucosides (Bar-Peled et al., 1991). This suggests that substrate specificity of recombinant Cm1,2RhaT enzyme includes 7-O-glucosides of flavanones and flavones, but probably not of flavonols. This finding is consistent with the fact that all three groups of flavonoids are found in citrus, but only flavanones and flavones occur as 7-O-neohesperidosides (Berhow et al., 1998), while some flavonols have been documented to occur as 7-O-glucosides (Gil-Izquierdo et al., 2004). Structural differences between the three flavonoid sub-families are small but may be significant for recognition by the enzyme. Flavonols are unique in containing a hydroxyl group at position 3 (ring C) whereas flavones and flavanones contain hydrogen at that position, although they differ in the oxidation level of ring C (Figure 3d). Therefore it is likely that either the added polarity or physical size of the hydroxyl group on ring C of flavonols prevents the interaction with Cm1,2RhaT. Alternatively, we cannot rule out the possibility that the flavonols are rapidly glycosylated at position 3 (ring C), and that the sugar moiety is responsible for steric hindrance inhibiting interaction with the Cm1,2RhaT enzyme. In contrast to the picture seen for ring C, modifications of ring B appear not to affect recognition by the enzyme. We therefore speculate that rings A and C are the specificity determinants, while ring B may not to be included in the interaction with the enzyme substrate-binding site. Based on the speculation that the enzyme encoded by Cm1,2RhaT interacts only with rings A and C, one may expect the two-ringed compound chromone-7-O-glucoside (analogous to flavonoid rings A and C; see Figure 3d) to be rhamnosylated by recombinant Cm1,2RhaT, but this compound is not commercially available. Interestingly, chromone-7-O-neohsperidoside together with NRG were detected in the bark of Ailanthus integrifolia (Kosuge et al., 1994) of the family Simaroubaceae, a sister family to Rutaceae (which includes the genus Citrus). It is likely that both NRG and chromone-7-O-neohesperidoside are the products of an enzyme closely related to Cm1,2RhaT, thus supporting the substrate-specificity-determinant speculation we proposed above. Acceptance of a variety of 7-O-glucoside phenolic substrates by Cm1,2RhaT is another example of how a relatively small number of plant enzymes/genes involved in secondary metabolism can give rise to a vast array of metabolites (Schwab, 2003).

Flavonoid-7-O-neohesperidosides are not very common flavonoid-glycosides in plants, but are not unique to the genus Citrus or even to the order Rutales. Flavonoid-7-O-neohesperidosides have been detected in the Solanaceae (Pomilio and Gros, 1979), Compositeae (Park et al., 1995), Clusiaceae (Alam et al., 1987) and Rubiaceae (Cimanga et al., 1995). Therefore, it is all the more difficult to explain the divergence within the genus citrus between species containing only bitter flavanone-7-O-neohesperidosides (i.e. pummelo) and species containing only tasteless flavanone-7-O-rutinosides (i.e. mandarin). The data presented here suggest that a 1,2RhaT enzyme is absent in the non-bitter species; however, it is difficult at this stage to determine whether this results from the actual lack of a functional gene in these species, or from extremely low gene expression levels. The flavanone-7-O-glucoside:1,6 rhamnosyltransferase activity characteristic of the rutinoside-exclusive species has been described (Lewinsohn et al., 1989b), but the enzyme has not been purified and the gene has not yet been characterized. Based on regiospecificity, the 1,6RhaT enzyme encoding gene may be expected to map to the same ‘new’ phylogenetic cluster as Cm1,2RhaT (flavonoid-glucoside RhaT cluster; Figure 5). Albeit, the relationship is expected to be distant because of the lack of immunological cross reactivity and because of specificity for a different rhamnosylation site.

Citrus flavanone-glycosides have been noted to accumulate only in young tissue (leaves, flowers, and fruit), and are later diluted in fruit to their final concentration during the process of development and ripening (Castillo et al., 1992; Jourdan et al., 1985; Ortuno et al., 1995). Studies at the protein level show that 1,2RhaT activity is prominent only in young fruit and leaves (Bar-Peled et al., 1993). Accordingly, the present data suggest that the developmental regulation of flavanone accumulation in citrus occurs via gene expression regulation. As the results we obtained were identical for two different gene-specific primers, it is likely that the same gene is expressed in both leaves and fruit. However, as the citrus genome sequence is not available as yet, we cannot rule out the possibility that separate Cm1,2RhaT-like highly homologous genes are differentially expressed in citrus tissues.

