SEARCH

SEARCH BY CITATION

Keywords:

  • sucrose transporter;
  • functional characterization;
  • facilitator;
  • symporter;
  • seed coat

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

A suite of newly discovered sucrose transporter genes, PsSUF1, PsSUF4, PvSUT1 and PvSUF1, were isolated from the coats of developing pea (Pisum sativum L.) and bean (Phaseolus vulgaris L.) seeds. Sequence analysis indicated that deduced proteins encoded by PsSUF1, PvSUT1 and PvSUF1 clustered in a separate sub-group under sucrose transporter Clade  I, whereas the deduced protein encoded by PsSUF4 clustered in Clade  II. When expressed in yeast, these genes were shown to encode sucrose transporters with apparent Michaelis Menten constant (Km) values ranging from 8.9 to 99.8 mm. PvSUT1 exhibited functional characteristics of a sucrose/H+ symporter. In contrast, PsSUF1, PvSUF1 and PsSUF4 supported the pH- and energy independent transport of sucrose that was shown to be bi-directional. These transport properties, together with that of counter transport, indicated that PsSUF1, PvSUF1 and PsSUF4 function as carriers that support the facilitated diffusion of sucrose. Carrier function was unaffected by diethylpyrocarbonate and by maltose competition, suggesting that the sucrose binding sites of these transporters differed from those of known sucrose/H+ symporters. All sucrose transporters were expressed throughout the plant and, of greatest interest, were co-expressed in cells considered responsible for sucrose efflux from seed coats. The possible roles played by the novel facilitators in sucrose efflux from seed coats are discussed.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bulk flow of nutrients to heterotrophic sinks primarily occurs in the phloem, and is driven by hydrostatic pressure differences between sources and sinks generated in turn by osmotic differences resulting from nutrient loading (source) and unloading (sink) of the phloem. This leads to the concept that loading and unloading determine the rates of nutrient transport through the phloem, whereas the relative rates of phloem unloading governs the partitioning of nutrients between competing sinks and, as a result, crop yield (Patrick, 1997). In most crop plants, nutrients are loaded into the phloem across cell membranes, but unloading commonly by-passes membrane transport through symplasmic routes (Williams et al., 2000). However, unloading of nutrients from the phloem occurs across cell membranes in a number of physiologically important sinks. These include biotrophic relationships, organs that accumulate osmotically active nutrients to high concentrations and developing seeds (Patrick, 1997). Sucrose is a major osmotic constituent of phloem sap. Hence phloem loading and unloading of sucrose would be expected to exert considerable influence over transport rates and partitioning of phloem-transported nutrients. For instance, phloem transport is dramatically slowed when sucrose symporter (SUT) activity, responsible for phloem loading, is down-regulated by either reverse genetics or gene knockout (Williams et al., 2000). Less certain is the physiological significance of sucrose unloading on phloem transport. Activity of a potato sucrose transporter (StSUT1), localized to sieve elements, was shown to influence potato tuber growth during the early stages of tuber development (Kühn et al., 2003) where unloading occurs across phloem membranes (Viola et al., 2001). However, a lack of experimental accessibility to membrane transport events in potato tubers prevents an unambiguous determination of whether StSUT1 functions to either directly (cf. Carpaneto et al., 2005) or indirectly influence phloem unloading. In contrast, developing seeds offer a well-defined and experimentally tractable model to examine membrane transport events involved in phloem unloading (Patrick and Offler, 2001).

All nutrients, including sucrose, are loaded into filial generations of developing seeds by two plasma-membrane transport steps arranged in series between the symplasmically isolated maternal and filial seed tissues. Sucrose released from maternal tissues is retrieved from the seed apoplasmic space by outer cell layers of filial tissues (endosperm/embryo) proximal to their maternal counterparts. Sucrose influx across plasma membranes of filial transport cells is mediated by sucrose/H+ symport (Patrick and Offler, 2001). Genes encoding sucrose/H+ symporters have been cloned and functionally characterized from developing seeds of monocots (e.g. Weschke et al., 2000) and dicots (e.g. Aldape et al., 2003; Gahrtz et al., 1996; Meyer et al., 2004; Tegeder et al., 1999; Weber et al., 1997). Symporter activity, located in filial cells, plays a significant physiological role in determining rates of sucrose loading and biomass gain by developing seeds of grain legumes (Rosche et al., 2002; Tegeder et al., 2000) and cereals (Scofield et al., 2002). Less is known about the transport mechanisms of, and membrane proteins responsible for, sucrose release from maternal seed tissues. Most progress has been made using large-seeded grain legumes such as bean and pea. For these seeds the absence of any anatomical connection between maternal and filial tissues has allowed simple surgical separation of the two generations, and hence the unambiguous and independent study of nutrient release (Patrick and Offler, 2001).

