SEARCH

SEARCH BY CITATION

Keywords:

  • biochemistry;
  • environmental stress;
  • metabolism;
  • starch;
  • temperature stress

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

It has been suggested that beta-amylase (BMY) induction during temperature stress in Arabidopsis could lead to starch-dependent maltose accumulation, and that maltose may contribute to protection of the electron transport chain and proteins in the chloroplast stroma during acute stress. A time-course transcript profiling analysis for cold shock at 4°C revealed that BMY8 (At4g17090) was induced specifically in response to cold shock, while major induction was not observed for any of the other eight beta-amylases. A parallel metabolite-profiling analysis revealed a robust transient maltose accumulation during cold shock. BMY8 RNAi lines with lower BMY8 expression exhibited a starch-excess phenotype, and a dramatic decrease in maltose accumulation during a 6-h cold shock at 4°C. The decreased maltose content was also accompanied by decreased glucose, fructose and sucrose content in the BMY8 RNAi plants, consistent with the roles of beta-amylase and maltose in transitory starch metabolism. BMY8 RNAi lines with reduced soluble sugar content exhibited diminished chlorophyll fluorescence as Fv/Fm ratio compared with wild type, suggesting that PSII photochemical efficiency was more sensitive to freezing stress. Together, carbohydrate analysis and freezing stress results of BMY8 RNAi lines indicate that increased maltose content, by itself or together through a maltose-dependent increase in other soluble sugars, contributes to the protection of the photosynthetic electron transport chain during freezing stress.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The function of beta-amylase in plants is starch breakdown (Scheidig et al., 2002). During starch breakdown, beta-amylase (an exoamylase) hydrolyzes α-1,4 glycosidic linkages of polyglucan chains at the non-reducing end to produce maltose (4-O-α-D-glucopyranosyl-β-D-glucose). Downregulation of a chloroplast-localized beta-amylase by antisense RNA methods results in a starch-excess phenotype in potato leaves (Scheidig et al., 2002). Plants with reduced chloroplastic beta-amylase activity degrade 8–30% of their total starch in the dark, while wild-type plants degrade about 50% (Scheidig et al., 2002). Additionally, hydrolytic rather than phosphorolytic cleavage appears to be predominant during transitory starch degradation (Lu and Sharkey, 2004; Scheidig et al., 2002; Sharkey et al., 2004; Weise et al., 2004; Zeeman et al., 2004).

The product of beta-amylase, maltose, is presently thought to be metabolized in the cytosol following hydrolytic cleavage. Several studies have shown that export of maltose occurs from isolated chloroplasts (Neuhaus and Schulte, 1996; Servaites and Geiger, 2002; Weise et al., 2004, 2005), presumably through the recently discovered maltose translocator (MEX1) present in the chloroplast envelope (Niittylèa et al., 2004). Mutations in the maltose translocator, a single-copy gene in Arabidopsis, results in a starch-excess phenotype and elevated maltose content (Niittylèa et al., 2004). Once maltose is exported to the cytosol, cytosolic disproportionating glucosyltransferases further metabolize it to glucose and maltodextrins (Chia et al., 2004; Lu and Sharkey, 2004). When cytosolic amylomaltase (disproportionating enzyme II, DPE2), which transfers a glucosyl unit of maltose to glycogen or amylopectin (Chia et al., 2004), is eliminated by a T-DNA insertion, knockout plants (dpe2) contain high levels of maltose (Chia et al., 2004; Lu and Sharkey, 2004), maltodextrins and starch (Lu and Sharkey, 2004).

Beta-amylase transcript and/or activity is induced during temperature stress (Datta et al., 1999; Dreier et al., 1995; Fowler and Thomashow, 2002; Jung et al., 2003; Kreps et al., 2002; Seki et al., 2001, 2002; Sung, 2001), and increased beta-amylase transcript and/or activity is linked with the increase in maltose content (Kaplan and Guy, 2004; Nielsen et al., 1997). For example, reducing potato tuber storage temperature from 20 to 5 or 3°C resulted in increased beta-amylase activity (four- to fivefold) over a 10-day period (Nielsen et al., 1997). The increases in beta-amylase activity were correlated with maltose accumulation, whereas the activities of α-glucosidase and endoamylase remained unchanged (Nielsen et al., 1997). When Arabidopsis was cold-stressed at 4°C for 12 h, expression of a chloroplast-localized beta-amylase (AJ25034; ct-Bmy or BMY8) increased (Kaplan and Guy, 2004; Sung, 2001), and induction occurred as early as 2 h after exposure to cold stress (Seki et al., 2001). More recently, increases in beta-amylase transcript abundance were found to be correlated with maltose accumulation (Kaplan and Guy, 2004).

Heat stress also induced beta-amylase transcript level (BMY7; At3g23920) (Kaplan and Guy, 2004; Sung, 2001) and beta-amylase activity (Dreier et al., 1995). When Arabidopsis plants grown at 20°C were exposed to 40°C for 1 h, the BMY7 transcript increased about fivefold (Kaplan and Guy, 2004; Sung, 2001). This was also accompanied by maltose accumulation (Kaplan and Guy, 2004). Similarly, raising barley growth temperature from 25 to 35°C resulted in induction of beta-amylase activity (Dreier et al., 1995).

It has been suggested that the increase in maltose content during temperature shock might contribute to protection of the photosynthetic electron transport chain and proteins in the chloroplast stroma (Kaplan and Guy, 2004). Maltose has also been shown to have compatible solute properties, and can contribute to the protection of the photosynthetic electron transport chain in vitro (Kaplan and Guy, 2004). The present study provides evidence that BMY8 RNAi lines with reduced beta-amylase transcript levels have reduced maltose accumulation in response to cold shock, compared with wild-type (WT) plants. Following freezing stress, BMY8 RNAi lines exhibit significantly greater damage to the photosynthetic electron transport apparatus, as evidenced by reduced chlorophyll fluorescence parameters. Therefore beta-amylase is central to maltose accumulation, which, by itself or through a maltose-dependent increase in other soluble sugar content, contributes to protection of the PSII photochemical efficiency, proteins and membranes during temperature shock.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Parallel transcript and metabolite profiling