The flavonoid biosynthetic pathways are attractive targets for metabolic engineering, to modulate a variety of plant characteristics (Dixon and Steele, 1999; Forkmann and Martens, 2001). In this context, isolation of the gene Cm1,2RhaT provides a new tool to manipulate fruit flavor and health-benefiting value. The potential of metabolic engineering for the production of commercially desirable plant flavonoids has also been demonstrated in microorganisms (Hwang et al., 2003). However, full realization of this potential will require the use of plant genes encoding various modification enzymes such as flavonoid glucosyl and rhamnosyltransferases. As UDP-rhamnose has not been documented outside of the plant kingdom, the use of plant-originating rhamnosyltransferases may be limited to plants alone at this stage.

Plant material

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Young leaves (up to 1 cm length) were collected from pummelo (C. maxima), mandarin (C. reticulata), orange (C. sinensis), grapefruit (C. paradisi), citron (C. medica), sour-orange (C. aurantium), poncirus (P. trifoliata) and kumquat (F. margarita) trees and frozen at −80°C for the purpose of protein or RNA purification. Young fruit (up to 1 cm in diameter) and mature fruit peel were collected from grapefruit and frozen at −80°C for RNA purification.

Tobacco BY2 cell cultures (Nagata et al., 1992) were maintained and transformed as previously described (Shaul et al., 1996).

Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

The enzyme 1,2 rhamnosyltransferase (1,2RhaT) was purified from pummelo leaves as described (Bar-Peled et al., 1991). Purified protein (10 μg) was reduced with 10 mm DTT and denatured with 1% SDS in 5 μl of 500 mm Tris-HCl pH 7.5, for 20 min at 50°C. After cooling to room temperature, 80 μl of distilled water and 10 μl of acetonitrile were added to the denatured protein, followed by the addition of 10 ng sequence grade protease (endoproteinase Asp-N; endoproteinase Lys-C; and trypsin; Roche Applied Science, Mannheim, Germany). Samples were incubated for 5 h at 37°C, and were then diluted with denaturing sample buffer before separation on 12.5% SDS-PAGE. PAGE-separated proteins were electro-blotted onto Immobilon-P 0.45 μm pore size PVDF membranes (Millipore, Bedford, MA, USA). Membranes were stained with 0.1% Coomassie brilliant blue (dissolved in 50% methanol) and destained with 30% methanol: 10% acetic acid and then washed several times in distilled water. After air-drying, the bands of interest were cut and subjected to N-terminal amino acid sequencing. N-terminal sequencing was performed at the Biological Service Unit of the Weizmann Institute of Science using an Applied Biosystems (Foster City, CA, USA) 477A pulsed liquid protein sequencer. Peptide sequences that were obtained and the corresponding degenerate primers designed for gene isolation are detailed in Figure 2(a).

Immunoblotting was performed as previously described using antibodies raised against 1,2 rhamnosyltransferase purified from pummelo leaves (Bar-Peled et al., 1993).

Isolation of the gene Cm1,2RhaT

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Total RNA was extracted from young pummelo leaves according to Logemann et al., 1987. mRNA was purified for RT-PCR applications by PolyAtract mRNA Isolation system III (Promega, Madison, WI, USA). Poly-A RNA (500 ng) was reverse transcribed using Superscript II reverse transcriptase (Gibco/BRL Life Technologies, Inc., Gaithersburg, MO, USA) and 10 pmol of tailed oligo-(dT) primer (5′GTTTTCCCAGTCACGACGTTTTTTTTTTTTTTT). PCR was performed using different combinations of the degenerate primers (Figure 2a) and the resulting products were cloned and sequenced. A relevant product (obtained using primers Lys-C-S and Trypsin-AS; see Figure 2a) was identified by the presence of the internal sequence EKMTIEEA, which is identical to one of the Asp-N peptide sequences. Gene-specific primers based on the RT-PCR fragment sequence were used to isolate the complete cDNA by RACE techniques. For 5′-RACE (Eyal et al., 1999), single-strand cDNA was synthesized using the oligonucleotide 5′CTTGGATTAGAGGCCCTACTGG. The 5′-RACE inverse product was amplified using oligonucleotides 5′GTAGTTCTCTCTAACTTAGGTTC and 5′CCAGTAGGGCCTCTAATCCAAG as described (Eyal et al., 1999). For 3′-RACE single-strand cDNA was synthesized using tailed oligo-(dT) primer (5′GTTTTCCCAGTCACGACGTTTTTTTTTTTTTTT). The gene-specific primer (5′GTACA-AGGTTGGGTTCCGCAG) was used in conjunction with tail-primer (5′ GTTTTCCCAGTCACGACG) to amplify a 3′-RACE fragment by PCR. Two primers flanking the coding region of Cm1,2RhaT (5′CTTGTCATGAATACCAAGCATCAAGATAAG; and 5′GCATCCTTATTCAGATTTCTTGACAAG C) were used to amplify the corresponding grapefruit (C. paradisi) homologue by RT-PCR on mRNA extracted from grapefruit young leaves, as described above for pummelo.