Physiological studies of whole coats of pea seeds concluded that the release of sucrose and other nutrients occurs through non-selective pores (van Dongen et al., 2001; de Jong et al., 1996). In contrast, for seeds of broad (Fieuw and Patrick, 1993) and French (Walker et al., 1995) beans, some 50% of the sucrose released was energy coupled and exhibited transport behaviour consistent with sucrose/H+ antiport. In apposition to their sucrose release function, seed coats of these species express putative sucrose symporter genes (Tegeder et al., 1999, 2000; Weber et al., 1997). However, symporter transport activity appears to be either absent from seed coats of pea (de Jong et al., 1996; cf. de Jong and Borstlap, 2000) or is significantly attenuated in coats of developing seeds of both broad and French bean (Ritchie et al., 2003). This phenomenon is widespread throughout flowering plants, as suggested by similar findings reported for the maternal tissues of developing grains of wheat (Bagnall et al., 2000), barley (Weschke et al., 2000) and rice (Furbank et al., 2001). At least for developing bean seeds, gradients of sucrose and proton motive force (pmf) across their plasma membranes (Walker et al., 1995) indicate that it is unlikely that sucrose/H+ symport can function as a release mechanism (cf. Carpaneto et al., 2005; and for further information, see the Discussion). Therefore, we speculated that the sucrose symporter paralogs, detected in maternal seed tissues (see above), may function to facilitate sucrose release by either uniport (van Dongen et al., 2001; de Jong et al., 1996; Ritchie et al., 2003) or less likely by proton antiport (Fieuw and Patrick, 1993; Walker et al., 1995). This claim is supported by the finding that only subtle differences in amino acid sequences can exist between facilitators and proton-coupled transporters in the Major Facilitator Superfamily (Pao et al., 1998).

We report a study in which sucrose symporter paralogs were cloned from seed coats of pea (putative sucrose uniporter, van Dongen et al., 2001; de Jong et al., 1996) and French bean (putative sucrose antiporter, Walker et al., 1995; and sucrose uniporter, Ritchie et al., 2003). In the absence of a functional screen for sucrose antiporters, cloned cDNAs of putative sucrose transporters were tested for their ability to complement a yeast mutant capable of sucrose synthesis by an introduced sucrose synthase gene (SUY7/ura3 - Barker et al., 2000; Riesmeier et al., 1992). Transport properties of these sucrose transporters were characterized in SUSY7/ura3. The transport data were supplemented with observations of spatial expression of the sucrose transporter genes at organ and cell levels. Possible release functions of these symporter paralogs are discussed with particular reference to their role in sucrose unloading from seed coats.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Isolation of sucrose transporter cDNAs

Novel sucrose transporter genes were cloned from the seed coats of pea and bean by degenerate PCR using primers corresponding to two conserved regions of all known SUTs, GVQFGWA and DTDWMGK (Lalonde et al., 2004). An expected fragment of 800 bp was amplified and 40 degenerate PCR clones were sequenced. Six sucrose transporter genes were identified, three from each of pea and bean seed coats. For pea seed coats, the three genes included the previously identified, but functionally uncharacterized, PsSUT1 (Tegeder et al., 1999). Four new genes were isolated in full length by 3′ and 5′ rapid amplification of cDNA ends (RACE) PCR. For each gene, the absence of PCR-introduced mutations was verified by obtaining identical sequences from five independent clones.

