SEARCH

SEARCH BY CITATION

Keywords:

  • callose;
  • camalexin;
  • complex trait;
  • natural variation;
  • QTL;
  • R gene signalling

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

In a cross between the two resistant accessions Col-0 and Ler-0, a 15:1 segregation was found in F2, suggesting the presence of unlinked resistance loci to Leptosphaeria maculans. One hundred Col-4 × Ler-0, and 50 Ler-2 × Cvi-1 recombinant inbred lines, and seven susceptible Ler-0 × Ws-0 F2 progenies were examined to identify the two loci. Resistance in Col-4, Ws-0 and Cvi-1 (RLM1) was mapped to the marker m305 on chromosome 1. Col-4 × Ler-0 and Ler-2 × Cvi-1 mapping populations located RLM2Ler on the same arm of chromosome 4. A tight physical location of RLM2 was established through near-isogenic lines. This region was found to correspond to an ancient duplication event between the RLM1 and RLM2 loci. Two independent T-DNA mutants in a TIR-NB-LRR R gene (At1g64070) displayed susceptibility, and L. maculans susceptible mutant phenotypes were confirmed to be allelic for rlm1 in F1 after crosses with susceptible rlm1Lerrlm2Col plants. Complementation of rlm1Lerrlm2Col with the genomic Col-0 sequence of At1g64070 conferred resistance. In addition, two T-DNA mutants in a neighbouring homologous TIR-NB-LRR gene (At1g63880) displayed moderate susceptibility to L. maculans. Sequence analysis revealed that At1g64070 was truncated by a premature stop codon, and that At1g63880 was absent in Ler-0. RNA interference confirmed that Ler-0 resistance is dependent on genes structurally related to RLM1. Camalexin was identified as a quantitative co-dominant resistance factor of Col-0 origin, but independent of RLM1. RLM1/RLM2 resistance was, however, found to require RAR1 and partially HSP90.1.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

In their natural environment, plants are continuously exposed to various environmental cues including insects, nematodes and an array of micro-organisms. Their survival under such conditions is dependent on their ability to perceive external signals and respond in a timely manner. During the past decade, an increasing number of plant disease resistance (R) genes from different species have been identified by map-based cloning, insertional mutagenesis or various high-throughput technologies. Sequence comparisons among these genes have revealed a remarkable conservation of structural features, despite the diversity of the pathogens with which their products interact (recently reviewed in Hammond-Kosack and Parker, 2003; Nimchuk et al., 2003). A large group of R proteins have localization and domain organization resembling that of the cytosolic Nod receptor proteins in animal innate immunity (Inohara and Nuñez, 2003). These consist of a nucleotide-binding oligomerization domain (NOD or NB) followed by a series of leucine-rich repeats (LRR). In contrast to the animal NB-LRR proteins, plant R proteins usually have a different N-terminal domain. The N-terminal domain in plants may be a coiled coil (CC) sequence or a domain that shares sequence similarity with the Drosophila melanogaster TOLL and human interleukin-1 receptor referred to as TIR. The TIR domain has a central role in interactions with downstream signalling components for TOLL-like receptors (TLRs) in animal innate immunity (Janssens and Beyaert, 2002). Information obtained about defence signalling thus far shows that the CC-NB-LRR and TIR-NB-LRR R proteins have differential requirements for downstream signalling components (Aarts et al., 1998). A route via RAR1 (required for Mla-dependent resistance 1) or SGT1 (suppressor of the G2 allele of SKP1) can, however, regulate the response of both categories of R proteins (Austin et al., 2002; Azevedo et al., 2002; Liu et al., 2002; Tör et al., 2002). RAR1 and SGT1 interact with each other and with diverse protein complexes, for example HSP90 (heat shock protein 90), which most likely allows them to have flexible functions (reviewed in Shirasu and Schulze-Lefert, 2003). In addition, RAR1 has been shown to possess quantitative influences on some NB-LRR class R proteins, caused by altered R protein stability (Bieri et al., 2004). Recent results show that the RAR1 animal homologue CHP-1 has an interaction pattern with PP5 (protein phosphatase 5), HSP90 and NOD1 (NB-LRR) similar to that seen in plants, suggesting that this is an ancient mechanism in innate immunity (Hahn, 2005). Despite the constantly expanding list of cloned plant disease resistance genes, defence mechanisms to most plant diseases are still unknown and many questions about the signalling machinery remain to be answered.

The dothideomycete, Leptosphaeria maculans, is a hemi-biotrophic fungal pathogen, causing the blackleg disease of Brassica oil crops worldwide (West et al., 2001). The fungal hyphae enter the host preferentially through wounds or stomata without the aid of specialized infection structures such as appressoria (Howlett et al., 2001). Genetic studies of L. maculans resistance in Brassica species have been tedious, and despite confirmed gene-for-gene interactions, no BrassicaR genes or LmAvr genes have been cloned (Howlett, 2004). Arabidopsis has been shown to be a suitable model host system to develop a mechanistic understanding of resistance against this pathogen. In a previous study, 168 Arabidopsis accessions and numerous mutants impaired in pathways or key genes important in plant defence were evaluated for their response to L. maculans (Bohman et al., 2004). It was found that the resistance in Arabidopsis was independent of salicylic acid, jasmonic acid and ethylene-induced defences, but partly relied on the phytoalexin camalexin. In the Arabidopsis–L. maculans pathosystem, we also have observed a segregation ratio close to 15:1 in a F2 population between resistant Col-0 and Ler-0, suggesting that two independent dominant resistance traits reside in each parental accession (Bohman et al., 2004). Similar results were obtained from crosses between Ler-0 and Ws-0 (Bohman, 2001). Based on this information, we utilized two sets of recombinant inbred lines (RILs) Col-4 × Ler-0 and Ler-2 × Cvi-1 with the aim of identifying genes that control the defence to L. maculans. A locus responsible for resistance to L. maculans in the Col-0 background (RLM1Col) comprising seven structurally related TIR-NB-LRR genes was identified. Disruption with two independent T-DNA insertions in each of two genes found in RLM1Col results in susceptible phenotypes. RLM1Col and RLM2Ler appear to be derived from an ancient segmental duplication event that included several flanking genes. It can be concluded that L. maculans resistance relies on several layers of defence, with RLM1/RLM2-dependent callose deposition and RLM1/RLM2-independent camalexin induction among the major determinants of this particular plant defence system.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Loss of two dominant resistance loci causes susceptibility in mapping populations

Earlier investigations by Bohman et al. (2004) revealed the loss of two unlinked L. maculans resistance loci (RLM1 and RLM2) in progeny of crosses between the two resistant accessions Col-0 (RLM1Colrlm2Col) and Ler-0 (rlm1LerRLM2Ler) (Figure 1a,b). We used the Col-4 × Ler-0 RILs (Lister and Dean, 1993) in a map-based approach to identify the two resistance loci. As a positive control, a Col-0 × Ler-0 F3 line was selected for its distinct susceptible phenotype, denoted rlm1Lerrlm2Col throughout this paper (Figure 1c). Susceptibility occurred in the same RILs, regardless of the L. maculans isolate used in the screening.

Figure 1. Differential responses observed on parental Arabidopsis accessions and progenies deriving from various crosses after inoculation of L. maculans. dpi, days post-inoculation. (a) Resistant phenotype on Col-0, 21 dpi. (b) Resistant phenotype on Ler-0, 21 dpi. (c) Susceptible homozygous progeny (F3) from Col-0 × Ler-0 (rlm1Lerrlm2Col) used as positive control and as test cross parent throughout this paper, 14 dpi. (d) Susceptible phenotype on Ler-0 × Ws-0 (rlm1Lerrlm2Ws) F2 progeny, 14 dpi. (e) Susceptible phenotype on the Ler-2/Cvi-1 near-isogenic line LCN4-6 (Ler-rlm2Cvi), 14 dpi. (f) Susceptible F1 progeny deriving from a cross between rlm1Lerrlm2Col and rlm1Lerrlm2Ws, 14 dpi. (g) Susceptible F1 progeny between rlm1Lerrlm2Col and Ler-rlm2Cvi, 14 dpi. (h) Resistant phenotype on F1 progeny between Col-0 and rlm1Lerrlm2Col, 21 dpi.