Biotransformation of flavonoids using transgenic BY2 cell culture

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

The coding sequence of Cm1,2RhaT was amplified by RT-PCR. Single-strand cDNA was prepared as described for 3′-RACE. Amplification was aceived using the oligonucleotides 5′GGTCGAGAGCTCTTATTCAGATTTCTTGAC and 5′GCTCAGGTCTCTAGAGAACATGGATACCAAG as well as Pfu DNA Polymerase (Stratagene, San Diego, CA, USA). The amplified fragment was cloned into the binary vector pME504 (M. Flaishman, The Volcani Center, ARD, Bet-Dagan, Israel, unpublished data) at the XbaI and SacI restriction sites under the control of a CAMV-35S promoter. The resulting construct was used to stably transform BY2 cell culture (Nagata et al., 1992) according to a published protocol (Shaul et al., 1996). To initiate biotransformation studies, transgenic and wild-type cell cultures were diluted (400 μl culture into 20 ml new media) and grown in Erlenmeyer flasks for 4 days. Flavonoid aglycones or glycosides were dissolved in DMSO to a concentration of 30 mm and added to the flasks to a final concentration of 0.15 mm. The cultures were grown for an additional 48 h before harvest. The cell cultures and media were boiled together for 15 min, cooled to room temperature and then extracted with water-saturated n-butanol. The butanol phase was transferred to a new tube and dried.

Analysis of flavanone-glycoside products by TLC

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Biotransformation products were resuspended in DMSO and analyzed by TLC. Samples (1–3 μl) were loaded on Silica gel 60 TLC plates (Merck, Darmstadt, Germany) and separated in solvent (n-butanol:methanol:ethylacetate:dichloromethane – 1:1:1:1) in a standard TLC chamber. TLC plates were dried and fluorescence was developed by spraying with 1% AlCl3 in methanol (Markham, 1982). Photographs were obtained using a digital camera (Nikon Coolpix 5000, Nikon Corporation, Tokyo, Japan) while irradiating the TLC plate with medium-range UV (302 nm). Putative NRG spots, which appeared only in the transgenic cell line biotransformation extract, were scraped from the TLC plate, eluted in methanol, dried and analyzed by LC-MS (see below).

Analysis of flavanone-glycoside products by LC-MS

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

LC-MS analyses were conducted using an Agilent 1100 HPLC coupled to a Bruker Esquire (Bruker Daltonics, Billerica, MA, USA) ion-trap mass spectrometer. HPLC separations were achieved using a reversed phase, C18, 5 μm, 4.6 × 250 mm column (J.T. Baker, Phillipsburg, NJ, USA). Samples were eluted with a linear gradient of 95%A:5%B to 5%A:95%B over 90 min and at a flow rate of 0.8 ml min−1. Mobile phases consisted of (i) 0.1% aqueous acetic acid and (ii) acetonitrile. Negative-ion electrospray ionization (ESI) mass spectra were acquired using a source potential of 3000 V and capillary offset potential of −70.7 V. Nebulization was achieved using nitrogen gas delivered at a pressure of 70 p.s.i. Desolvation was aided by a counter current gas of nitrogen at a pressure of 12 p.s.i. and a capillary temperature of 360°C. Mass spectra were recorded over the m/z range of 50–2200. The Bruker ion-trap mass spectrometer was operated using an ion current control preset at 20 000, a maximum acquire time of 100 msec, and a trap drive setting of 60. Tandem mass spectra were obtained using automated LC/MS/MS following the selection of the two most abundant ions above m/z 200 as precursor ions for MS/MS. Tandem spectra were then acquired using an isolation width of 2.0, a fragmentation amplitude of 0.83, and a threshold setting of 5000. Ion charge control was set at 2000 with a maximum acquire time set at 100 msec.