Sequence analysis showed that the predicted proteins of the new genes bear all the hallmarks of the SUT family (Figure 1). These include the presence of 12 transmembrane domains and two copies of RXGR motifs, one in loop II/III and one in loop VIII/IX extended as [M/T]-[S]-x(2)-[V/M]-[E]-x-[L]-[G/C]-[R]-x(3)-[G/A] (Figure 1 and see Lemoine, 2000).

image

Figure 1.  Comparison of the predicted amino acid sequences from PsSUF1, PsSUF4, PvSUT1 and PvSUF1 genes. Sequence alignment was performed by ClustalW algorithm. Black shading indicates identical residues and grey shading conserved residues. Transmembrane domains (TM) were predicted by the hidden Markov model. Annotated are TM domains, two R-X-G-R boxes (<<< with one extended as [MT]-[S]-x(2)-[V/M]-[E]-x-[L]-[G/C]-[R]-x(3)-[G/A]), C-termini phosphorylation sites (>>>), SQ/TQ-like motif (∧∧∧) and residues described in the text (*).

Download figure to PowerPoint

The existing nomenclature of SUTs neither rigorously reflects their phylogenetic relationships nor their transport functions. In this context, we adopted the preliminary measure of naming the newly discovered sucrose transporters following the clade system described by Lalonde et al. (2004). In addition, as all characterized SUTs/sucrose carriers (SUCs) function as sucrose/H+ symporters (Lalonde et al., 2004), the acronym of SUT was reserved for this function. This allows distinction from the newly discovered sucrose facilitators (SUFs; and see functional characterization of the transporters described later). Phylogenetic analysis revealed that one sucrose transporter, PsSUF4, was grouped in Clade  II and was most closely related to the Lotus japonicus homolog, LjSUT4 (Genbank acc. AJ538041), with 73% identity at the amino acid level (Figure 2). The remaining sucrose transporters are clustered under Clade  I (Figure 2), which contains SUT1s (Lalonde et al., 2004). These were PsSUF1 from pea, and PvSUT1 and PvSUF1 from bean seed coats. The nomenclature reflects their transport function as either symporters (SUT) or facilitators (SUF) and a phylogenetic clustering in Clade  I with known SUT1s (Figure 2). A partial sequence of another sucrose transporter, putatively PvSUT3, was also clustered in Clade  I. However, PvSUT3 was excluded from ongoing study because RT-PCR expression analyses demonstrated that its transcript was localized to flowers (data not shown). PsSUF1, PvSUT1 and PvSUF1 transporters grouped together outside the previously known Fabaceae SUT1 branch containing PsSUT1, GmSUT1 and VfSUT1 (see Figure 2). For instance, pea PsSUF1 is more closely related to bean PvSUF1 than its pea paralog, PsSUT1 (Figure 2). Thus a functional difference may exist between these two pea sucrose transporter paralogs and indeed the two sub-groups of Clade  I.