Parallel transcript and metabolite profiling analyses were done to determine the influence of temperature shock on transcript levels of beta-amylases and maltose content. Plants were exposed to 4°C for 0, 1, 4, 12, 24, 48 and 96 h (Figure 1), and 0, 24, 48 and 96 h cold shock samples were taken at the same time point of the photoperiod, which was 2 h after the start of the light period. The steady-state transcript level of chloroplast-targeted beta-amylase (BMY8) (Figure 1) showed a transient increase with a peak at 24 h, and the increase in transcript level at 4°C was evident within 4 h of exposure. Transcript levels of the other beta-amylases (Figure 1) were either unchanged or lower (BMY1 and 3) during temperature shock, except for BMY9, which exhibited a small but significant increase in transcript levels in cold-stressed shoots of Arabidopsis. Overall, expression analysis indicates that the increase in the level of BMY8 transcripts during cold shock was unique to this gene. GC–MS analysis revealed that maltose content increased transiently during cold shock, peaking at about 4 h (Figure 1). The increase in maltose content appeared to precede major increases in BMY8 transcript level. This indicates that the modulation of maltose content during cold shock cannot be explained exclusively by transcriptional regulation.

image

Figure 1. Parallel transcript and metabolite profiling analysis during cold shock. Transcript profiles for key enzymes in the starch-degradation pathway and changes in maltose content in response to cold shock were determined in Arabidopsis leaves. Plants were exposed to temperature at 4°C for 0, 1, 4, 12, 24, 48 and 96 h. Time 0, 24, 48 and 96 cold-shock samples were taken at precisely the same point in the photoperiod, 2 h into the light period. Error bars indicate standard deviation (±SD) of the mean for three experiments. SEX1 (R1/GWD; At1g10760) glucan, water dikinase; AMY3 (At1g69830) alpha-amylase; DPE1 (At5g64860) disproportioning enzyme 1 chloroplastic form; MEX1 (At5g17520) maltose exporter; GLT1 (At5g16150) glucose transporter; DPE2 (At2g40840) disproportioning enzyme 2 cytosolic form; BMY1 (At4g15210); BMY2 (At5g45300); BMY3 (At5g18670); BMY4 (At2g45880); BMY5 (At2g32290); BMY6 (At5g55700); BMY7 (At3g23920); BMY8 (At4g17090); BMY9 (At4g00490).

Download figure to PowerPoint

The transcript levels of BMY8 and maltose content are regulated diurnally (Harmer et al., 2000; Smith et al., 2004b). In the present experiment, the cold-shock sampling times of 1, 4 and 12 h comprise a sizeable portion of the diurnal cycle. To rule out the possibility that the increase in the maltose content and BMY8 transcript level were due to diurnal regulation, a 20°C control sample at the same time period as the 4-h cold-shock sample was taken (Figure 2). The 4-h cold-shock time point is key because that is where maltose content showed peak accumulation (Figure 1). BMY8 transcript level and maltose content did not increase between 2 and 6 h into the light period, in plants grown at 20°C (Figure 2). However, when plants were cold-shocked at 4°C for 4 h (cold shock started 2 h into the light period), both BMY8 transcript level and maltose content showed unmistakable increases (Figure 2), demonstrating that the increases in maltose content and BMY8 transcript level were not the result of diurnal regulation.

image

Figure 2. Changes in BMY8 transcript levels and maltose content during cold shock. The 0-h control (left) is at 2 h into the light period; the 4-h control (middle) is at 6 h into the light period; and the 4-h cold-shock (right) is 6 h into the light period. Cold shock was initiated at time 0 h, 2 h into the light period. Error bars indicate standard deviation (±SD) of the mean for three experiments.

Download figure to PowerPoint

Transcript profiles for key enzymes of starch degradation pathways were also examined to determine whether modulation of BMY8 expression is part of a general stress response of genes for starch-degrading enzymes. Transcript levels of glucan-water dikinase (SEX1/R1/GWD) and alpha-amylase (AMY3) were increased transiently (Figure 1) with peak levels at 12 and 24 h of cold shock. However, compared with the 20°C 4 h control, SEX1 expression at 4 h of cold shock was not statistically different. Similarly, AMY3 was regulated diurnally. The increase in AMY3 expression was statistically higher in 4 h cold-shock plants compared with 20°C 0 h controls; however, AMY3 expression in 4-h cold-shock plants was statistically lower when compared with 20°C 4 h controls. Cytosolic disproportioning enzyme II (DPE2) transcript levels showed a significant increase after 12 h of cold shock (Figure 1). The increase in DPE2 transcript level at 4 h of cold shock, however, was due not to cold shock but to diurnal regulation. The transcript levels of chloroplastic disproportioning enzyme I (DPE1) (Figure 1) was repressed by cold shock, except for 12 and 96 h. Transcript levels of the maltose translocator (MEX1) (Figure 1) at 4 h cold shock, when maltose content shows a peak accumulation, was not statistically different from the corresponding 4 h 20°C controls, and its transcript level was repressed after 24 h of cold shock. Transcript levels of glucose translocator (GLT1) showed statistically lower than control levels during 96 h of cold shock (Figure 1). Thus only the transcript profile of BMY8 appeared to follow a pattern that may indicate a level of co-ordination toward maltose production during early cold shock, in contrast to the transcript levels of maltose metabolism enzymes (MEX1, DPE2) that did not show statistically different levels during the first 4 h of cold shock, when maltose was accumulating.

Characterization of BMY8 RNAi lines

Maltose protects proteins and the photosynthetic electron transport apparatus in vitro (Kaplan and Guy, 2004). To determine whether maltose contributes to protection of the photosynthetic electron transport in vivo, BMY8 RNAi lines, T-DNA insertional beta-, and alpha-amylase lines were examined. Agrobacterium-mediated transformed plants for BMY8 RNAi were selected on MS medium containing 50 mg l−1 kanamycin. The 17 kanamycin-resistant lines were screened for the presence of the transgene by PCR using plasmid-specific primers. Half the kanamycin-resistant lines (nine lines) produced the expected 652-bp transgene fragment. Because beta-amylase is involved in starch degradation, elimination or reduction of beta-amylase expression was expected to lead to starch accumulation. Leaf starch was visualized in the transgenic lines to identify transgenic lines that have reduced beta-amylase activity. Various degrees of starch accumulation were observed (Figure 3a), and three high starch-accumulating lines (C5, C13 and C14) were selected for further analysis. The T2 segregation profile for kanamycin resistance was determined to ascertain whether the phenotype resulted from a single insertion. Two lines (C5 and C14) showed a 3:1 segregation (Figure 3b), but not C13, based on a χ2 test. This suggests that C5 and C14 contained a single transgene insertion or multiple insertions that are very close together, and C13 might have more than one insertion.

image

Figure 3. Characterization of BMY8 RNAi lines. (a) Leaf starch staining. Leaf samples were taken 2 h after the photoperiod began. Representative images are shown from one of eight leaves, each from different plants, for each transgenic line. (b) The T2 generation was grown on sucrose-free MS medium supplemented with 50 mg l−1 kanamycin. Transgenic lines were kanamycin-resistant and WT segregating lines were kanamycin-sensitive. (c) Semi-quantitative RT–PCR for C5 and C14 transgenic lines. Arrowhead shows the 18S rRNA for loading control. (d) Carbohydrate profiles of 28-day-old BMY8 RNAi lines (C5 and C14). Soluble sugar concentrations in samples were calculated as lactose equivalent using lactose as an internal reference accounting for sample loss and drift of detector responses. Error bars indicate standard deviation (±SD) of the mean for three experiments. Based on t-test (P < 0.05), C5 and C14 have significantly lower maltose and higher starch content.