RT-PCR analysis of gene expression

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

Total RNA was extracted from young and mature grapefruit peel and leaves as previously described (Jacob-Wilk et al., 1999). cDNA was synthesized from 1 μg total RNA of each sample using a tailed oligo-(dT) primer (5′GTTTTCCCAGTCACGACGTTTTTTTTTTTTTTT) and Superscript II reverse transcriptase according to the manufacturers instructions (BRL, Life Technologies). Amplification of cDNA gene-specific products (not affected by potential genomic DNA contamination) was obtained by PCR using one gene-specific primer (5′CCATCTCTCATCGGAATGGAA for the actin gene control; 5′CAGTAGGGCCTCTAATCCAAGAACC or 5′CTTTGGCAGTGAGTACTTTCCTTCC for Cm1,2RhaT) and one tail-primer associated with the poly-T end of the cDNA (5′GTTTTCCCAGTCACGACG). The amplification consisted of 35 cycles of 94°C-20 sec, 62°C-30 sec, 72°C-90 sec and products were separated by gel electrophoresis and visualized by ethidium bromide staining.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882

We thank Dr Moshe Flaishman of the Volcani Center for providing the binary vector PME504. This research was supported by Research Grant No. IS-2851-97R from BARD, The United States–Israel Binational Agricultural Research and Development Fund. Salary support for L.W. Sumner and D. Huhman as well as mass spectrometry equipment were provided by The Samuel Roberts Noble Foundation, Ardmore, OK, USA.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Partial-peptide sequencing of citrus 1,2RhaT and isolation of the encoding gene Cm1,2RhaT
  6. Recombinant Cm1,2RhaT enzyme activity demonstrated in planta using transgenic tobacco cell culture
  7. Transgenic tobacco cell-culture overexpressing Cm1,2RhaT performs a two-step biotransformation of naringenin to naringin
  8. Cm1,2RhaT substrate specificity is not limited to flavanones
  9. Cm1,2RhaT maps phylogenetically to a new subgroup of the flavonoid glycosyltransferase family
  10. Cm1,2RhaT protein is detected only in flavonoid-7-O-neohesperidoside-containing citrus species
  11. Cm1,2RhaT mRNA is detected in young fruit and leaves
  12. Discussion
  13. Experimental procedures
  14. Plant material
  15. Purification of 1,2 RT protein, proteolysis, protein sequencing, and immunoblotting
  16. Isolation of the gene Cm1,2RhaT
  17. Biotransformation of flavonoids using transgenic BY2 cell culture
  18. Analysis of flavanone-glycoside products by TLC
  19. Analysis of flavanone-glycoside products by LC-MS
  20. RT-PCR analysis of gene expression
  21. Sequence analysis and phylogenetic tree software tools
  22. Acknowledgements
  23. References
  24. Accession number: AY048882
  • Alam, M.S., Kamil, M. and Ilyas, M. (1987) 4′-Hydroxywogonin 7-neohesperidoside from Garcinia andamanica. Phytochemistry, 26, 18431844.
  • Bar-Peled, M., Lewinsohn, E., Fluhr, R. and Gressel, J. (1991) UDP-rhamnose:flavanone-7-O-glucoside-2′′-O-rhamnosyltransferase. Purification and characterization of an enzyme catalyzing the production of bitter compounds in citrus. J. Biol. Chem. 266, 2095320959.
  • Bar-Peled, M., Fluhr, R. and Gressel, J. (1993) Juvenile-specific localization and accumulation of a rhamnosyltransferase and its bitter flavonoid in foliage, flowers, and young citrus fruits. Plant Physiol. 103, 13771384.
  • Benavente-Garcia, O., Castillo, J., Marin, F.R., Ortuno, A. and Del Rio, J.A. (1997) Uses and properties of citrus flavonoids. J. Agric. Food Chem. 45, 45054515.
  • Berhow, M.A. and Smolensky, D. (1995) Developmental and substrate specificity of hesperetin-7-O-glucosyltranseferase activity in Citrus limon tissues using high-performance liquid chromatographic analysis. Plant Sci. 112, 139147.