image

Figure 2.  Phylogenetic analysis of PsSUF1, PsSUF4, PvSUT1 and PvSUF1 in relation to other sucrose transporters. The tree was constructed based on maximum likelihood method using a program, TREE-PUZZLE5 (Schmidt et al., 2002). The branch length was computed using the JTT model with rate heterogeneity (Jones et al., 1992). The bar denotes the fraction of expected changes of amino acids described in the model. All sucrose transporter members are light-shaded into three Clades, Clade I–III with PsSUF1, PsSUF4, PvSUT1, PvSUF1 and the sucrose transporters from the legume family highlighted in dark shading. All sequences were obtained from NCBI (http://www.ncbi.nlm.nih.gov). Asarina barclaina: AbSUT1 (AF191024); Apium graveolens: AgSUT1 (AF063400); Alonsoa meridionalis: AmSUT1 (AF191025); Arabidopsis thaliana: AtSUC1 (At1g71880), AtSUC2 (At1g22710), AtSUC3(At2g02860), AtSUT4 (At1g09960), AtSUC5 (At1g71890), AtSUC6 (At5g43610), AtSUC7 (At1g66570), AtSUC8 (At2g14670) and AtSUC9 (At5g06170); Brassica oleracea: BoSUT1 (DQ020217), BoSUC2 (AY065840); Beta vulgaris: BvSUT1 (X83850); Citrus sinensis: CsSUT1 (AY098891), CsSUT2 (AY098894); Daucus carota: DcSUT2 (Y16768); DcSUT1 (Y16767); Euphorbia esula: EeSUT1 (AF242307); Glycine max: GmSUT1 (AJ563364); Hordeum vulgaris: HvSUT1 (AJ272309), HvSUT2 (AJ272308); Lycopersicon esculentum: LeSUT1 (X82275), LeSUT2 (AF166498), LeSUT4 (AF176950); Lotus japonicus: LjSUT4 (AJ538041); Nicotiana tabacum: NtSUT1 (X82276), NtSUT3 (AF149981); Oryza sativa: OsSUT1 (D87819), OsSUT2 (AY137242), OsSUT4(AB091673); Plantago major: PmSUC1 (X84379), PmSUC2 (X75764), PmSUC3 (AJ534442); Pisum sativum: PsSUT1 (AF109922); Ricinus communis: RcSCR1 (Z31561); Spinacia oleracea SoS21 (X67125); Solanum tuberosum: StSUT1 (X69165), StSUT2 (AY291289), StSUT4 (AF237780); Triticum aestivum: TaSUT1a (AF408842), TaSUT1b (AF408843), TaSUT1c (AF408844), TaSUT1d (AF408845); Vicia faba: VfSUT1 (Z93774); Vitis vinifera; VvSUC2 (AF439321), VvSUC27 (AF021810), VvSUC11 (AF021808), VvSUV12 (AF021809); Zea mays: ZmSUT1 (AB008464).

Download figure to PowerPoint

Sequence comparisons with all SUTs available in Genbank detected a number of major differences for the new Clade-I sub-group (Figure 2). These were as follows (see asterisks in Figure 1, unless otherwise stated): (1) the proline, conserved in loop VIII/IX of all known Clade-III/SUT2 members, was conserved across PsSUF1, PvSUT1 and PvSUF1; (2) the uncharged hydrophobic residue, comprising a leucine/isoleucine/valine in transmembrane domain (TM) X of most SUTs, was substituted by a phenylalanine; (3) three of the four cysteines conserved in SUTs (Lemoine, 2000) were detected in PsSUF1 and PvSUF1, with the fourth cysteine, conserved in loop TM  II/TM  III, replaced by either a serine or an asparagine; (4) unique substitutions were detected in PsSUF1, compared with all other SUTs – a methionine (loop V/VI) replaced either the positively charged lysine or histidine, an asparagine replaced the tyrosine/phenylalanine/leucine in TM  II and another asparagine replaced either the positively charged lysine or arginine in the central loop; 5) in contrast to SUT1 from Clade I, a predicted protein kinase C phosphorylation site at the C-termini, conserved in most Clade III (SUT2) and Clade II (SUT4) members, was present in PsSUF1, PvSUF1 and PvSUT1 (Figure 1, indicated as >>>); 6) a SQ/TQ-like motif, Ser-Glu-Ser-Glu-Thr-Glu-Thr-Glu-Thr-Glu-Ser sequence located in the central cytoplasmic loop (loop VI/VII) of PsSUF1 (Figure 1, indicated as ∧∧∧). The SQ/TQ motif is considered to be a signature characteristic of DNA-dependent protein kinases that function as protein-protein interaction modules (e.g. Traven and Heierhorst, 2005).

Functional characterization of SUTs expressed in yeast

The cDNA of each sucrose transporter was cloned into a yeast vector (pDR196) and transformed into the yeast strain SUSY7/ura3, a complementation system for SUTs (Barker et al., 2000; Riesmeier et al., 1992). For each gene, six independent colonies were tested for complementation on sucrose plates. Compared to yeast transformed with empty vector pDR196 alone, expression of PsSUT1 and PvSUT1 allowed growth on a medium containing 2% sucrose as the sole carbon source (see representative growth of a single colony, each expressing a sucrose transporter, in Figure 3a). In contrast, verified incorporated sequences of PsSUF1, PsSUF4 and PvSUF1 (Figure 1 and for more details, see Experimental procedures) did not rescue SUSY7/ura3 on a 2% sucrose medium traditionally used for yeast complementation (e.g. Riesmeier et al., 1992; Weise et al., 2000). Interestingly, when medium sucrose concentration was raised to 4%, SUSY7/ura3 transformed with PsSUF1, PsSUF4 and PvSUF1 exhibited superior growth compared with the empty pDR196 vector (Figure 3b). This finding could prove to be a valuable modification in refining a functional screening system for low affinity sucrose transporters (see apparent Km values reported in Figure 4e,f).