Download figure to PowerPoint

image

Analysis of 100 Col-4 × Ler-0 RILs identified 20 susceptible individual lines, close to the expected 3:1 segregation ratio. A quarter of the lines are expected to be susceptible as RILs are considered to be homozygous, compared to an expected segregation of 6.25% susceptible plants in an F2 population where heterozygotes are present. Susceptibility due to transgressive segregation of the resistance genes was also seen on Ler-0 × Ws-0 (rlm1Lerrlm2Ws) and on inbred progenies from crosses between the resistant accessions Cvi-1 and Ler-2 (Ler-rlm2Cvi) (Figure 1d,e). Furthermore, F1 plants from crosses of rlm1Lerrlm2Col with rlm1Lerrlm2Wsand with Ler-rlm2Cvi were found to be susceptible (Figure 1f,g). This provides further support to there being a common resistance locus in Col-0, Cvi-1 and Ws-0. As a control, F1 progeny from a cross between susceptible plants (rlm1Lerrlm2Col) and resistant Col-0 yielded fully resistant plants (Figure 1h).

Regression analysis of the RIL screening results revealed two significant loci (Figure 2). The genetic position on chromosome 1 was well-characterized due to close recombination events, whereas the genetic position on chromosome 4 was less defined. Susceptibility in the RILs between Col-4 and Ler-0 occurred when marker m305 (RLM1) showed the Ler genotype and marker mi198 (RLM2) displayed a Col genotype. Thus, the gene found in Col-4 should encode a L. maculans resistance gene located close to marker m305. Only one RIL (N1918) exhibiting a Col-4 genotype at marker m305 was classified as susceptible and provided important information for a well-defined location of RLM1. A tight association between the marker m305 and RLM1 was further confirmed using the core set of fifty Ler-2 × Cvi-1 RILs and seven susceptible Ler-0 × Ws-0 F2 plants that also linked RLM1 to marker m305.

Figure 2. Graphical output from QTL cartographer, illustrating the well-defined genetic intervals of RLM1 and RLM2 and the additive effect for the alleles that contribute to susceptibility. RLM1 has an LOD score of 14.8 at marker m305 (91.89 cM, At1g64170/80) and RLM2 an LOD score of 7.9 at marker mi198 (52.47 cM, At4g15160/80). A significance of P < 0.05 corresponds to an LOD score of 4.94 according to permutation tests.

Download figure to PowerPoint

image

The Ler-resistance locus (RLM2Ler) was found between Ve024 (51.93 cM, At4g14690) and mi260 (54.93 cM, At4g16010) on chromosome 4 on the Col-4 × Ler-0 RIL marker map. The best associations were found at marker m198 (52.47 cM, At4g15160–At4g15180). RLM2Ler was however mapped to marker GB.750C on chromosome 4 in the Ler-2 × Cvi-1 RI lines, which is approximately 31 cM south of marker mi198. This discrepancy implies an inversion event in either Col-4 or Cvi-1 compared to Ler-0 or differences between the genetic maps. The physical location of RLM2Ler was determined by observations of disease lesions on the near–isogenic lines LCN4-5 and LCN4-6 that have Ler-2 background with Cvi-1 genotype only at parts of the mapped location of RLM2 (Figure 1e). Ler-2 shows a completely resistant phenotype identical to Ler-0. Data on the genomic regions of Cvi-1 genotype within the Near Isogenic Lines (NILs) (J. Keurentjes, Laboratory of Genetics, Wageningen University, Wageningen, personal communication) define the location of RLM2Ler between 9.9 and 11.4 Mbp, corresponding to At4g17800–At4g24140, on chromosome 4.

RLM1Col resides in a complex of structurally related TIR-NB-LRR class R genes

Data on the physical locations of RIL markers defined the Col-resistance locus (RLM1Col) to the At1g63710–At1g64360 interval. Out of 76 genes found in the mapped locus, seven encoded putative R genes of the TIR-NB-LRR family. The genetically defined locus also contained defence-associated genes such as NPR1, RbohF and a pathogen-responsive dirigent-like lignan biosynthesis protein. To identify the gene responsible for the rlm1Ler phenotype, T-DNA mutants in the Col-0 background of candidate genes in the RLM1 locus were screened with L. maculans.

None of the 16 T-DNA mutant lines targeting 10 disease-associated genes in the RLM1 locus examined showed the same rapid lesion development as the rlm1Lerrlm2Col plants used as a positive control. However, two independent knock-out lines (salk_014088 and salk_014096), containing a disruption of the first exon of the gene At1g64070, displayed a reduced resistance (Figure 3a) compared to the highly resistant wild-type Col-0 (Figure 1a). T-DNA mutants in At1g64070 were confirmed to be allelic for rlm1Ler by observations of susceptibility in F1 after crosses with the rlm1Lerrlm2Col control line. The test cross between salk_014088 and rlm1Lerrlm2Col did show an intermediate susceptible phenotype in F1 (Figure 3b). Disease symptoms were more severe than found on salk_014088 but not as obvious as on rlm1Lerrlm2Col individuals. In addition to the phenotypes found after disruption of At1g64070, two T-DNA mutant lines in the gene At1g63880 (salk_110395 and salk_110393) also exhibited a reduced resistance, although more moderately (Figure 3c,d). Pycnidia developed over large leaf areas on both rlm1Lerrlm2Col and salk_014088 plants but not on wild-type Col-0 (Figure 3e–g). The F1 progeny between salk_014088 and rlm1Lerrlm2Col displayed successful systemic growth of L. maculans in un-inoculated leaves (Figure 3h), which was not observed in salk_014088. The intermediary response observed on F1 plants from a test cross between salk_014088 and rlm1Lerrlm2Col suggests that the remaining genetic components, when At1g64070 function is lost, quantitatively contribute to resistance. Complementation analysis with the genomic Col-0 sequence of At1g64070 driven by its native promoter was performed in the highly susceptible rlm1Lerrlm2Col control line background to facilitate reliable scoring of phenotype changes. Completely restored resistance was found in eight T1 plants (Figure 3i,j). The remaining three lines showed very weak lesions corresponding to 3 or less on the Delwiche and Williams (1979) scale but with no obvious mycelia growth or pycnidia development. In conclusion, RLM1 activity is mainly dependent on At1g64070, together with a minor contribution from at least one additional homologous gene, At1g63880, present in this locus.

Figure 3. Phenotypic responses to L. maculans observed on genotypes with genetic modifications of RLM1 or RLM2 compared to wild-type plants. dpi, days post-inoculation. (a) Susceptible phenotype on At1g64070 T-DNA mutant salk_014088, 19 dpi. (b) Susceptible phenotype on F1 progeny between rlm1Lerrlm2Col and At1g64070 T-DNA mutant salk_014088, 16 dpi. (c) Moderately susceptible phenotype on At1g63880 T-DNA mutant salk_110395, 21 dpi. (d) Mycelia growth in salk_110395 visualized by tryphan blue staining, 21 dpi. (e) Pycnidia formation on a detached leaf of rlm1Lerrlm2Col. (f) Pycnidia formation on a detached leaf from At1g64070 T-DNA mutant salk_014088. (g) Lack of fungal growth on a detached leaf from resistant Col-0. (h) Pycnidia formation on a detached leaf after systemic growth of L. maculans in F1 progeny between rlm1Lerrlm2Col and At1g64070 T-DNA mutant salk_014088. (i) Resistant phenotype in T1 by complementation of rlm1Lerrlm2Col with the genomic Col-0 sequence of At1g64070 driven by the native promoter, 14 dpi. (j) Susceptible rlm1Lerrlm2Col non-transformed control, 14 dpi. (k) Resistant non-transformed Ler-0 control, 14 dpi. (l) Susceptible phenotype in T2 line of Ler-0 with RNAi that targets four TNL-H genes in the RLM1Col locus, 14 dpi.

Download figure to PowerPoint

image

To further understand the role of this particular gene family, a 26-mer RNA interference (RNAi) construct was designed to specifically target TIR-NB-LRR genes within the RLM1Col locus (At1g64070, At1g63750, At1g63880, At1g63870) under the simplified assumption of a requirement of 22 consecutive identical nucleotides for silencing. This assumption predicted that three RLM1-related off-target genes (At4g14370, At1g56510, At2g16870) would be affected by the RNAi construct. A sequence analysis with the more flexible criteria described by Du et al. (2005) showed that only genes structurally related to RLM1 may act as off-target genes and that two more genes (At5g18350 and At1g63740) are possibly silenced by the RNAi construct. Twelve susceptible plants were found when 79 T1 RNAi plants of the Ler-0 background were evaluated (Figure 3k,l). The appearance of the first necrotic lesion varied however from 5 to 17 days post-inoculation. These results support our hypothesis that resistance in Ler-0 is dose-dependent and dependent on genes structurally related to those found in RLM1Col. Consequently, RLM2Ler is a paralogue of RLM1Col.

RLM1 is a L. maculans-specific resistance gene

Leptosphaeria maculans-susceptible (rlm1Lerrlm2Col) plants and T-DNA mutants in RLM1 candidate genes did not display any susceptibility to Botrytis cinerea or Alternaria brassicicola, suggesting that RLM1 is a L. maculans-specific resistance gene and that RLM1 differs from the BOS3 locus, which has been mapped to the same cluster of genes (Veronese et al., 2004).