Download figure to PowerPoint

Based on semi-quantitative RT–PCR results, BMY8 transcript levels were markedly lower in RNAi lines C5 and C14 (Figure 3c). To rule out the possibility that the increased starch content was due to decreased expression of the other beta-amylases, we looked at the transcript levels of BMY7 and BMY9. These genes appear to possess putative transit peptide sequences for chloroplast targeting. BMY9 transcript level was not affected (Figure 3c) by the BMY8 RNAi construct based on the RT–PCR results. In contrast, the BMY7 transcript level was reduced in C14 (Figure 3c). The reduced BMY7 transcript level in line C14 could be due to RNA interference.

To determine whether the cold-shock-induced maltose accumulation was abolished by reduced BMY8 expression, the maltose content of T2-generation BMY8 RNAi lines was measured (Figure 3d). Maltose content was found to be low in leaf tissue when plants were grown at 20°C; however, on exposure to 4°C maltose content increased very rapidly (Figure 1) in WT plants. BMY8 RNAi lines (C5 and C14) failed to accumulate maltose during cold shock (4°C for 6 h) based on the results of HPLC carbohydrate analyses (Figure 3d). This suggests that the lack of maltose accumulation during cold shock is primarily due to reduced BMY8 expression.

Consistent with the leaf starch-staining results, starch analysis indicated that the BMY8 RNAi lines had much higher starch content than WT plants (Figure 3d) when grown at 20°C, and the high levels persisted when cold-shocked. However, when BMY8 RNAi lines were cold-shocked for 6 h in the light, starch content did not increase dramatically beyond the very high levels already present in 20°C-grown plants. In contrast, starch levels did increase during 6 h of cold shock in WT plants. Taken together, the RT–PCR and starch analyses suggest that starch accumulation at 20°C resulted from reduced BMY8 expression.

Characterization of beta- and alpha-amylase T-DNA insertional lines

Seeds of T-DNA insertion lines for several beta-amylases (BMY1, BMY7, BMY8, BMY9) and alpha-amylase (AMY3) were obtained (Table 1) from the Arabidopsis Biological Resource Center, Ohio State University, Columbus, OH 43210. Beta- and alpha-amylase T-DNA insertion lines were screened by PCR using a T-DNA-specific primer (LBa1) (Alonso et al., 2003) and gene-specific primers to verify the presence of the T-DNA insertion (Figure 4a) and to assess the homozygosity/hemizygosity of the plants. Amplified T-DNA flanking sequences were sequenced using a T-DNA specific primer (LBb1) (Alonso et al., 2003) to verify the insertion site. T-DNA insertion sites were either the same or 30–40 bp 5′ of the reported region of the SALK lines (Alonso et al., 2003). Notable was the positioning of the T-DNA insertion for bmy1-1, which was actually located in the intron instead of an exon, and of amy 3-5, which was in the promoter instead of an exon (Table 1; Figure 4a).

Table 1.  Knockout lines for beta- and alpha-amylases verified by PCR
MIPSMutantSalk IDT-DNA location and orientationExpression
At4g15210bmy1-1SALK_004755Intron reverseExpressed
bmy1-2SALK_032057Exon forwardNo expression
At3g23920bmy7-1SALK_039895Exon reverseNo expression
At4g17090bmy8-1SALK_041214Promoter forwardExpressed
At4g00490bmy9-1SALK_086084Exon forwardNo expression
At1g69830amy3-5SALK_058213Promoter 2 T-DNA insertions forward and reverseExpressed
amy3-3SALK_005044Exon forwardNo expression
image

Figure 4. Characterization of beta- and alpha-amylase T-DNA insertional lines. (a) PCR screening for the T-DNA insertion. Upper band is T-DNA insertion fragment; lower band is wild-type fragment. Representative images are shown from one of the 17 plants for each knockout line. (b) RT–PCR for the presence and absence of transcript. Arrowhead shows 18S rRNA for equal loading. The absence of the target gene amplicon is due to lack of transcript. (c) Maltose and starch profiles of 18-day-old alpha- and beta-amylase knockout plants. Maltose concentration in samples was calculated as lactose equivalent using lactose as an internal reference accounting for sample loss and drift of detector responses. Error bars indicate standard deviation (±SD) of the mean for three experiments. bmy1-2 and amy3-3 have significantly higher starch content based on t-test (P < 0.05).

Download figure to PowerPoint

RT–PCR analysis was done using gene-specific primers to verify that T-DNA insertion had disrupted gene expression. In this RT–PCR analysis (Figure 4b), amplification was designed to be saturated at 45 PCR cycles to detect transcripts, even if they were present in low abundance. Based on RT–PCR results (Figure 4b) for bmy7-1, bmy9-1, bmy1-2 and amy3-3, the presence of detectable transcripts was abolished. However, bmy8-1, bmy1-1 and amy3-5 still had transcripts present. To determine whether transcript levels were reduced in bmy8-1 and amy3-5 T-DNA insertion lines, semi-quantitative RT–PCR analysis was performed. Based on RT–PCR results, amy3-5 and bmy8-1 transcript levels were found to be the same as WT levels (data not shown). Therefore the BMY8 T-DNA insertion line was not analyzed further.