image

Figure 3.  Rescue of yeast strain SUSY/ura3 transformed with specific SUT/SUFs on sucrose as the sole carbon source. (a) PsSUT1 and PvSUT1 supported cell growth on 2% sucrose. (b) PsSUF1, PsSUF4 and PvSUF1 supported cell growth on 4% sucrose. pDR196 is the empty vector. Single colonies, containing each sucrose transporter gene, were streaked onto sections of sucrose plates (ura) followed by incubation at 30°C and observed after 10 days.

Download figure to PowerPoint

image

Figure 4.  Characterization of sucrose transport function of SUT/SUFs, cloned from pea (a, c, e, g) and French bean (b, d, f, h), and expressed in yeast. (a–d) Time course for uptake from a 0.2 mm [14C]sucrose solution pH 5.5 (solid line, closed symbols) and by cells preloaded with 50 mm sucrose (broken line, open symbols). (e, f) Concentration-dependent uptake at pH 4.5. Inserted tables display apparent Km values. (g, h) pH dependent uptake from a 1 mm sucrose solution. Values are means ± SEs of at least 6 replicates per treatment. All experiments were energised with 10 mm glucose added 1 min prior to treatment, with the exception of PvSUF1, which was energised with 100 mm ethanol. (a, c, e, g) bsl00001– PsSUT1; bsl00066– PsSUF1; bsl00063– PsSUF4; ×– pDR196. (b, d, f, h) bsl00001– PvSUT1; bsl00066– PvSUF1; ×– pDR196.

Download figure to PowerPoint

Time course studies of [14C]sucrose uptake by SUSY7/ura3 yeast, expressing PsSUT1, PsSUF1, PsSUF4, PvSUT1 or PvSUF1, showed that each transporter conferred higher rates of sucrose uptake than those cells transformed with empty vector alone (Figure 4a–d and note solid lines). These findings demonstrate that the new sucrose transporter genes, and the previously isolated PsSUT1 (Tegeder et al., 1999), encode functional sucrose transporters. Each transporter supported constant rates of [14C]sucrose uptake over the first four min of exposure to [14C]sucrose. These rates are commensurate with those supported by SUTs from other legume species including VfSUT1 (Weber et al., 1997) and GmSUT1 (Aldape et al., 2003). Thereafter, for PsSUF1, PsSUF4 and PvSUF1, uptake slowed between 6 and 10 min (Figure 4c,d). In contrast, uptake remained constant across the 10-min period for PsSUT1 and PvSUT1 (Figure 4a,b). Thus, all subsequent uptake experiments were conducted over a 4-min period following exposure to [14C]sucrose.

Concentration-dependent uptake of [14C]sucrose by transformed yeast demonstrated that all sucrose transporters exhibited saturating transport kinetics typical of a carrier function (Figure 4e,f). These sucrose uptake data were fitted by Eadie-Hofstee transformations to obtain estimates of apparent Km values that differed markedly between the two Clade I sub-groups (cf. Figure 2). Values obtained for the proposed new Clade I sub-group members were 5.5- (PvSUT1) to 66-(PsSUF1) fold higher than those found for PsSUT1 (Figure 4e,f). In addition, PsSUF4 exhibited an apparent Km value 4-fold larger than those reported for AtSUT4 and StSUT4 (Figure 4e and cf. Weise et al., 2000).