  • Berhow, M.A. and Vandercook, C.E. (1991) Sites of naringin biosynthesis in grapefruit. J. Plant Physiol. 138, 176179.
  • Berhow, M.A., Tisserat, B., Kanes, K. and Vandercook, C. (1998) Survey of Phenolic Compounds Produced in Citrus. USDA, ARS, Technical Bulletin No. 1856. Washington DC: US Government Printing Office.
  • Bowles, D. (2002) A multigene family of glycosyltransferases in a model plant, Arabidopsis thaliana. Biochem. Soc. Trans. 30, 301306.
  • Brugliera, F., Holton, T.A., Stevenson, T.W., Farcy, E., Lu, C.Y. and Cornish, E.C. (1994) Isolation and characterization of a cDNA clone corresponding to the Rt locus of Petunia hybrida. Plant J. 5, 8192.
  • Castillo, J., Benavente-Garcia, O. and Del Rio, J.A. (1992) Naringin and neohesperidin levels during development of leaves, flower buds, and fruits of Citrus aurantium. Plant Physiol. 99, 6773.
  • Chiba, H., Uehara, M., Wu, J., Wang, X., Masuyama, R., Suzuki, K., Kanazawa, K. and Ishimi, Y. (2003) Hesperidin, a citrus flavonoid, inhibits bone loss and decreases serum and hepatic lipids in ovaryectomized mice. J. Nutr. 133, 18921897.
  • Cimanga, K., Bruyne, T., Lasure, A., Li, Q., Pieters, L.L., Claeys, M., Berghe, D.V., Kambu, K., Tona, L. and Vlietinck, A. (1995) Flavonoid-O-glycosides from the leaves of Morinda morindoides. Phytochemistry, 38, 13011303.
  • Cooper, J.D., Qiu, F. and Paiva, N.L. (2002) Biotransformation of an exogenously supplied isoflavonoid by transgenic tobacco cells expressing alfalfa isoflavone reductase. Plant Cell Rep. 20, 876884.
  • Coutinho, P.M. and Henrissat, B. (1999a) Carbohydrate-Active Enzymes. Available at URL: http://afmb.cnrs-mrs.fr/cazy/CAZY/index.html.
  • Coutinho, P.M. and Henrissat, B. (1999b) Carbohydrate-active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering (Gilbert, H.J., Davies, G., Henrissat, B. and Svensson, B. eds). Cambridge: The Royal Society of Chemistry, pp. 312.
  • Del Rio, J.A., Arcas, M.C., Benavente-Garcia, O. and Ortuno, A. (1998) Citrus polymethoxylated flavones can confer resistance against Phytophthora citrophthora, Penicillium digitatum, and Geotrichum species. J. Agric. Food Chem. 46, 44234428.
  • Del Rio, J.A., Gomez, P., Baidez, A.G., Arcas, M.C., Botia, J.M. and Ortuno, A. (2004) Changes in the levels of polymethoxyflavones and flavanones as part of the defense mechanism of Citrus sinensis (cv. Valencia Late) fruits against Phytophthora citrophthora. J. Agric. Food Chem. 52, 19131917.
  • Dixon, R.A. and Steele, C.L. (1999) Flavonoids and isoflavonoids – a gold mine for metabolic engineering. Trends Plant Sci. 4, 394400.
  • Ebel, J. and Hahlbrock, K. (1982) Biosynthesis. In The Flavonoids, Advances in Research (Harborne, J.B. and Malory, T.J., ed.). London: Chapman & Hall, pp. 641679.
  • Emanuelsson, O., Nielsen, H., Brunak, S. and von Heijne, G. (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300, 10051016.
  • Eyal, Y., Neumann, H., Or, E. and Frydman, A. (1999) Inverse single-strand RACE: an adapter-independent method of 5′ RACE. Biotechniques, 27, 656658.
  • Forkmann, G. and Martens, S. (2001) Metabolic engineering and applications of flavonoids. Curr. Opin. Biotechnol. 12, 155160.
  • Garg, A., Garg, S., Zaneveld, L.J. and Singla, A.K. (2001) Chemistry and pharmacology of the Citrus bioflavonoid hesperidin. Phytother. Res. 15, 655669.
  • Gil-Izquierdo, A., Riquelme, M.T., Porras, I. and Ferreres, F. (2004) Effect of rootstock and interstock grafted in lemon tree [Citrus limon (L.) Burm.] on the flavonoid content of lemon juice. J. Agric. Food Chem. 52, 324331.
  • Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 9598.