Maltose content was measured (Figure 4c) using HPLC to determine whether abolishing gene expression for beta- and alpha-amylases had any influence on maltose accumulation during cold shock. Maltose content was not significantly different (t-test, P < 0.05) in any of the T-DNA insertional lines when plants were grown at 20°C. When plants were cold-shocked for 6 h, overall maltose content of T-DNA insertional lines was slightly lower than that of WT, except for bmy7-1 where maltose levels were unchanged. Because bmy7-1 did not affect maltose or starch content at 20 or 4°C, reduced BMY7 transcript level in the BMY8 RNAi line C14 (Figure 3c) was apparently not a factor for the starch and maltose phenotype. Additionally, maltose content increased more in 28-day-old plants (Figure 3d) than that of 18-day-old plants (4°C) after 6 h of cold shock.

Because alpha- and beta-amylases are involved in starch degradation, starch content was quantified to determine whether lack of expression of various amylases influenced starch content. Knockout lines bmy7-1 and bmy9-1 did not show significant differences (t-test, P < 0.05) in starch content compared with WT (Figure 4c). However, bmy1-2 and amy3-3 showed about twice as much starch as WT plants (Figure 4c). When plants were cold-shocked for 6 h, WT and knockout plants had increased starch content and the bmy1-2 and amy3-3 plants continued to maintain high starch content compared with WT.

BMY8 RNAi lines exhibit more sensitive phenotype for photosynthetic apparatus functionality following freezing stress

Chlorophyll a fluorescence of T2-generation BMY8 RNAi lines was measured following an overnight recovery from freezing stress to determine whether BMY8 RNAi lines with reduced maltose accumulation would exhibit a more sensitive phenotype for photosynthetic apparatus functionality. Based on maltose-accumulation kinetics, plants were cold-shocked over the same interval of the photoperiod as described above at 4°C for 6 h and then freeze-stressed. As determined by chlorophyll a fluorescence measured as the Fv/Fm ratio, three BMY8 RNAi lines (C5, C13 and C14) began showing PSII damage at −4°C, and by −5°C (Figure 5a) these lines exhibited considerably lower fluorescence levels than WT plants.

image

Figure 5. Freezing tolerance of cold-shocked BMY8 RNAi lines. (a) Fv/Fm ratio. (b) Ion leakage: 27-day-old plants grown at 20°C were cold-shocked for 6 h at 4°C and then freeze-stressed. Error bars indicates ±SD of six replications. At −5°C BMY8 RNAi lines (C5, C14 and C13) had significantly lower Fv/Fm ratios compared with controls (t-test, P < 0.05).

Download figure to PowerPoint

Total ion leakage was measured to determine whether maltose accumulation contributes to the reduction in damage to the plasma membrane. BMY8 RNAi lines and WT plants given a 6-h cold shock had very similar ion leakages following subsequent freezing stress (Figure 5b). This suggests that maltose accumulation is not contributing to plasma membrane protection via the cytosol. If correct, then maltose accumulation during early cold shock may be largely occurring in the chloroplast stroma. This, however, may be difficult to reconcile, given that the MEX1 transporter is expected to be a simple uniporter. Yet it is possible that transport may not be so mechanistically simple, given there is no evidence for active transport or directionality of this transporter at this time. An alternative hypothesis to explain these data (Figure 5) is that maltose protects PSII by some mechanism that does not involve a change in membrane permeability. Then, the accumulated maltose could possibly be distributed equally in the cytosol and chloroplast, and have an effect on chlorophyll fluorescence, but not on ion leakage. It may also be that maltose does not protect the plasmalemma against freezing stress, or possibly that electrolyte leakage occurs from cell types that do not effectively accumulate maltose.

Non-acclimated plants were also freeze-stressed to determine whether non-acclimated plants behave differently from 6-h cold-acclimated plants with respect to chlorophyll fluorescence. Initially, BMY1, the vacuolar form, was expected to serve as a negative control because a known point mutation in this gene resulted in reduced beta-amylase activity due to inefficient mRNA splicing, but did not affect carbohydrate metabolism (Laby et al., 2001). However, knocking out BMY1 expression resulted in a 1.6-fold higher starch content compared with WT (Figure 4c), and slightly lower maltose content. Subsequently a BMY9 knockout was chosen as the negative control because its silencing did not influence starch or maltose content significantly (Figure 4c). The AMY3 knockout was initially considered as a positive control, because it was thought that beta-amylase activity required that intact starch granules first undergo partial digestion by alpha-amylase (Beck and Ziegler, 1989). However, a recent study showed that AMY3 was not required for transitory starch breakdown in Arabidopsis leaves (Yu et al., 2005), and had no effect on maltose content compared with WT. Thus the AMY3 knockout line was expected to behave similarly to the BMY9 knockout line with regard to chlorophyll a fluorescence. Similar to cold-acclimated plants, BMY8 RNAi lines began showing distinct PSII damage at −4°C (Figure 6a) following freezing stress, whereas WT started showing PSII damage at −5°C. Amy3-3 also appeared to be more sensitive than WT (Figure 6a) at −6 and −7°C (P < 0.05). With the persistence and increased severity of freezing stress, PSII damage increased and was more pronounced in the BMY8 RNAi lines (Figure 6a) down to −7°C. Ion leakage assays with non-acclimated plants following freezing stress showed a small but significant (P < 0.05) difference between WT and BMY8 RNAi lines (Figure 6b) at −4 and −5°C. The reason for the reduced ion leakage in the BMY8 RNAi lines at −4 and −5°C is unknown.

image

Figure 6. Freezing tolerance of non acclimated BMY8 RNAi lines. (a) Fv/Fm ratio. (b) Ion leakage. 27-day-old plants grown at 20°C were freeze-stressed; −5, −6 and −7°C BMY8 RNAi lines (C5, C14 and C13) and amy3-3 had significantly less chlorophyll fluorescence (as Fv/Fm ratio) compared with the control, according to anova (P < 0.05). Error bars indicate ±SD of mean of three independent experiments each having six replications.