The non-functional rlm1Ler locus reveals loss-of-function in both RLM1Col genes

PCR amplification of genomic DNA and cDNA from Ler-0 did not result in any product from the sequences of the gene At1g63880. PCR amplification of the same sequences was successful and resulted in identical fragment lengths from genomic DNA of the RLM1 genotypes Col-0, Col-4 and Ws-0. The gene At1g64070 was, on the other hand, isolated from genomic Ler-0 DNA and fragment lengths corresponded to the products obtained from Col-0 DNA. BLAST analysis of At1g64070 against the Cereon Ler-0 sequence database (Jander et al., 2002) revealed a 1604 bp hit with 96% identity. The sequence (ATL8C33498) revealed a G insertion at 1569 bp (coordinates based on Col-0 coding domain sequence (CDS) of At1g64070), which caused a +1 frameshift (rlm1-snpA) in the gene, resulting in subsequent premature translational stop codons. The same polymorphism was found in BLAST hits from the Ler-0 sequence database (http://www.tigr.org/tdb/e2k1/ath1/atgenome/Ler.shtml) using the Col-0 At1g64070 CDS sequence. Single nucleotide polymorphism (SNP)-specific PCR analysis showed the Ler-0 genotype in rlm1-snpA for all 12 rlm1Lerrlm2Col and seven susceptible rlm1Lerrlm2Ws F2 plants tested. Furthermore, rlm1-snpA was found to co-segregate with marker m305 in the Col-4 × Ler-0 RILs, providing further proof that the Ler-0 sequence ATL8C33498 represents an allele of At1g64070. In agreement with phenotype data, the susceptible RIL N1918 with Col-4 genotype at marker m305 showed Ler-0 genotype at rlm1-snpA. Allele fragments of the expected size were recovered with two independent At1g64070-specific forward primers and the SNP-specific primer. The Ler-0 allele of rlm1-snpA was not amplified in any of the four RLM1 genotypes (Col-0, Col-4, Ws-0, Cvi-1), whereas the Col-0 allele of rlm-snpA was successfully amplified.

Variation in disease progression between susceptible Col-4 × Ler-0 RILs reveals camalexin as a quantitative resistance factor

The genetic analysis showed that resistance to L. maculans is mainly controlled by two different dominant loci, RLM1Col and RLM2Ler, one from each parental accession, but the level of disease progression and the disease phenotypes among the susceptible Col-4 × Ler-0 RILs was highly variable (Table S1 and Figure S1a,b). This observation demonstrates that additional quantitative trait locus (QTLs) reside together with the Mendelian resistance traits. The 4.2% (7 of 168) discovery rate of susceptible individuals from Ler-0 × Ws-0 and 4.4% from Col-0 × Ler-0 F2 populations compared to the expected 6.25% segregation (Bohman et al., 2004) suggest that the resistance QTLs represents one recessive or several weak multigenic resistance traits. Weak susceptible phenotypes are usually not detected in screenings of large F2 populations, which explains the lower frequency, whereas they are possible to characterize in homogenous RILs. The phytoalexin camalexin has been shown to play a partial role in the L. maculans defence system (Bohman et al., 2004). These observations led us to further analyse the influence of camalexin induction.

The Ler-0 accession induced approximately 30% of Col-0 levels of camalexin 48 h after L. maculans inoculation (Figure 4a). A similar difference in camalexin induction levels between Ler-0 and Col-0 has previously been observed in response to A. brassicicola (Kagan and Hammerschmidt, 2002). However, the susceptible Col-0 × Ler-0 plants displayed a large variation in camalexin induction (Figure 4a,b). This difference in camalexin induction between Col-0 and Ler-0 could explain our difficulties when attempting to rapidly identify susceptible mutants displaying a clear disease phenotype in the Col-0 background. For example, disease phenotypes in mutants with the Col backgrounds represented by the At1g64070 mutant salk_014088 and the At1g63880 mutant salk_110395 (Figure 3a,c) need at least 19 days to develop disease symptoms compared to the rlm1Lerrlm2Col, rlm1Lerrlm2Ws and Ler-rlm2Cvi lines (Figure 1c–e) which only require approximately 14 days before distinct lesions are formed. The delayed disease phenotype in the Col-0 background is characterized by a large chlorotic halo, whereas genotypes of Ler-0 background either develop an expanding necrotic area along the edge of the inoculation point or several expanding lesions surrounding the sites of inoculation. Susceptible Ler-0 genotypes will, at the time of established Col-0 susceptibility, have lesions that often have developed so far that the leaf is completely dead.

Figure 4. Induction of camalexin and disease progression by L. maculans in different genotypes. (a) Camalexin induction in Ler-0, Col-0 and susceptible Col-0 × Ler-0 F3 plants 48 h post-inoculation, based on at least 15 independent measurements of each genotype. (b) Relative camalexin induction 48 h post-inoculation in susceptible Col-4 × Ler-0 RILs in relation to the average number of days until disease severity corresponding to 5 or higher levels, using the scale of qualitative classes ranging from 0 to 9 (Delwiche and Williams, 1979). The scale is as follows: 0, no symptoms; 1, lesion diameter 0.5–1.5 mm; 3, dark necrotic lesions 1.5–3 mm; 5, lesions 3–5 mm, occasional sporulation; 7, grey-green tissue collapse, lesions 4–8 mm, sporulation; 9, rapid tissue collapse, accompanied by profuse sporulation in large lesions (more than 5 mm). Disease development is based on observations of between 7 and 17 plants per line. (c) Disease development expressed as percentage of diseased plants after inoculation with PG2 isolates (PHW1245 and Leroy) in relation to time to develop a distinct disease phenotype. No difference in disease response could be observed between the isolates. A plant was classified as susceptible when the disease lesion phenotype had reached a level corresponding to 3 or more on the Delwiche and Williams scale. Forty-nine inoculated plants from a F2 population of salk_014088 × rlm1Lerrlm2Col were compared to responses in 10 plants of each parental line. Differences between rlm1Lerrlm2Col (Col × Ler) and the rlm1Lerrlm2Col × salk_014088 F2 population are interpreted to measure the contribution from a resistance QTL of Col-0 origin. (d) Evaluation of isolate dependency (Leroy and M1) of the synergistic effects, visible as a hyper-susceptible phenotype found in a double mutant (DM) between rlm1Lerrlm2Col and pad3-1, compared to the susceptible phenotype seen in the parental genotypes. Susceptibility is expressed as number of days post-inoculation until disease severity corresponding to 3 or more on the Delwiche and Williams scale has been reached, based on 18–52 individual plants per line and isolate. The double mutant was represented by progeny from two different F2 plants with the hyper-susceptible phenotype. (e) Evaluation of an Ler-0-derived resistance QTL using rlm1Lerrlm2Col and an F2 population between rlm1Lerrlm2Col and Ler-rlm2Cvi (LCN4-6). Susceptibility is determined as the number of days post-inoculation until disease severity corresponding to 3 or more on the Delwiche and Williams scale has been reached. The data is based on 9–34 plants per line. (f) Evaluation of an Ler-0-derived resistance QTL using rlm1Lerrlm2Col and an F2 population between rlm1Lerrlm2Col and Ler-rlm2Cvi at 16 days post-inoculation, and scored according to the Delwiche and Williams scale. The data is based on 9–34 plants per line.

Download figure to PowerPoint

image

The variation of disease symptoms in plants with non-functional RLM1 and RLM2 alleles can partially be explained by camalexin induction, as the susceptible RILs displayed trends of a negative correlation between camalexin induction and the level of susceptibility (Figure 4b). Similar observations to these have been found in the Arabidopsis–B. cinerea pathosystem (Denby et al., 2004). Many of the susceptible RILs show higher camalexin induction when compared to the resistant Col-0 parent. A plant lacking an R gene will have a higher degree of pathogen-induced stress, consequently it will also induce higher levels of camalexin (Mert-Türk et al., 2003). As camalexin induction to some extent is indistinguishable from disease progress, a genetic identification of a ‘camalexin induction in response to L. maculans’ QTL is complicated. Further analysis of F2 progenies from the cross between rlm1Lerrlm2Col and salk_014088 revealed that the weaker susceptible phenotype displayed by salk_014088 segregated in a 1:1 pattern when all rlm1Lerrlm2Col control plants showed full susceptible phenotype (Figure 4c). This segregation pattern shows that there is a co-dominant resistance trait of Col-0 parental origin responsible for this phenotype, and also provides evidence that At1g64070 is the gene primarily responsible for RLM1 function. The observation of a 15:1 segregation ratio of hyper-susceptibility by F2 progenies from a cross between rlm1Lerrlm2Col and the camalexin-deficient mutant pad3-1 together with subsequent disease progression studies in F3 (Figure 4d) confirms that RLM1/RLM2-dependent resistance and camalexin represent two independent resistance pathways with additive effects. No effect on the time of emergence of disease symptoms could be observed from resistance QTLs of Ler parental origin in an F2 population from a cross between rlm1Lerrlm2Col and Ler-rlm2Cvi (Figure 4e). The resistance QTLs from Ler parental origin did however influence the disease severity (Figure 4f).