To determine whether sucrose was accumulated against its concentration gradient, comparisons were made between external (C0) and internal (Ci) sucrose concentrations. Assuming that 108S. cerevisiae cells have an intracellular volume of 5 μl (cf. Cirillo, 1989), internal sucrose concentrations were estimated from levels of [14C]sucrose accumulated after 10 min (6 min for PsSUF4 and see Figure 4a–d noting that 98 ± 1% of the accumulated 14C-label remained as [14C]sucrose). At a Co of 0.2 mm sucrose, SUSY7/ura3 cells expressing PsSUT1 and PvSUT1 achieved Ci/Co ratios in excess of one (Table 1a). This outcome indicates that sucrose was accumulated above its external concentration. In contrast, PsSUF1, PsSUF4 and PvSUF1 supported Ci/Co ratios approximating one, showing that equilibria between internal and external sucrose concentrations were reached by 10 min or earlier (Table 1a and cf. Figure 4c,d noting solid lines). The mitochondrial electron transport inhibitor, antimycin A, significantly inhibited [14C]sucrose transport by PsSUT1 and PvSUT1 (Table 1b) whereas PsSUF1, PsSUF4 and PvSUF1 transport functions were unaffected (Table 1b).

Table 1.   Sucrose concentration ratios, relative rates of sucrose efflux and effects of inhibitors and competing sugars on sucrose uptake by pea and bean sucrose transporter genes expressed in SUSY7/ura3 yeast
TreatmentPsSUT1PsSUF1PsSUF4PvSUT1PvSUF1
  1. Cells were energised by adding 100 mm ethanol 1 min prior to addition of inhibitors (n = 8 from three independent experiments) or sugars (n = 6 from at least two independent experiments). Control transport rates (nmol per 108 cells min−1) for inhibitor and sugar competition studies were: PsSUT1 – 1.046 ± 0.060, PsSUF1 – 0.882 ± 0.054, PsSUF4 – 0.938 ± 0.029, PvSUT1 – 3.212 ± 0.320, PvSUF1 – 1.038 ± 0.069.

  2. Sucrose concentrations (mm) in preloaded cells prior to efflux were: PsSUT1 – 0.452 ± 0.025, PsSUF1 – 0.145 ± 0.011, PsSUF4 – 0.124 ± 0.007, PvSUT1 – 1.320 ± 0.031, PvSUF1 – 0.163 ± 0.013, pDR196 – 0.049 ± 0.009. Control empty vector (pDR196) cells retained 88% of preloaded sucrose.

  3. aEstimated Ci/Co values for sucrose after 10 min (6 min for PsSUT4) of uptake from a 0.2 mm sucrose solution, pH 5.5. Ci, internal sucrose concentration; Co, external sucrose concentration.

  4. bPercent changes in sucrose uptake rates from a 1 mm [14C]sucrose solution pH 4.5, in the presence of specified inhibitors.

  5. cPercent [14C]sucrose remaining in cells, preloaded from a 0.2 mm [14C]sucrose solution pH 4.5 for 10 min, after washing for 10 min in buffer alone.

  6. dPercent changes in sucrose uptake rates from a 1 mm [14C] sucrose solution pH 4.5, in the presence of 10 mm competing sugars.

  7. *Significance at P < 0.05.

Estimated Ci/Co ratioa  1.81  1.03  0.73  8.28  1.18
Inhibitor (% control)b
 10 μm Antimycin A 40*110110 66* 94
 50 μm CCCP 69*105 92 39*102
 1.5 mm DEPC 29*106 92 59*100
Sucrose remaining (% of preloaded 14C)c 92 52* 39* 90 42*
Competing sugar (% control)d
 10 mm glucose127*103 95124* 59*
 10 mm fructose128* 98 86137* 66*
 10 mm maltose 72*102 90 58* 94
 10 mm mannitol 96111 97 95 90
 10 mm raffinose101104104 93 91
 10 mm palatinose 99100 88 98 70*