Download figure to PowerPoint

Maltose influences carbohydrate metabolism

Maltose is involved in the production of cytosolic glucose and sucrose (Lu and Sharkey, 2004; Sharkey et al., 2004; Weise et al., 2004) during starch degradation. To determine whether changes in maltose accumulation influenced other free sugars, glucose, fructose and sucrose levels were determined for 20°C-grown and cold-shocked (6 h at 4°C) plants. Consistent with the role of maltose in carbohydrate metabolism (Lu and Sharkey, 2004), a decrease in maltose content resulted in a significant (P < 0.05) decrease in glucose, fructose and sucrose content (Figure 7) in BMY8 RNAi line C5 during cold shock. Glucose and sucrose levels in BMY8 RNAi line C14 were largely unaffected at 4°C compared with WT. Overall, T-DNA insertional lines had comparable soluble sugar content (sucrose, glucose and fructose) to WT at 20°C, and this was slightly lower when they were cold-shocked (Figure 7). Only bmy1-2 and amy3-5 had a small, but significant, reduction in glucose and fructose content (P < 0.05) during cold shock.

image

Figure 7. Carbohydrate profiles of 28-day-old BMY8 RNAi lines (C5 and C14) and 18-day-old alpha- and beta-amylase knockout plants. Soluble sugar concentrations in samples were calculated as lactose equivalent using lactose as an internal reference. Error bars indicate standard deviation (±SD) of the mean for three experiments. Based on t-test (P < 0.05), glucose, fructose and sucrose levels were significantly lower during cold shock in C5. Only fructose levels were significantly lower during cold shock in C14. T-DNA insertional lines did not show a significant difference (t-test, P < 0.05) compared with wild type.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Beta-amylase induction during temperature stress has been hypothesized to lead to a starch-dependent maltose accumulation, which may contribute to protection of the electron transport chain and proteins in the chloroplast stroma during acute temperature stress in Arabidopsis (Kaplan and Guy, 2004). Consistent with this hypothesis, BMY8 RNAi lines (C5, C13, C14) had reduced maltose accumulation and exhibited lower chlorophyll a fluorescence compared with WT, BMY9 and AMY3 T-DNA insertional lines following freezing stress. The AMY3 knockout line, which had slightly lower maltose content (Figure 4c), also had lower chlorophyll a fluorescence (Figure 6a) compared with WT and BMY9.

The decrease in maltose content resulted in decreased glucose, fructose and sucrose content in BMY8 RNAi lines, consistent with the role of maltose in transitory starch turnover (Lu and Sharkey, 2004; Sharkey et al., 2004; Smith et al., 2004a,b; Weise et al., 2004). While these sugars are known to have protective properties, they are mainly found in the vacuole and the cytosol in potato tubers and spinach leaves (Farrâe et al., 2001; Gerhardt and Heldt, 1984). The present gene expression, carbohydrate analysis and freezing stress results suggest that maltose accumulation during cold shock, by itself or together with a maltose-dependent increase in soluble sugar content, contributes to protection of the photosynthetic electron transport chain or stromal proteins in the chloroplast during freezing stress.

It was expected that reduced maltose production would be inversely correlated with a starch-excess phenotype either during starch breakdown or during cold shock. BMY8 RNAi lines (Figure 3) showed a starch-excess phenotype, and this phenotype was in agreement with the study by Scheidig et al. (2002), where reduction in expression of the potato ortholog of BMY8 by an antisense method resulted in a starch-excess phenotype. The other two putative chloroplast-localized beta-amylase T-DNA insertional lines (bmy7-1 and bmy9-1) did not show starch-excess phenotypes or significant changes in maltose content, indicating a minor role in starch degradation in leaf tissue. Thus BMY8 plays the major role in starch degradation in Arabidopsis among the three putative chloroplast-localized beta-amylases examined in the present study. Interestingly, BMY1 (ram1), the extraplastidic form (Figure 4c), showed a higher starch content than WT plants, and the starch-excess phenotype persisted during cold shock (Figure 4c), suggesting that BMY1 is somehow involved in starch metabolism. How this might be accomplished is unclear. The present work contrasted with a previous report (Laby et al., 2001), where ram1 (BMY1) did not affect starch content. One possible reason for this may arise because different aspects of starch degradation were being studied. The earlier study (Laby et al., 2001) was focused on starch mobilization over a 24-h period, while the present study was looking at cumulative starch content during an interval of vegetative growth and development. BMY1 may have a very small effect on starch mobilization over a 24-h measurement interval. In the present work, impairment of BMY1 activity on starch degradation is detectable because cumulative starch content is measured. As expected, a knockout line of a plastidic alpha-amylase (amy3-3; At1g69830) showed 2.1-fold more starch than WT under normal and cold-shock conditions. In contrast, a recent study reported that a knockout line for AMY3 did not impair starch degradation (Yu et al., 2005). This difference in findings could be due to differences in growth conditions and sampling time. Additionally, starch and soluble sugar analysis of an AMY3 knockout line suggests that AMY3 could have a limited role in starch metabolism during cold shock.

We propose a model (Figure 8) of how hydrolytic starch degradation might play a role in early cold shock. Upon cold shock, maltose begins rapidly accumulating due to the action of BMY8 degrading long, unbranched glucans in the chloroplast. The increase in maltose content may result in parallel increases in stromal maltotriose and glucose content. Metabolite profiling has revealed that maltotriose shows a highly similar profile to the maltose accumulation profile (data not shown). As some trisaccharides are known to act as protective solutes (Levitt, 1972), maltotriose may also have beneficially protective properties. Therefore maltose, maltotriose and glucose could act together as a protective solute network in the chloroplast to help protect chloroplast constituents during acute stress. This model is further supported by the findings of a recent study that alpha-glucan/water dikinase (GWD, SEX1) is involved in the cold-induced development of freezing tolerance of Arabidopsis during cold shock (Yano et al., 2005). The activity of GWD is required for efficient hydrolytic starch breakdown of transitory starch under normal diurnal conditions (Ritte et al., 2002). Presumably, the action of GWD on starch is required to facilitate attack on starch itself, or on long-chain glucans, by beta-amylase. In the SEX1/GWD mutants, the accumulation of malto-oligosaccharides during cold shock is abolished and glucose and fructose accumulation is reduced (Yano et al., 2005). The reduced breakdown of starch, low levels of malto-oligosaccharides, and reduced sugars coincide with reduced cold-shock-induced freezing tolerance.

image

Figure 8. Hydrolytic starch degradation during cold shock. R1, a glucan water dikinase (GWD, SEX1); AMY, alpha-amylase; DBE, debranching enzyme; PHS, phosphorylase b; BMY, beta-amylase; DPE1, plastidic disproportionating enzyme; DPE2, cytosolic disproportionating enzyme; MEX, maltose exporter; GLT, glucose transporter. This diagram is based on the model of transitory starch metabolism by Sharkey et al. (2004) and Smith et al. (2004a).