RLM1Col/RLM2Ler gene-mediated resistance triggers callose deposition and is dependent of RAR1 and HSP90.1

Several R protein-dependent signalling cascades have been revealed for different classes of R proteins by studies of Arabidopsis mutants (Hammond-Kosack and Parker, 2003). Hence, we were interested in examining mutants linked to TIR-NB-LRR-type R protein interactions identified in other pathosystems. The mutants eds1-1 (Ws-0 background), eds1-2 (Ler-0 background) and pad4-1 (Col-0 background) impair the function of all previously reported TIR-class R gene-mediated resistance responses, but do not affect L. maculans resistance (Bohman et al., 2004). We have, however, found a requirement for RAR1 in both RLM1- (salk_013489, Col-0 background) and RLM2- (rpr2-4, Ler-0 background) mediated resistance (Figure 5a,b). The difference in the degree of susceptibility between the Ler-0 and Col-0 mutants in RAR1 is in accordance with our observations of weaker susceptibility phenotypes with a Col-0 background and hence higher camalexin induction. Screening of the T-DNA mutants in a HSP90 chaperone athsp90.1-1 and athsp90.1-2 (Col-0 background), involved in RAR1/R gene activity, revealed, on the other hand, that HSP90.1 possess a moderate influence on L. maculans resistance (Figure 5c). Neither the RAR1-associated SGT1b mutation (enhancer of tir1-1 auxin resistance, eta3, Col-0 background) nor the SGT1b-like gene SGT1a (sgt1a1-1, Ws-0 background) exhibited any visible influence on L. maculans resistance (Figure 5d).

Figure 5. Phenotypic responses to L. maculans on mutants involved in R gene signalling, and aniline blue staining to assess callose induction. dpi, days post-inoculation. (a) Susceptible phenotype on RAR1 mutant rpr2-4 (Ler-0 background), 14 dpi. (b) Susceptible phenotype on RAR1 T-DNA mutant salk_013489 (Col-0 background), 21 dpi. (c) Susceptible phenotype on hsp90.1-1 (Col-0 background), 21 dpi. (d) Resistant phenotype on the SGT1b mutant eta3 (Col-0 background), 21 dpi. (e) Callose deposition in the camalexin-deficient genotype pad3-1 (Col-background), 2 dpi. (f) Callose deposition in the camalexin-free rlm1Ler double mutant pad3-1 × rlm1Lerrlm2Col, 2 dpi. (g) Susceptible phenotype on the callose synthase mutant pmr4-1, 17 dpi. (h) Susceptible phenotype on the papilla formation mutant pen1, 19 dpi.

Download figure to PowerPoint

image

Synthesis of 1,3-β-glucans (callose) has been found to be induced by the BrassicanapusL. maculans resistance genes LepR1 and LepR2 (Yu et al., 2005), which led us to examine if it also is an R gene-dependent resistance response in Arabidopsis. Aniline blue staining and comparison of callose deposition 2 days post-inoculation of (RLM1Col)pad3-1 (Figure 5e) and rlm1Lerpad3-1 revealed that RLM1, like the B. napusLepR genes, is required for efficient callose deposition in response to L. maculans infection (Figure 5f). Furthermore, susceptible phenotypes to L. maculans were found both with the callose synthase mutant pmr4-1 and the papilla mutant pen1 (Figure 5g,h).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Exploring the natural variation of disease resistance in Arabidopsis

Exploitation of the natural variation in Arabidopsis has received quite some attention, especially when used to identify the genetics behind complex traits (Borevitz and Nordborg, 2003; Koornneef et al., 2004). The evolutionary history of Arabidopsis contains a relatively large proportion of outbreeding, consequently a phylogeographic ‘accession tree’ cannot be built based on polymorphism information (Bergelson et al., 1998). Thus, different loci have developed differently across accessions over time. Based on an assumption of linkage disequilibrium between the marker m305 and the RLM1 gene, we predicted that progenies between Ler-2 and Cvi-1 should provide susceptible individuals. The evolutionary linkage between m305 and RLM1 is considered to be strong, as the accession Cvi-1 is more divergent from Col-0 than any of the three other accessions tested in this study (Schmid et al., 2003). No other SNPs with the same accession haplotype pattern as m305 could be found in the MASC database within the RLM1 locus (http://www.mpiz-koeln.mpg.de/masc/), apart from the rlm1-snpA polymorphism that causes a premature translational stop in the rlm1Ler gene.

The Col-4 × Ler-0 population has been used for mapping and cloning a number of resistance genes, such as RPP5 and RPP8 (McDowell et al., 1998; Parker et al., 1993, 1997). Further mapping initiatives using Col-4 × Ler-0 RILs include study of the venial necrosis in response to turnip mosaic virus (Kaneko et al., 2004) and susceptibility to B. cinerea (Denby et al., 2004). QTL analysis suggested the presence of multiple and isolate-specific loci in Arabidopsis controlling B. cinerea disease development. Other reports of a complex genetic framework derive from work on Phytophthora brassicae (formerly P. porri) and Xanthomonas campestris pv. campestris (Buell and Sommerville, 1997; Roetschi et al., 2001). The genetic mapping of X. campestris resistance revealed a monogenic form of resistance (RXC2), but, in addition, interacting genetic components from both parental genotypes (RXC3Ler + RXC4Col) resulted in a novel form of digenic resistance. These results, together with our results on L. maculans, imply that natural variation in pathogen resistance often is a result of a complex genetic background.

RLM1, a resistance locus with contribution to resistance from more than one TIR-NB-LRR R gene

In this study we have shown that RLM1, a locus with at least two TIR-NB-LRR R genes, contributes to resistance to L. maculans. One gene, At1g64070, was shown to play the major role in the resistance response. A digenic requirement for functional resistance has been observed for the RPP2 locus, which also consists of a complex of TIR-NB-LRR R genes (Sinapidou et al., 2004). It was suggested that the two genes responsible for RPP2 function cooperated to provide the necessary recognition or signalling functions for Hyaloperonospera parasiticaCala2 resistance. Resistance could also, in accordance to the suggested mechanism of RAR1 (Bieri et al., 2004), be R protein dose-dependent thus requiring additive input from several independent R genes with redundant function to a certain threshold level. If that is the case, it is likely that both At1g64070 and At1g63880 are required in order to reach such a threshold level for RLM1-derived L. maculans resistance in Col-0. The complete resistance seen in rlm1Lerrlm2Col plants complemented with the Col-0 version of At1g64070, in contrast to the knock-out lines in At1g63880, indicate that the two genes have redundant functions in L. maculans recognition, and that complementation using our genomic At1g64070 construct provides additional transcripts to compensate for the loss of At1g63880. T-DNA mutant phenotypes show that RLM1 is mainly dependent on At1g64070. Consequently, it is difficult to resolve the precise level required to compensate for a loss of At1g63880.

A genome-wide analysis of NB-LRR-encoding genes in Arabidopsis (Col) has revealed a number of subclasses within the two major groups comprised of either CC-NB-LRR or TIR-NB-LRR proteins (Meyers et al., 2003). All the R genes found in the mapped region of RLM1 (At1g64070, At1g63880, At1g63870, At1g63860, At1g63750, At1g63740, At1g63730) are members of the TIR-NB-LRR TNL-H subgroup (Meyers et al., 2003). Twenty-four proteins were found in TNL-H, which are homogeneous in the composition and arrangement of their LRR motifs. TNL-H is a subgroup that has not previously been linked to any specific disease resistance. The seven homologous TNL-H R genes within the mapped region of RLM1 in Col-0 are arranged in two clusters of three R genes each (At1g63730–At1g63750 and At1g63860–At1gg3880) (clusters 9 and 10 in Richly et al., 2002). The gene responsible for RLM1 activity, At1g64070, has no immediate homologous neighbours. In contrast to other previously characterized R genes, the TNL-H genes found in the RLM1 locus do not appear to be under positive selection (group 1 genes in Mondragon-Palomino et al., 2002). Despite the lack of apparent positive selection on this group of genes, the function provided by the RLM1/RLM2 loci seems to have an evolutionary importance, as a large proportion of Arabidopsis accessions, 167 out of 168, tested against L. maculans display a high degree of resistance (Bohman et al., 2004).