  • Harborne, J.B. (1967) Comparative Biochemistry of the Flavonoids. London, UK: Academic Press Inc.
  • Hasegawa, S. and Hoagland, J.E. (1977) Biosynthesis of limonoids in citrus. Phytochemistry, 16, 469471.
  • Horowitz, R.M. (1986) Taste effects of flavonoids. In Plant Flavonoids in Biology and Medicine, Biochemical, Pharmacological, and Structure-Activity (Cody, V., Middleton, E.Jr and Harborne, J. eds). New York, NY: Alan R. Liss, pp. 163175.
  • Horowitz, R.M. and Gentili, B. (1961) Phenolic glycosides of grapefruit: a relation between bitterness and structure. Arch. Biochem. Biophys. 92, 191192.
  • Hwang, E.I., Kaneko, M., Ohnishi, Y. and Horinouchi, S. (2003) Production of plant-specific flavanones by Escherichia coli containing an artificial gene cluster. Appl. Environ. Microbiol. 69, 26992706.
  • Jacob-Wilk, D., Holland, D., Goldschmidt, E.E., Riov, J. and Eyal, Y. (1999) Chlorophyll breakdown by chlorophyllase: isolation and functional expression of the Chlase1 gene from ethylene-treated Citrus fruit and its regulation during development. Plant J. 20, 653661.
  • Jagetia, G.C. and Reddy, T.R. (2002) The grapefruit flavanone naringin protects against the radiation-induced genomic instability in the mice bone marrow: a micronucleus study. Mutat. Res. 519, 3748.
  • Jones, P. and Vogt, T. (2001) Glycosyltransferases in secondary plant metabolism: tranquilizers and stimulant controllers. Planta, 213, 164174.
  • Jones, P., Messner, B., Nakajima, J., Schaffner, A.R. and Saito, K. (2003) UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana. J. Biol. Chem. 278, 4391043918.
  • Jourdan, P.S., McIntosh, C.A. and Mansell, R.L. (1985) Naringin levels in citrus tissues II. Quantitative distribution of naringin in C. paradisi. Plant Physiol. 77, 903908.
  • Kim, H.K., Jeon, W.K. and Ko, B.S. (2001) Flavanone glycosides from Citrus junos and their anti-influenza virus activity. Planta Med. 67, 548549.
  • Kosuge, K., Mitsunaga, K., Koike, K. and Ohmoto, T. (1994) Studies on the constituents of Ailanthus integrifolia. Chem. Pharm. Bull. 42, 16691671.
  • Kroon, J., Souer, E., de Graaff, A., Xue, Y., Mol, J. and Koes, R. (1994) Cloning and structural analysis of the anthocyanin pigmentation locus Rt of Petunia hybrida: characterization of insertion sequences in two mutant alleles. Plant J. 5, 6980.
  • Lewinsohn, E., Berman, E., Mazur, Y. and Gressel, J. (1986) Glucosylation of exogenous flavanones by grapefruit cell cultures. Phytochemistry, 25, 25312535.
  • Lewinsohn, E., Britsch, L., Mazur, Y. and Gressel, J. (1989a) Flavanone glycoside biosynthesis in citrus. Chalcone synthase, UDP-glucose:flavanone-7-O-glucosyl-transferase and –rhamnosyl-transferase activities in cell-free extracts. Plant Physiol. 91, 13231328.
  • Lewinsohn, E., Berman, E., Mazur, Y. and Gressel, J. (1989b) (7)-Glucosylation and (1–6) rhamnosylation of exogenous flavanones by undifferentiated Citrus cell cultures. Plant Sci. 61, 2328.
  • Li, Y., Baldauf, S., Lim, E.K. and Bowles, D.J. (2001) Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana. J. Biol. Chem. 276, 43384343.
  • Logemann, J., Schell, J. and Willmitzer, L. (1987) Improved method for the isolation of RNA from plant tissues. Anal. Biochem. 163, 1620.
  • Maier, V.P. and Beverly, G.D. (1968) Limonin monolactone, the non-bitter precursor responsible for delayed bitterness in certain citrus juices. J. Food Sci. 33, 488492.
  • Manthey, J.A. and Guthrie, N. (2002) Antiproliferative activities of citrus flavonoids against six human cancer cell lines. J. Agric. Food Chem. 50, 58375843.
  • Manthey, J.A., Grohmann, K. and Guthrie, N. (2001) Biological properties of citrus flavonoids pertaining to cancer and inflammation. Curr. Med. Chem. 8, 135153.