Download figure to PowerPoint

The present findings support the model where starch is the source of maltose accumulation during cold shock. Given the design of the current experimental evidence, all cold-shock treatments were imposed early in the photoperiod when starch synthesis was probably occurring, and when degradation was probably minimal or non-existent (Zeeman et al., 2002). The data from the present study suggest simultaneous synthesis and degradation of starch, although we did not measure either directly. In contrast, under favorable temperature conditions there appears to be little or no turnover of starch in the light in Arabidopsis leaves (Zeeman et al., 2002). Therefore it seems reasonable that some process upstream of BMY8 in starch degradation must be strongly cold-activated if the findings and model are correct. We have examined time-course expression data for all known components of starch degradation, and this has failed to identify potential targets for such a cold-activated response. Therefore, for the model to be correct, cold shock must trigger a non-transcriptional response that allows beta-amylase to degrade starch effectively in the light during simultaneous starch synthesis. The present findings with the BMY8 RNAi lines and other knockout lines show that BMY8 is required, and in fact may be wholly sufficient for maltose accumulation during cold shock. How, exactly, that might occur remains unclear.

The findings presented here lead us to conclude that accumulation of BMY8 transcripts represents a functional cold-shock response that is clearly not a general stress response of other BMY genes involved in starch degradation. Maltose, the product of beta-amylase, increased very rapidly during cold shock, a response that actually preceded overall BMY8 transcript induction during cold shock. Given that maltose accumulation occurs well before the change in BMY8 transcript level suggests that this could be a result of post-translational activation of BMY8. Alternatively, the increase in maltose could equally be explained by a transient block in some maltose-consuming reaction or impairment of its export out of the chloroplast. Yet the decrease in BMY8 transcript level in RNAi lines prevented accumulation of maltose during cold shock, indicating that BMY8 is required for maltose accumulation during cold shock. Together the results from transcript profiling, maltose accumulation pattern and BMY8 RNAi lines suggest that beta-amylase activity could be regulated both at the transcriptional and post-translational level during cold shock. Post-translation regulation for enzymes of starch metabolism has also been suggested by Smith et al. (2004a). The nature of the post-translational regulation is unknown, but it is likely to involve activation of enzymatic activity without concomitant requirement of gene expression, given that maltose is already significantly increased at 1 h of cold shock.

Consistent with the role of maltose in cytosolic carbohydrate metabolism (Lu and Sharkey, 2004), a decrease in maltose content resulted in decreased glucose, fructose and sucrose content in BMY8 RNAi lines. BMY8 RNAi lines with reduced soluble sugar content showed reduced chlorophyll fluorescence (Fv/Fm ratio) compared with WT, suggesting that the photosynthetic electron transport chain of BMY8 RNAi lines was more sensitive to freezing stress. The findings presented here reveal that the function of BMY8 leading to maltose accumulation during cold shock in photosynthetic organs is an important factor that aids plants in coping with the consequences of acute temperature stress.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Plant growth and cold shock

Arabidopsis thaliana (ecotype Columbia) plants were grown as described by Sung and Guy (2003) for 3 weeks, on Fafard #2 (Fafard, Inc., Agawam, MA, USA) or Sunshine #5 soil mix (Sun Gro Horticulture Distribution Inc., Bellevue, WA, USA). Plants were grown at 20°C with a photoperiod of 15/9 h light/dark cycle in growth cabinets for 3 weeks. Irradiance was provided by incandescent bulbs and cool-white fluorescent tubes, and ranged between 100 and 150 μmol m−2 sec−1 at canopy height.

Three-week-old 20°C-grown plants were placed at 4°C and sampled at 1, 4, 12, 24, 48 and 96 h cold shock. Cold shock was initiated 2 h into the light period. Untreated control samples were taken at time 0 (2 h into light period) and at 4 h (6 h into light period). Untreated control sample time 0, and cold-shocked sample times 24, 48 and 96 h were taken 2 h into the light period. The 4-h cold-shock sample (6 h into light period) also had a control, which was taken 6 h into the light period.

Metabolite profiling by gas chromatography and mass spectrometry (GC–MS)

Cold-shocked Arabidopsis leaves were flash-frozen in liquid nitrogen and stored at −80°C. Two sets of temperature-stress experiments were performed, each comprising two to four replicate measurements per time point. Aerial tissues were used for GC–MS profiling (Fiehn et al., 2000; Kaplan et al., 2004; Roessner et al., 2000; Wagner et al., 2003).

RNA extraction, microarray sample preparation

Cold-shocked Arabidopsis leaves from three independent experiments were flash-frozen in liquid nitrogen and stored at −80°C. The leaf tissues were ground to a fine powder in liquid nitrogen using a mortar and pestle, then RNA was extracted using Qiagen RNeasy Plant Mini Kits (Qiagen, Valencia, CA) according to the manufacturer's protocol. RNA was quantified by absorbance at 260 nm using a UV spectrophotometer and stored at −80°C.

Total RNA for each sample was prepared for hybridization according to the protocols outlined in the GeneChip Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA, USA). Briefly, 8 μg total RNA was used as template for first-strand cDNA synthesis (Superscript, Invitrogen, Carlsbad, CA), which was primed with a T7-(dT)24 primer containing a T7 RNA polymerase promoter sequence (Genset Oligos, St Louis, MO).

In vitro transcription was performed on second-strand product using biotinylated UTP and CTP (Bioarray High Yield RNA transcript labeling kit; Enzo Diagnostics, Farmingdale, NY). Biotinylated cRNA was heated in Mg buffer resulting in 35–200 base fragments. Arabidopsis arrays (Affymetrix) were hybridized for 16 h at 45°C with 15 μg fragmented cRNA. Arrays were stained with a streptavidin–phycoerythrin conjugate (Molecular Probes, Carlsbad, CA) and scanned with an Agilent argon–ion laser with 488 nm emission and 570 nm detection (GeneArray Scanner).

Files for each array, containing intensity data for each probe cell, were analyzed with Probe Profiler (Corimbia) to generate quantitative estimates of gene expression. Genes that were not being expressed under any experimental conditions were removed from further analyses.

Quick DNA extraction for PCR screening of knockout and RNAi lines

A small amount of a cotyledon (1 × 1 mm) from Arabidopsis seedlings was removed with forceps and placed into 50 μl DNA extraction buffer (100 mm Tris–HCl pH 9.5, 10 mm EDTA pH 8.0 and 1 m KCl), heated at 95°C for 10 min and then cooled to room temperature 25°C. DNA extract (1 μl) was used as a template in a 25-μl PCR reaction.