Chromosomal regions in the vicinity of RLM1 and RLM2 show evolutionary links

There is an over-representation of genes in close proximity to RLM1 with a significant sequence similarity to genes in the region on chromosome 4 mapped for RLM2. This observation suggests that RLM1 and RLM2 share a common evolutionary history. There is a duplication event (block 0104431800740 in http://wolfe.gen.tcd.ie/athal/index.html; Blanc and Wolfe, 2004) between a region spanning RLM1 (At1g63830–At1g64670) and a location within the NIL-mapped region of rlm2Cvi (At4g23470–At4g24140). Given that synteny within this block is maintained, we expect RLM2 to be situated around 11.28 Mbp (between At4g23530 and At4g23630) on chromosome 4 in Ler-0. NIL screening results locate RLM2 between 9.9 and 11.4 Mbp on chromosome 4, which is in agreement with the location for the duplication block of RLM1. A corresponding gene to At1g64070 is not found in the Col-0 sequence of the homeologous region on chromosome 4 that corresponds to RLM2. The corresponding gene responsible for RLM2 activity could possibly have been deleted in Col-0, whereas it remains intact in Ler-0. The concurrence between the NIL mapping results and the possible location of RLM2, based on gene duplication data, provides a strong indication of the physical location of RLM2. Furthermore, the susceptible phenotype on Ler-0 plants transformed with an RNAi construct designed to target RLM1Col provides strong evidence that RLM2Ler is structurally related to RLM1Col. Candidate gene selection based on common evolutionary history for R genes is however problematic, since even apparently minor changes can drastically change pathogen specificity, as shown in the RPP8/HRT family (Cooley et al., 2000). The Col-4 × Ler-0 RIL mapping results define the location of RLM2 to the At4g14690–At4g16010 interval. This discrepancy between the Col-4 × Ler-0 and Ler-2 × Cvi-1 results may indicate that either Col-4 or Cvi-1 has experienced a large-scale genomic rearrangement at this locus. Alternatively, this may be a locus with a complex composition of resistance genes, where different components are lost in the different accession crosses. However, we did not see any restoration of resistance in F2 progenies from rlm1Lerrlm2Col and Ler-rlm2Cvi, which would be expected if rlm2 consisted of different loci. The data suggest that the RLM1 and RLM2 genes derive from a common ancestor. Given that RLM1 has been found in several accessions, whereas RLM2 has only been found in Ler, it is likely that RLM1 is the older of the two loci. A recent mapping attempt of the B. napusL. maculans resistance genes LmR1 and CLmR1 revealed that the most significantly linked markers showed homology to sequences close to RLM1Col on Arabidopsis chromosome 1 (Mayerhofer et al., 2005). This could indicate that the L. maculans resistance genes share common ancestry prior to the separation of the Arabidopsis and the Brassica lineages.

RLM1Col/rlm1Ler comparisons

The two genes At1g64070 and At1g63880, confirmed as important for RLM1 function, are more similar to each other in protein sequence than to any of the other TNL-H homologues present in the RLM1 locus. Analyses of the two RLM1 genes in the non-functional rlm1Ler locus showed a deletion of At1g63880 and premature translational stops in At1g64070. The premature translational stop of At1g64070 generates a 528 amino acid protein, containing a 130-residue (16-146) TIR domain and a 294-residue (167-461) nucleotide binding domain. The Col-0 version of this gene translates to a protein of 997 residues and consists of domains that correspond to the Ler-0 protein plus a region of six LRR domains. At1g64070 in Ler-0 is translationally truncated almost immediately after the NB domain, which addresses the issue of function of the TIR-NB (TN) class proteins (Meyers et al., 2002). Comparison of amino acid changes between Col-0 and Ler-0 shows that these two genes have experienced considerable evolution since they diverged. However, the changes in nucleotide sequence preceding the premature stop codons in Ler-0 are clearly more restricted [1100/1153 (95%) sequence identity to the Col-0 sequence] than in the sequence downstream of this event [371/509 (72%) sequence identity to the Col-0 sequence]. This difference in sequence degeneration indicates that the gene At1g64070 still has retained some functions as a TN gene in Ler-0 due to selection pressure. TN genes probably do not act as resistance genes, but may be required for downstream signalling and function of another full-length TIR-NB-LRR resistance gene, possibly as TIR adaptor proteins such as the animal signalling component MyD88 (Janssens and Beyaert, 2002; Jordan et al., 2002; Zhang and Gassmann, 2003).

R gene signalling

In Arabidopsis, a range of downstream R gene signalling components has been identified. In contrast to most previously reported TIR-NB-LRR R gene systems, resistance to L. maculans is dependent on neither PAD4 nor EDS1 (Bohman et al., 2004). To date, only one reported TIR-NB-LRR class R protein, resistance to Albugo candida (RAC1), has been shown to require EDS1 but not PAD4 to remain functional (Borhan et al., 2004). A common denominator between A. candida and L. maculans is that they both, in contrast to all previously reported TIR-NB-LRR-dependent resistance systems, exhibit a salicylic acid-independent resistance, which could explain the dispensability of PAD4 in response to these pathogens. In addition, components such as RAR1 and SGT1 are required for both the TIR-NB-LRR and CC-NB-LRR R gene classes. It is intriguing that one important activity of SGT1 is in Skp1/Cullin/F-box (SCF)-mediated ubiquitinylation (Kitagawa et al., 1999). SCF complex activity influences the signalling of a wide array of plant hormones. The auxin-resistant E1 ubiquitin ligase mutant axr1-24 affects, among other things, the SCFcoi1 complex for functional jasmonate signalling (Tiryaki and Staswick, 2002). In response to L. maculans, a significant induction of the ubiquitin protein UBQ4 at 72 h post-inoculation in B. napus plants harbouring Arabidopsis-derived L. maculans resistance has been found (Bohman et al., 2002). Furthermore, the auxin resistant mutant axr1-12, which is impaired in SCF complex function, shows susceptibility towards L. maculans. This result, together with the observed root insensitivity of the lms5 mutant on auxin-containing medium suggest the involvement of components in common with auxin responses in plant defence against L. maculans (M. Kaliff, J. Staal, C. Dixelius, unpublished data).

Taken together, we have shown in this paper that L. maculans resistance in Arabidopsis requires several components, which most likely represent different layers of plant defence. At least two TIR-NB-LRR class R genes, callose deposition and camalexin induction are major determinants of disease development. Susceptible RAR1 and HSP90 mutants, which affect R protein stability and thereby steady-state levels, suggest that L. maculans resistance requires a certain threshold level of recognition proteins. Our current understanding of the function and possible interaction of the components so far found to be important for plant defence to L. maculans is still rudimentary. In this respect, we foresee that the sequence information and fungal tools such as mutants deriving from the genome project of L. maculans will be of significant value (Rouxel and Balesdent, 2005). However, the R genes identified in this work will constitute key players in future work to unravel important regulatory elements and interacting defence proteins.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Plant material

Recombinant inbred populations of Col-4 × Ler-0 (Lister and Dean, 1993) and Ler-2 × Cvi-1 (Alonso-Blanco et al., 1998) and F2 populations between Ler-0 × Ws-0 and Col-0 × Ws-0 were evaluated for responses to L. maculans. F1 and F2 progeny between susceptible Ler-0 × Ws-0 plants and susceptible Col-0 × Ler-0 plants were evaluated for allelism. T-DNA mutants (salk_087810, salk_133795, salk_101258, salk_133759, salk_110395, salk_110393, salk_143567, salk_014088, salk_014096, salk_129756, salk_134815, salk_053084, salk_128409, salk_087551, salk_015175, salk_100157) in genes located in the mapped region for resistance in accession Col-0 (Alonso et al., 2003) were evaluated for L. maculans susceptibility. The following mutants were evaluated for responses to L. maculans: RAR1 in both Col-0 and Ler-0 backgrounds (salk_013489, rpr2-4), SGT1b (eta3, Gray et al., 2003) and its homologue SGT1a (sgt1a-1, Austin et al., 2002) in Col-0 and Ws-0 backgrounds, respectively, and two independent HSP90.1 T-DNA insertion mutants in the Col-0 background (hsp90.1-1 and hsp90.1-2, Takahashi et al., 2003). In order to determine the role of callose and papilla induction in L. maculans resistance, the callose synthase mutant pmr4-1 (Vogel and Somerville, 2000) and papilla formation mutant pen1 (Collins et al., 2003) were assessed for L. maculans susceptibility. Susceptible homozygous plants (F3) deriving from a cross between Col-0 and Ler-0 were crossed with pad3-1 (Glazebrook and Ausubel, 1994), propagated and assessed for susceptibility, camalexin induction and inheritance pattern.