  • Markham, K.R. (1982) Techniques of Flavonoid Identification. London: Academic Press.
  • McIntosh, C.A. and Mansell, R.L. (1997) Three-dimensional distribution of limonin, limonoate A-ring monolactone, and naringin in the fruit tissues of three varieties of Citrus paradisi. J. Agric. Food Chem. 45, 28762883.
  • McIntosh, C.A., Mansell, R.L. and Rouseff, R.L. (1982) Distribution of limonin in the fruit tissues of nine grapefruit cultivars. J. Agric. Food Chem. 30, 689692.
  • McIntosh, C.A., Latchinian, L. and Mansell, R.L. (1990) Flavanone-specific 7-O glucosyltransferase activity in Citrus paradisi seedlings: purification and characterization. Arch. Biochem. Biophys. 282, 5057.
  • Moriguchi, T., Kita, M., Tomono, Y., Endo-Inaguki, T. and Omura, M. (2001) Gene expression in flavonoid biosynthesis: correlation with flavonoid accumulation in developing citrus fruit. Physiol. Plant. 114, 251258.
  • Nagata, T., Nemoto, Y. and Hazezawa, S. (1992) Tobacco BY2 cell line as the ‘HeLa’ cell in the cell biology of higher plants. Int. Rev. Cytol. 132, 130.
  • Ortuno, A., Garcia-Puig, D., Fuster, M.D., Perez, M.L., Sabater, F., Porras, I., Garcia-Lidon, A. and Del Rio, J.A. (1995) Flavanone and nootkatone levels in different varieties of grapefruit and pummelo. J. Agric. Food Chem. 43, 15.
  • Ortuno, A., Arcas, M.C., Botia, J.M., Fuster, M.D. and Del Rio, J.A. (2002) Increasing resistance against Phytophthora citrophthora in tangelo Nova fruits by modulating polymethoxyflavones levels. J. Agric. Food Chem. 50, 28362839.
  • Page, R.D.M. (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci., 12, 357358.
  • Park, J.C., Lee, J.H. and Choi, J.S. (1995) A flavone diglycoside from Citrus japonicum var. ussuriense. Phytochemistry, 39, 261262.
  • Pomilio, A.B. and Gros, E.G. (1979) Pinocembrin 7-neohesperidoside from Nierembergia hippomanica. Phytochemistry, 18, 14101411.
  • Ranganna, S., Govindarajan, V.S. and Ramana, K.V. (1983) Citrus fruits varieties, chemistry, technology, and quality evaluation. Part II. Chemistry, technology, and quality evaluation. Crit. Rev. Food Sci. Nutr. 18, 313386.
  • Ross, J., Li, Y., Lim, E. and Bowles, D.J. (2001) Higher plant glycosyltransferases. Genome Biol. 2: reviews, 3004.13004.6.
  • Rouseff, R.L. and Naim, M. (2000) Citrus flavor stability. In Flavor Chemistry: Industrial and Academic Research (Ho, C.-T. and Risch, S.J., eds). Washington DC: American Chemical Society, pp. 101122.
  • Rousseff, R.L., Martin, S.F. and Youtsey, C.O. (1987) Quantitative survey of narirutin, naringin, hesperidin and neohesperidin in citrus. J. Agric. Food Chem. 35, 10271030.
  • Schwab, W. (2003) Metabolome diversity: too few genes, too many metabolites. Phytochemistry, 62, 837849.
  • Shaul, O., Mironov, V., Burssens, S., Van Montagu, M. and Inze, D. (1996) Two Arabidopsis cyclin promoters mediate distinctive transcriptional oscillation in synchronized tobacco BY-2 cells. Proc. Natl Acad. Sci. USA, 93, 48684872.
  • Taguchi, G., Imura, H., Maeda, Y., Kodaira, R., Hayashida, N., Shimosaka, M. and Okazaki, M. (2000) Purification and characterization of UDP-glucose: hydroxycoumarin 7-O-glucosyltransferase, with broad substrate specificity from tobacco cultured cells. Plant Sci. 157, 105112.
  • Taguchi, G., Yazawa, T., Hayashida, N. and Okazaki, M. (2001) Molecular cloning and heterologous expression of novel glucosyltransferases from tobacco cultured cells that have broad substrate specificity and are induced by salicylic acid and auxin. Eur. J. Biochem. 268, 40864094.
  • Vogt, T. and Jones, P. (2000) Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci. 5, 380386.