PCR screening of knockouts

Beta-amylase and alpha-amylase T-DNA insertion lines obtained from the Arabidopsis Biological Resource Center (Ohio) were screened by PCR using LBa1 (Alonso et al., 2003) primer and gene-specific primers (Table 2). Ready To Go PCR Beads (Amersham Pharmacia Biotech, Piscataway, NJ) were used for screening. Each 25 μl PCR included approximately 2.5 U Taq DNA polymerase, 10 mm Tris–HCl pH 9, 50 mm KCl, 1.5 mm MgCl2, 200 μm each dNTP, stabilizers, BSA, and 0.4 μm each gene-specific forward and reverse primer. PCR amplification was carried out with a Stratagene Robocycler (Stratagene, La Jolla, CA). The first PCR cycle was 95°C for 5 min; the second cycle was 95°C for 30 sec, 52°C for 1 min, 72°C for 1 min. The second cycle was repeated 45 times. The final cycle was 72°C for 7 min. Afterwards, PCR products were kept at 5°C. PCR products were fractionated in a 1% agarose gel. Gels were stained with ethidium bromide and digitally photographed with a Kodak Gel Logic 100 Imaging System (Kodak).

Table 2.  Primers for PCR screening of knockout lines
MIPSMutantSalkPrimerSequence 5′ to 3′
  1. *This primer sequence was obtained from SALK website.

At4g15210bmy1-1SALK_004755CG466AAACCTACCACATTCACATACTCAA
CG467CTCGGAGAAGGGGAAGTTTT
bmy1-2SALK_032057CG468TTTTTTGGTTTTTTGTTCTTTCTC
CG469CATGATTGCTTGGATTTTGAGT
At3g23920bmy7-1SALK_039895CG472TGGTCATAATCTCAAATCCTACTTC
CG473AAAGGCGATGAAAGCGAGT
At4g17090bmy8-1SALK_041214CG498CCATGTGTTCAAAGCCAAAG
CG499TTTTAACCTTTTCACTTGTCACAC
At4g00490bmy9-1SALK_086084CG476GGTTTAGTGATGGCGATTAGG
CG477CAGCCAAATCAACCAAACAC
At1g69830amy3-5SALK_058213CG478ACCAAAAGTTATCATATCTCTCTGC
CG479CCGACACTTTTTCCAATTGAG
amy3-3SALK_005044CG480GGTGAATATAGACAAGAGTGAGAGAG
CG481AGCATTGAAAAAAGTGGGACA
LBa1*T-DNA left border primerCG448TGGTTCACGTAGTGGGCCATCG

Sequencing T-DNA flanking fragments

T-DNA flanking fragments were gel-purified using Wizard PCR Preps DNA Purification System (Promega, Madison, WI), according to the manufacturer's protocol. The 10 μl big dye sequencing reaction [Interdisciplinary Center for Biotechnology Research (ICBR) Sequencing Core Laboratory, University of Florida] was carried out according to the manufacturers’ protocol using 3–10 ng PCR product, 5 pmol LBb1 sequencing primer (Alonso et al., 2003) and 4 μl big dye. PCR amplification was done using a Stratagene robocycler. The first cycle was 95°C for 30 sec, 50°C for 15 sec and 60°C for 4 min. The first cycle was repeated 25 times. The resulting PCR product was ethanol-precipitated, air-dried and submitted for sequencing to the ICBR Sequencing Core Lab.

BMY8 RNAi construct

A unique 338-bp BMY8 sequence at the 3′ end had been amplified by PCR using pfu polymerase (Stratagene) and gene-specific primers (forward CG553; 5′-CACCTGAGCACGCGAATTG-3′ and reverse CG554; 5′-TCAGCGATCTTGCCTTTGAC-3′). The 338-bp DNA fragment was gel-purified using Wizard PCR Preps DNA Purification System (Promega), then the fragment was directionally cloned into pENTR directional TOPO vector (Invitrogen), according to the manufacturer's manual. The cloning reaction was used to transform electrocompetent Escherichia coli DH5α strain. Escherichia coli strains were selected for kanamycin resistance and desired colonies were tested for the presence of BMY8 fragment using PCR amplification with the BMY8 gene-specific primers above (CG553 and CG554). The hpRNA construct was done as described by Wesley et al. (2001). The pENTR directional TOPO vector with BMY8 fragment was mixed with pHellsgate 8 plasmid in the presence of Gateway LR clonase enzyme mix (Invitrogen), which promotes in vitro recombination between entry clone and destination clone resulting in a hairpin construct, according to the manufacturer's protocol. The mixture was transferred to DH5αE. coli strain by electroporation (Bio-Rad, Hercules, CA), according to the manufacturer's protocol. The pHellsgate plasmid was extracted from spectinomycin-resistant lines and digested with Xho1 and Xba1 for the presence of BMY8 fragment in the forward and reverse orientation to form a hairpin structure. The desired plasmids were further confirmed by PCR using BMY8-specific primers (CG553 and CG554) for the presence of the BMY8 fragment. Afterwards, Agrobacterium (ABI strain) was transformed by electroporation, according to the manufacturer's manual (Bio-Rad).

Agrobacterium-mediated transformation

The floral dip method for Agrobacterium-mediated transformation was utilized as described by Clough and Bent (1998).

PCR screening BMY8 RNAi lines

Seeds were harvested from transformed plants that were subjected to the floral dip method, and grown on MS medium with 50 mg l−1 kanamycin and 100 mg l−1 carbenicillin. The kanamycin-resistant plants were screened by PCR using pHellsgate-specific primers, which were located in either side of the 338 bp BMY8 fragment in order to amplify only transgene. Forward primer was designed from the 35S promoter (CG555; 5′-GTTCCAACCACGTCTTCAAAG-3′) and reverse primer was designed from the intron (CG556; 5′-TTCTTCGTCTTACACATCACTTG-3′) in the pHellsgate vector. Ready To Go PCR Beads (Amersham Pharmacia Biotech) were used for PCR as described above. Seeds were collected for further analysis from plants that were resistant to kanamycin and contained the BMY8 fragment.

Starch screening for BMY8 RNAi lines

Leaf staining for starch was used to quickly screen T2 generation BMY8 RNAi lines. Leaf samples were taken 2 h after the photoperiod began from nine BMY8 RNAi lines with eight plants each. Mature, fully expanded leaves were decolorized with 80% ethanol at 80°C for about 10–15 min. The leaves were then gently washed with water, stained with 1.2% iodine–potassium iodide for 30 sec, gently washed to remove excess iodine, and placed on a plastic Petri dish for visual inspection and photography.