Plant growth conditions and fungal inoculations

Arabidopsis plants were cultured and inoculated as described by Bohman et al. (2004) Four L. maculans isolates (Leroy, PHW1245, M1 and MD2) that are variable in all nine avirulence genes described in B. napus interactions were used (Balesdent et al., 2005). To further confirm susceptibility, leaves were detached 1 week post-inoculation and incubated under 100% humidity in Petri dishes to promote the formation of pycnidia. Detailed growth of the fungus was monitored by lactophenol trypan blue staining (Koch and Slusarenko, 1990), and induced callose depositions in plants by aniline blue staining (Gressel et al., 2002). Alternaria brassicicola (isolate MUCL20297) and B. cinerea (isolate MUCL30158) inoculations (Thomma et al., 1998) were performed on T-DNA mutants of RLM1 candidate genes and susceptible Col-0 × Ler-0 plants for confirmation of L. maculans-specific responses.

Mapping of RLM loci

One hundred recombinant inbred lines (set 1) between Ler-0 and Col-4 (Lister and Dean, 1993) were used in order to map the susceptibility previously observed (Bohman et al., 2004). Markers found to be significantly associated with susceptibility were also evaluated on susceptible individuals deriving from a Ler-0 × Ws-0 F2 population. RLM1-linked Col-4 × Ler-0 RI map markers mi324 (At1g62630), mi353 (At1g63040) and mi424 (At1g65540) were sequenced in order to establish a physical location. Linkage disequilibrium was assumed between susceptibility and marker m305, and found to be highly significant in the Col-4 × Ler-0 RIL mapping data. Marker m305 is polymorphic between Ler and Col/Ws/Cvi. The link to m305 was confirmed using the basic set of 50 Ler-0 × Cvi-1 recombinant inbred lines (Alonso-Blanco et al., 1998). The full set (100 lines) of Col-4 × Ler-0 RI lines was screened three times with 3–7 replicates for each line. Ambiguous phenotypes were studied in detail using a larger number of plants (>20) per line. Additionally, plants deriving from crosses of susceptible Col-0 × Ler-0 and Ler-0 × Ws-0 were assessed in F1.

Statistical analysis of RIL screening data

Marker information was obtained from NASC (http://arabidopsis.info/new_ri_map.html), and markers annotated as ‘unique’ and ‘framework’ were selected to an average marker density of 1 marker per 1.5 cM. Susceptible RILs were scored as ‘1’ and resistant lines were scored ‘0’ for further analysis. A paired marker regression was made in QTX map manager (Manly et al., 2001) under high stringency (P < 10−7). When the screening data were more complete, the analysis was complemented with composite interval mapping analysis in QTL cartographer (Wang et al., 2004). The Ler-0 × Cvi-1 marker map was retrieved from the NATURAL-EU project (http://www.dpw.wau.nl/natural/resources/populations/CVI/). Screening results were analysed qualitatively via recombination patterns in the proximity of the most significant markers and quantitatively using QTX map manager as described for the Col-4 × Ler-0 RILs.

PCR and DNA sequencing

All PCR analyses were performed using 1.25 U Taq polymerase (Fermenta, St Leon-Rot, Germany) per 50 μl reaction volume, 1× PCR buffer with ammonium sulphate (Fermenta), 2 mm MgCl2, 0.2 mm dNTP and 0.6 μm of each primer. The amplifications were made with an initial denaturation at 95°C for 4 min, followed by 35 cycles of 95°C for 30 sec, 55°C for 30 sec and 72°C at 1 min per kb expected product length, followed by a final extension of 10 min at 72°C. The identity of the PCR amplified fragments was either confirmed by sequencing or by amplification by several independent primer pairs. Sequencing was carried out on an ABI 377 automatic sequencer (ABI Prism 377, XL Upgrade; Applied Biosystems, Foster City, CA, USA) using a Thermo Sequenase dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). For each 20 μl reaction, we used 5 pm of the primers and 2 μg of template DNA. Sequences were evaluated using ABI Edit View and Technelysium Chromas software (Applied Biosystems).

Confirmation of RLM1 candidate T-DNA mutant

The RLM1 candidate gene was evaluated by assessing offspring from crosses between susceptible Col-0 × Ler-0 plants and the T-DNA mutant salk_014088. The identity and homozygosity of the susceptible T-DNA mutants salk_014088 and salk_014096 were confirmed by PCR, using the gene-specific primers salk:RLM1_LP: GGAAACTTCTCAAGCCCCAC, salk:RLM1_RP: CCAGTTTAGCAAGTGTTCGCC, and the T-DNA insertion-specific primer LBa1: TGGTTCACGTAGTGGG CCATCG. Susceptible F1 progeny between Col-0 × Ler-0 and salk_014088 were confirmed by identification of a heterozygous insertion, using the same set of primers.

Complementation of RLM1Col

The Col-0 genomic sequence of At1g64070, including 1600 bases upstream as promoter and 400 bases downstream, was amplified in PCR with the primers attB1- CTTCTGCTATAACTCGCTTTTATAAACG and attB2- GAATGAGTCAAAATATGGAATTGGAGTC using the high-fidelity enzyme Phusion (Finnzyme, Espoo, Finland). The PCR mix was used as recommended by the manufacturer and was performed with 30 sec denaturation at 98°C, four initial cycles with 10 sec denaturation at 98°C, 30 sec annealing at 58°C and 3 min elongation at 72°C, followed by 31 cycles where the annealing temperature was raised to 65°C. The PCR product was recombined into the pDONR vector via the Gateway system (Invitrogen, Carlsbad, CA, USA) for subsequent recombination into the Gateway-compatible binary vector pGWB1 (T. Nakagawa, Shimane University, Izumo, Japan). The complementation clone was used in transformation of susceptible Col-0 × Ler-0 (rlm1Lerrlm2Col control line) and a susceptible Ler-2 × Cvi-1 RIL (N22149). All Arabidopsis transformations were performed using the floral dip method (Desfeux et al., 2000), and seeds selected on 50 μg ml−1 kanamycin. Eleven individual plants of rlm1Lerrlm2Col background transformed with RLM1Col (At1g64070) were evaluated in T1 for resistant phenotype.

Sequence analysis of candidate genes from rlm1Ler

Matching sequences of the two candidate genes At1g64070 and At1g63880 were identified using BLAST against the Cereon Ler-0 sequence database (http://www.arabidopsis.org/Cereon/index.jsp). BLAST hits were evaluated in the TIGR Ler-0 database (http://www.tigr.org/tdb/e2k1/ath1/atgenome/Ler.shtml) for further confirmation. To confirm in silico results, three fragments of the gene At1g63880 were isolated using the primers At1g63880_AF: GCTTCTCCTTCTTCTTTTTCG, At1g63880_AR: TCACAACATCTTCCCATTCG, At1g63880_BF: TAAACAGACCTCTCCACGTCA, At1g63880_BR: AGCTCTGGCAAAGATGCGA, At1g63880_CF: AAAAGGGGTTAATCTACGTGGCT, and At1g63880_CR: CAATCTCCGTATTTTTCGTCTC. PCR amplification with the same primers was also used to evaluate the presence of At1g63880 in Ws-0 and Col-4. Three genomic fragments of the gene At1g64070 were isolated using the primers At1g64070_AF: TTCTTCCTCTTCTTCTGCGAGT, At1g64070_AR: TCAGAAGGAAATCCTACATAGTAGG, At1g64070_BF: TGTCAAGCAATTAGAGGCTTTAGC, At1g64070_BR: GATACAACTATCTGCAATCATCTCA, At1g64070_CF: TGGATGCCCACAGTTGAAAA, and At1g64070_CR: TCCGTCGCAGCTTCTTCTCT. In order to confirm a polymorphism that caused a truncation of the translated sequence of the Ler-0 version of At1g64070, an area surrounding this polymorphism was isolated with PCR using the primers rlm1-snpAF: CAAGAAGTGTAACAGAGCTTTGTGG and rlm1-snpAR: AGTAACCTTAGGCGAGGTGGAAACT. When the polymorphism was confirmed to exist in Ler-0, SNP-specific primers [the Col-0 allele rlm1-snpAC: ATGTCCTTGAAAATGATATAGGT (forward) and the Ler-0 allele rlm1-snpAL: CAGACACAACTCCAGTACCCA (reverse)] were designed for comparative analysis of other RLM1 accessions. PCR amplification with Ler-0 SNP-specific primer was performed in the presence of rlm1-snpAF or At1g64070_BF. For optimal reliability, PCR analyses were performed with SNP-specific primer together with At1g64070_BF and At1g64070_BR for observation of the presence of the allele-independent full-length band (1.7 kb), in combination with the presence or absence of an allele-specific band for the Col-0 allele (1 kb) or the Ler-0 allele (0.65 kb).