RT–PCR

For BMY8 (At4g17090) RNAi lines, semi-quantitative RT–PCR was done as described Kaplan and Guy (2004) using gene-specific primers as listed in Kaplan and Guy (2004) to determine the degree of transcript decrease and specificity of the RNAi construct.

For beta-amylase and alpha-amylase knockout lines, gene-specific primers were designed for either side of the insertion if the insertion was positioned in an exon. If the insertion was positioned in an intron, gene-specific primers were selected from exonic regions on either side of the intron. If the insertion event was in the promoter region, gene specific primers were appropriately designed (Table 3). RT–PCR was done as described above except that 45 PCR cycles were used in order to detect low-abundance transcripts.

Table 3.  Primers used in RT–PCR reaction for knockout lines
MIPSMutantSalkPrimerSequence 5′ to 3′
At4g15210bmy1-1SALK_004755CG535ACCCGCAACTTCTATACCT
CG536AACATGGCGGATTTGATAG
bmy1-2SALK_032057CG541CCGTTTACGTTATGCTTCC
CG542CGGCTTGTCATTGTATTCTC
At3g23920bmy7-1SALK_039895GC537TAGCATTGCACAGGTGTTC
CG538ATCGAAACTACAAGGCTCAC
At4g17090bmy8-1SALK_041214CG307GGAACAAGCGGACCTCAT
CG308TCTCAGCGATCTTGCCTT
At4g00490bmy9-1SALK_086084CG539TTGGCGTGGTGTTTCTAC
CG540TTCCCCAAGTAAGGCATT
At1g69830amy3-5SALK_058213CG345CCAGGGTAGAGGAAACAA
CG346TCGAAGAAGACCGCTGGT
amy3-3SALK_005044CG543CGGAGAAATGGACTACAATCAA
CG481AGCATTGAAAAAAGTGGGACA

Carbohydrate analysis

Carbohydrate analysis was done as described by Kaplan and Guy (2004). Eighteen-day-old cold-shocked Arabidopsis beta- and alpha-amylase knockout plants and 28-day-old BMY8 RNAi lines from three independent experiments were harvested, flash-frozen in liquid nitrogen and freeze-dried. Lactose was added to samples as an internal standard at the beginning of extraction.

Starch content was determined by the method of Li et al. (1965). After soluble sugar extraction, the ethanol-insoluble residue was vacuum-dried. Starch was solubilized in boiling water for 15 min. The supernatant was reacted with iodine–potassium iodide (0.1%) and color density was measured at A620 using a spectrophotometer. Potato starch was used as the standard to estimate starch quantity.

Freezing stress

Wild-type, knockout and (T2 generation) BMY8 RNAi lines were grown on sucrose-free MS medium (for BMY8 RNAi lines this medium was supplemented with 50 mg l−1 kanamycin and 100 mg l−1 carbenicillin), stratified for 3 days at 4°C, and placed in a controlled environment. Seven days later, kanamycin-resistant seedlings were transferred to soil and grown for another 20 days. Plants with cold shock (4°C for 6 h) or without cold shock were subjected to freezing stress (−3, −4, −5, −6 and −7°C). Non-cold-shocked plants were rapidly harvested 2 h after onset of the light period. In the cold-shocked plants, cold shock was initiated 2 h into the light period and lasted for 6 h, then plants were harvested. Harvested plants were wrapped in water-saturated tissue paper, inserted in a test tube, then placed in a controlled-temperature bath (Forma Scientific model 2425, Marietta, OH) and equilibrated for 30 min at 0°C. To prevent supercooling, a chip of ice was placed in contact with the tissue paper and the temperature was lowered at a rate of 2°C h−1. Tubes were removed at 30-min intervals, placed on ice, and allowed to thaw overnight at 4°C. The next day chlorophyll a fluorescence and electrolyte leakage measurements were taken. Three independent experiments were carried out for 20°C-grown plants and one experiment for cold-shocked plants. Each experiment contained six replications, each from a different plant.

Chlorophyll fluorescence

Chlorophyll fluorescence parameters were measured with the Plant Efficiency Analyzer (Hansatech Instruments, King's Lynn, Norfolk PE32 1JL England) after a 10-min dark-adaptation period. Readings were taken over a 5-sec interval after exposure at 100% illumination level (approximately 3000 μmol m−2 sec−1, peak wavelength 650 nm) by high-intensity light-emitting diodes and 4 mm in diameter leaf area was illuminated. Six replicates, each from a different plant, were averaged for each time point. Variable fluorescence, Fv, was determined as the difference between the maximal fluorescence signal, Fm, and the initial darkness fluorescence level, Fo.

Electrolyte leakage measurements

Electrolyte leakage of the aerial portions of plants was measured according to Sung and Guy (2003). After freezing-stress treatment, aerial portions of plants were placed in scintillation vials containing 10 ml distilled water and shaken for 1 h. After the first reading, the tissue was exposed to a 2-min microwaving at high setting to destroy all living cells. After cooling to room temperature, the second readings were taken and the LT50 determined.

Statistical analysis

One-way anova was done using the Kruskal–Wallis (KW) test on metabolite response values and on microarray signal values. The non-parametric approach was chosen because it did not require normally distributed data and is more resistant to the outliers in the data set that might lead to high fold changes. Changes in metabolite content and transcript levels with P ≤ 0.05 were considered significant. Pairwise comparisons between different time points were done using the KW test.

Student's t-test was used on carbohydrate analysis data and one-way anova was used on freezing-stress data. Changes at P ≤ 0.05 were considered significant.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

I would like to thank Lanfang Levine at Kennedy Space Center for making her laboratory available and for helping with the soluble sugar analysis of Arabidopsis transgenic lines; Kevin Folta for advice on screening T-DNA insertional lines; Joachim Kopka for helping with metabolite profiling analysis; Wei Zhao and Cameron Schiller for their help on statistical analysis, Dale Haskell, Cameron Schiller, and Maria Amaya for their help during the freezing-stress experiments, and Curt Hannah, Sherry Leclare and Dale Haskell for critical reading and comments. We also acknowledge helpful comments from two anonymous reviewers. We thank the Arabidopsis Biological Resource Center (Ohio) for providing seed of T-DNA insertion lines; and CSIRO Plant Industry for permitting the use of the pHellsgate 8 plasmid for the production of the BMY8 hairpin construct. This research was supported by grants from NASA#NAG10-316, USDA NRI#2002-35100-12110 and the Institute of Food and Agricultural Sciences at the University of Florida. This article is Journal Series No. R-11034.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References