RNAi silencing of RLM1Col-like TNL-H family genes in Ler-0

An RNAi construct was designed using the sequence from a highly conserved stretch of nucleotides from a CLUSTAL-W (Available at http://www.ebi.ac.uk/clustalw/index.htmlalignment of the TNL-H gene family genes within RLM1. The sequence was confirmed to have possible cross-reactions to as few as possible non-target genes through the use of BLAST. A sense (CCAGATCTTTCAAATGCTACAAATCT) and an anti-sense 26 bp oligonucleotide sequence with attB sites (Invitrogen) were mixed in equal amounts and set to hybridize for 3 h at 55°C. A Klenow fragments reaction (Fermenta) was performed to make the attB sites double-stranded. The double-stranded oligonucleotide was recombined into a Hellsgate 2 vector (Helliwell et al., 2002). The recombination was confirmed by sequencing. Clones containing the Hellsgate 2 vector were identified by colony blot hybridization and used for transformation of Ler-0, Col-0 and Ws-0. Seventy-nine individual Ler-0 RNAi T1 lines were obtained and evaluated for susceptible phenotypes.

Camalexin quantification and evaluation

Plant material (100 mg) was extracted twice in 500 μl 80% methanol at 80°C for 1 h. The resulting solution was extracted twice with 100 μl chloroform, and the two chloroform extracts were pooled and concentrated. The extract was re-dissolved in 5 μl chloroform, loaded on a silica gel thin-layer chromatography (TLC) plate, and developed with chloroform/methanol in the ratio 9:1. Both relative quantifications using absorbance and absolute quantifications using fluorescence were performed (Bohman et al., 2004). Each determination was repeated with at least three independent technical replicates. Camalexin was determined and compared from two independent inoculation events using 3–5 biological replicates in each comparison. Synthetic camalexin was used as a reference in quantifications and during TLC analysis. The mutant genotype in PAD3 was confirmed with the primers PAD3-F: AACACAAGAACAGGGCAAGGA and PAD3-R: CTGACTCCAACTGGATCATCA together with snp_PAD3: ATATACTTGAAAGATTGAAGC or snp_pad3-1: ATATACTTGAAAGATTGAAGT.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Joe Ecker and Sabine Rundle for providing new information about the physical location of markers, Jonathan Jones, William Gray, Ken Shirasu, Jane Parker and Paul Schulze-Lefert for material to study R gene signalling, and Maarten Koornneef and Joost Keurentjes, for providing Ler/Cvi NILs for further confirmation of the RLM2 locus. We also thank Anders Falk and Ann-Christin Rönnberg-Wästljung for fruitful genetic discussions and Richard Hopkins for language corrections. This research was supported by the national graduate research schools in Genomics and Bioinformatics (FGB) and Interactions between Micro-Organisms and Plants (IMOP) at the Swedish University of Agricultural Sciences, and the Swedish Foundation of Strategic Research, the Plant Biotechnology Program.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J. and Parker, J.E. (1998) Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proc. Natl Acad. Sci. USA, 95, 1030610311.
  • Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science, 301, 653657.
  • Alonso-Blanco, C., Peeters, A.J., Koornneef, M., Lister, C., Dean, C., van den Bosch, N., Pot, J. and Kuiper, M.T. (1998) Development of an AFLP based linkage map of Ler, Col and Cvi Arabidopsis thaliana ecotypes and construction of a Ler/Cvi recombinant inbred line population. Plant J. 14, 259271.
  • Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D.G. and Parker, J. (2002) Regulatory role of SGT1 in early R gene-mediated plant defenses. Science, 295, 20772080.
  • Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K. and Schulze-Lefert, P. (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science, 295, 20732076.
  • Balesdent, M.H., Barbetti, M., Li, H., Sivasithamparam, K., Gout, L. and Rouxel, T. (2005) Analysis of Leptosphaeria maculans race structure in a worldwide collection of isolates. Phytopathology, 95, 10611071.
  • Bergelson, J., Stahl, E., Dudek, S. and Kreitman, M. (1998) Genetic variation within and among populations of Arabidopsis thaliana. Genetics, 148, 13111323.
  • Bieri, S., Mauch, S., Shen, Q. et al. (2004) RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell, 16, 34803495.
  • Blanc, G. and Wolfe, K.H. (2004) Functional divergence of duplicated genes formed by polyploidy during Arabidopsis evolution. Plant Cell, 16, 16791691.
  • Bohman, S. (2001) Molecular studies of Arabidopsis and Brassica with focus on resistance to Leptosphaeria maculans. PhD Thesis. Agraria 305. SLU Press, Uppsala, Sweden.
  • Bohman, S., Wang, M. and Dixelius, C. (2002) Arabidopsis thaliana derived resistance against Leptosphaeria maculans in a Brassica napus genomic background. Theor. Appl. Genet. 105, 498504.
  • Bohman, S., Staal, J., Thomma, B.P.H.J., Wang, M. and Dixelius, C. (2004) Characterisation of an ArabidopsisLeptosphaeria maculans pathosystem: resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling. Plant J. 37, 920.
  • Borevitz, J. and Nordborg, M. (2003) The impact of genomics on the study of natural variation in Arabidopsis. Plant Physiol. 132, 718725.
  • Borhan, H.M., Holub, E.B., Beynon, J., Rozwadowski, K. and Rimmer, R. (2004) The Arabidopsis TIR-NB-LRR gene RAC1 confers resistance to Albugo candida (white rust) and is dependent on EDS1 but not on PAD4. Mol. Plant Microbe Interact. 7, 711719.
  • Buell, C. and Sommerville, S. (1997) Use of Arabidopsis recombinant inbred lines reveals a monogenic and a novel digenic resistance mechanism to Xanthomonascampestris pv. campestris. Plant J. 12, 2129.
  • Collins, N., Thordal-Christensen, H., Lipka, V. et al. (2003) SNARE-protein-mediated disease resistance at the plant cell wall. Nature, 425, 973977.
  • Cooley, M.B., Pothirana, S., Wu, H.-J., Kachroo, P. and Klessig, D.F. (2000) Members of the Arabidopsis HRT/RPP8 family of resistance genes confer resistance to both viral and oomycete pathogens. Plant Cell, 12, 663676.
  • Delwiche, P.A. and Williams, P.H. (1979) Screening for resistance to blackleg of crucifers in the seedling stage. Cruciferae Newsl. 4, 24.
  • Denby, K., Kumar, P. and Kliebenstein, D. (2004) Identification of Botrytis cinerea susceptibility loci in Arabidopsis thaliana. Plant J. 38, 473486.
  • Desfeux, C., Clough, S.J. and Bent, A.F. (2000) Female reproductive tissues are the primary target of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123, 895904.
  • Du, Q., Thonberg, H., Wang, J., Whalestedt, C. and Liang, Z. (2005) A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 33, 16711677.
  • Glazebrook, J. and Ausubel, F.M. (1994) Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization of their interactions with bacterial pathogens. Proc. Natl Acad. Sci. USA, 91, 89558959.
  • Gray, W.M., Muskett, P.R., Chuang, H.-W. and Parker, J. (2003) Arabidopsis SGT1b is required for SCFTIR1-mediated auxin response. Plant Cell, 15, 13101319.
  • Gressel, J., Michaeli, D., Kampel, V., Amsellem, Z. and Warshawsky, A. (2002) Ultralow calcium requirements of fungi facilitate use of calcium regulating agents to suppress host calcium-dependent defenses, synergizing infection by a mycoherbicide. J. Agric. Food. Chem. 50, 63536360.
  • Hahn, J. (2005) Regulation of Nod1 by Hsp90 chaperone complex. FEBS Lett. 579, 45134519.
  • Hammond-Kosack, K.E. and Parker, J.E. (2003) Deciphering plant–pathogen communication: fresh perspectives for molecular resistance breeding. Curr. Opin. Biotechnol. 14, 177193.
  • Helliwell, C., Varsha Wesly, S., Wielopolska, A.J. and Waterhouse, P.M. (2002) High-throughput vectors for efficient gene silencing in plants. Funct. Plant Biol. 29, 12171225.
  • Howlett, B. (2004) Current knowledge of the interaction between Brassica napus and Leptosphaeria maculans. Can. J. Plant Pathol. 26, 245252.
  • Howlett, B., Idnurm, A. and Pedras, M.S.C. (2001) Leptosphaeria maculans, the causal agent of blackleg disease of Brassicas. Fungal Genet. Biol. 33, 114.
  • Inohara, N. and Nuñez, G. (2003) NODs: intracellular proteins involved in inflammation and apoptosis. Nat. Rev. Immunol. 3, 371381.
  • Jander, G., Norris, S., Rounsley, S., Bush, D., Levin, I. and Last, R. (2002) Arabidopsis map-based cloning in the post-genome era. Plant Physiol. 129, 440450.
  • Janssens, S. and Beyaert, R. (2002) A universal role for MyD88 in TLR/IL-1R-mediated signaling. Trends Biochem. Sci. 27, 474482.
  • Jordan, T., Schornack, S. and Lahaye, T. (2002) Alternative splicing of transcripts encoding Toll-like plant resistance proteins – what's the functional relevance to innate immunity? Trends Plant Sci. 7, 392398.
  • Kagan, I.A. and Hammerschmidt, R. (2002) Arabidopsis ecotype variability in camalexin production and reaction to infection by Alternaria brassicicola. J. Chem. Ecol. 28, 21212140.
  • Kaneko, Y.H., Inukai, T., Suehiro, N., Natsuaki, T. and Masuta, C. (2004) Fine genetic mapping of the TuNI locus causing systemic veinal necrosis by turnip mosaic virus infection in Arabidopsis thaliana. Theor. Appl. Genet. 110, 3340.
  • Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W. and Hieter, P. (1999) SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol. Cell, 4, 2123.
  • Koch, E. and Slusarenko, A. (1990) Arabidopsis is susceptible to infection by a downy mildew fungus. Plant Cell, 2, 437445.
  • Koornneef, M., Alonso-Blanco, C. and Vreugdenhil, D. (2004) Naturally occurring genetic variation in Arabidopsis thaliana. Annu. Rev. Plant Biol. 55, 142172.
  • Lister, C. and Dean, C. (1993) Recombinant inbred lines for mapping RFLP and phenotypic markers in Arabidopsis thaliana. Plant J. 4, 745750.
  • Liu, Y., Schiff, M., Serino, G., Deng, X.W. and Dinesh-Kumar, S.P. (2002) Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene-mediated resistance response to tobacco mosaic virus. Plant Cell, 14, 14831496.
  • Manly, K.F., Cudmore, R.H. and Meer, J.M. (2001) Map Manager QTX, cross-platform software for genetic mapping. Mamm. Genome, 12, 930932.
  • Mayerhofer, R., Wilde, K., Mayerhofer, M., Lydiate, D., Bansal, V., Good, A. and Parkin, I. (2005) Complexities of chromosome landing in a highly duplicated genome: towards map based cloning of a gene controlling blackleg resistance in Brassica napus. Genetics, 171, 19771988.
  • McDowell, J.M., Dhandayham, M., Long, T., Aarts, M., Goff, S., Holub, E.B. and Dangl, J.L. (1998) Intragenic recombination and diversifying selection contribute to the evolution of downy mildew resistance at the RPP8 locus of Arabidopsis. Plant Cell, 10, 18611874.
  • Mert-Türk, F., Bennett, M.H., Mansfield, J.W. and Holub, E.B. (2003) Camalexin accumulation in Arabidopsis following abiotic elicitation or inoculation with virulent or avirulent Hyaloperonospora parasitica. Physiol. Mol. Plant Pathol. 62, 137145.
  • Meyers, B.C., Morgante, M. and Michelmore, R.W. (2002) TIR-X and TIR-NB proteins: two new families related to disease resistance TIR-NB-LRR proteins encoded in Arabidopsis and other plant genomes. Plant J. 32, 7792.
  • Meyers, B.C., Kozik, A., Griego, A., Kuang, H. and Michelmore, R.W. (2003) Genome-wide analysis of NB-LRR-encoding genes in Arabidopsis. Plant Cell, 15, 809834.
  • Mondragon-Palomino, M., Meyers, B.C., Michelmore, R.W. and Gaut, B.S. (2002) Patterns of positive selection in the NBS-LRR gene family of Arabidopsis thaliana. Genome Res. 12, 13051315.
  • Nimchuk, Z., Eulgem, T., Holt, B.F., III and Dangl, J.L. (2003) Recognition and response in the plant immune system. Annu. Rev. Genet. 37, 579609.
  • Parker, J., Szabo, V., Staskawicz, B., Lister, C., Dean, C., Daniels, M. and Jones, J. (1993) Phenotypic characterization and molecular mapping of the Arabidopsis thaliana locus RPP5 determining resistance to Peronospora parasitica. Plant J. 4, 821831.
  • Parker, J.E., Coleman, M.J., Szabò, V., Frost, L.N., Schmidt, R., van der Biezen, E.A., Moores, T., Dean, C., Daniels, M.J. and Jones, J.D.G. (1997) The Arabidopsis downy mildew resistance gene RPP5 shares similarities to the Toll and Interleukin-1 receptors with N and L6. Plant Cell, 9, 879894.
  • Richly, E., Kurth, J. and Leister, D. (2002) Mode of amplification and reorganization of resistance genes during recent Arabidopsis thaliana evolution. Mol. Biol. Evol. 19, 7684.
  • Roetschi, A., Azeddine, S., Lassaâd, B., Mauch, F. and Mauch-Mani, B. (2001) Characterization of an Arabidopsis–Phytophthora pathosystem: resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signaling. Plant J. 28, 293305.
  • Rouxel, T. and Balesdent, M.H. (2005) The stem canker (blackleg) fungus, Leptosphaeria maculans, enters the genomic era. Mol. Plant Pathol. 6, 225241.
  • Schmid, K., Rosleff Sörensen, T., Stracke, R., Törjék, O., Altmann, T., Mitchell-Olds, T. and Weisshaar, B. (2003) Large-scale identification and analysis of genome-wide single-nucleotide polymorphisms for mapping in Arabidopsis thaliana. Genome Res. 13, 12501257.
  • Shirasu, K. and Schulze-Lefert, P. (2003) Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways. Trends Plant Sci. 8, 252258.
  • Sinapidou, E., Williams, K., Nott, L., Bahkt, S., Tor, M., Crute, I., Bittner-Eddy, P. and Beynon, J. (2004) Two TIR:NB:LRR genes are required to specify resistance to Peronospora parasitica isolate Cala2 in Arabidopsis. Plant J. 38, 898909.
  • Takahashi, A., Casais, C., Ichimura, K. and Shirasu, K. (2003) HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl Acad. Sci. USA, 100, 1177711782.
  • Thomma, B., Eggermont, K., Penninckx, I., Mauch-Mani, B., Vogelsang, R., Cammue, B.P.A. and Broekaert, W.F. (1998) Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl Acad. Sci. USA, 95, 1510715111.
  • Tiryaki, I. and Staswick, P. (2002) An Arabidopsis mutant defective in jasmonate response is allelic to the auxin-signaling mutant axr1. Plant Physiol. 130, 887894.
  • Tör, M., Gordon, P., Cuzick, A., Eulgem, T., Inapidou, E., Mert-Türk, F., Can, C., Dangl, J.L. and Holub, E.B. (2002) Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes. Plant Cell, 14, 9931003.
  • Veronese, P., Chen, X., Bluhm, B., Salmeron, J., Dietrich, R. and Mengiste, T. (2004) The BOS loci of Arabidopsis are required for resistance to Botrytis cinerea infection. Plant J. 40, 558574.
  • Vogel, J. and Somerville, S.C. (2000) Isolation and characterization of powdery mildew-resistant Arabidopsis mutants. Proc. Natl Acad. Sci. USA, 97, 18971902.
  • Wang, S., Basten, C.J. and Zeng, Z.B. (2004) Windows QTL Cartographer 2.0. Raleigh, NC: Department of Statistics, North Carolina State University.
  • West, J.S., Kharbanda, P.D., Barbetti, M.J. and Fitt, B.D.L. (2001) Epidemiology and management of Leptosphaeria maculans (Phoma stem canker) on oilseed rape in Australia, Canada and Europe. Plant Pathol. 50, 1027.
  • Yu, F., Lydiate, D.J. and Rimmer, S.R. (2005) Identification of two novel genes for blackleg resistance in Brassica napus. Theor. Appl. Genet. 110, 969979.
  • Zhang, X. and Gassmann, W. (2003) RPS4-mediated disease resistance requires the combined presence of RPS4 transcripts with full-length and truncated open reading frames. Plant Cell, 15, 23332342.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Figure S1. Quantitative description of disease progression in susceptible Col × Ler RI lines based on observations from 7 to 17 individual plants per line.

Table S1. Qualitative description of different disease phenotypes observed on susceptible Col × Ler RI lines, based on observations from 7 to 17 individual plants per line

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
TPJ_2688_sm_FigureS1.doc41KSupporting info item
TPJ_2688_sm_TableS1.doc40KSupporting info item

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.