The prospect of sucrose transport utilizing an ATPase-generated H+ gradient was explored by manipulating the pmf with the protonophore, carbonyl cyanide (CCCP). Treatment with CCCP led to a significant inhibition of [14C]sucrose transport by PsSUT1 and PvSUT1 but had no effect on PsSUF1, PsSUF4 or PvSUF1 (Table 1b). PsSUT1 and PvSUT1 transport activities were strongly pH dependent as shown by progressive increased rates of sucrose uptake when media pH was decreased below 6.0 (Figure 4g) and 8.0 (Figure 4h) respectively. PvSUT1 exhibited a distinct pH optimum at pH 5.0. In contrast, rates of sucrose transport mediated by PsSUF1, PsSUF4, and PvSUF1 were independent of medium pH (Figure 4g,h). Collectively, these data demonstrate that an inward-directed pmf across the yeast plasma membrane is required only for sucrose uptake by PsSUT1 and PvSUT1. As an added marker for sucrose/H+ symporter function (Lalonde et al., 2004), sucrose transporter-transformed yeast was treated with diethylpyrocarbonate (DEPC) which inhibits sucrose/H+ symporter activity by binding with the highly conserved histidine-65 (Lemoine, 2000; Lu and Bush, 1998). PsSUT1 and PvSUT1 were the only transporters that displayed DEPC inhibition of their transport activity (Table 1b).

To test whether the newly-discovered sucrose tranporters supported sucrose efflux, relative amounts of [14C] sucrose lost from [14C]sucrose preloaded yeast cells were determined following a 10-min wash in buffer (Table 1c and noting that 98 ± 1% of the accumulated 14C-label remained as [14C]sucrose). These data demonstrate that PsSUF1, PsSUF4 and PvSUF1 support high rates of sucrose efflux in comparison to the proton symporters, PsSUT1 and PvSUT1. The latter rates of efflux corresponded to those found for yeast cells transformed with empty vector alone (Table 1 caption). The strongest evidence that substrate influx (cf. Figure 4e,f) and efflux are carrier- and not channel-mediated is that, for a carrier, substrate efflux temporarily drives influx against the substrate's electrochemical gradient – a phenomenon referred to as counter transport (Stein, 1986). To test this proposition, transformed yeast cells were preloaded with a high (50 mm) concentration of [12C]sucrose prior to resuspending them in a 0.2 mm [14C] sucrose medium. Under these conditions, if the expressed sucrose transporter functions as a carrier, a transient unidirectional influx of [14C]sucrose will result by counter-transport until equilibrium between [12C] and [14C]sucrose is restored. Consistent with this model, yeast cells expressing PsSUF1, PsSUF4 or PvSUF1, exhibited transient higher uptake rates of [14C]sucrose at two min compared to those exposed to a preload solution containing an equimolar concentration of non-permeating sorbitol. This difference in influx was dissipated by 4 to 10 min (Figure 4c,d noting broken lines). In contrast, a transient burst in [14C]sucrose uptake was not detected for sucrose preloaded cells transformed with PsSUT1 or PvSUT1 (Figure 4a,b noting broken lines).

Substrate specificity of each transporter was determined by sucrose uptake in the presence of selected sugar species supplied at 10x greater concentration. Among tested sugars, maltose inhibited [14C]sucrose uptake mediated by PsSUT1 and PvSUT1 (Table 1d). Glucose and fructose stimulated sucrose uptake by PsSUT1 and PvSUT1, but interestingly these sugars and palatinose competed with sucrose for PvSUF1 (Table 1d). The latter observation is the subject of a separate investigation.

Expression analysis of sucrose transporters in pea and bean

Similar to expression of VfSUT1 (Weber et al., 1997) and PsSUT1 (Tegeder et al., 1999), transcripts of the newly discovered sucrose transporters were detected in all plant organs including source leaves, sink leaves, flowers, stem, roots, cotyledons and seed coats (Figure 5). The most marked features of the organ expression profiles were that PsSUF4 (Figure 5b) was expressed equally in all tissues including seed coats and cotyledons. In contrast, the remaining sucrose transporter genes exhibited organ specific expression. Thus PsSUF1 (Figure 5b) exhibited strongest expression in cotyledons with transcript levels some 3- to 4-fold greater than those detected in seed coats and roots with relatively low levels of expression in the remaining organs. In bean, PvSUF1 expressed most strongly in vegetative tissues (Figure 5a), particularly source leaves and stems, with low levels of expression detected in seed coats and cotyledons. This pattern contrasted with PvSUT1 (Figure 5a) that exhibited strongest expression in seed coats and weakest by three-fold in cotyledons, source leaves and roots. Overall, PsSUF1 and PvSUT1 showed the greatest seed specificity with PsSUF1 and PvSUT1 expression strongest in cotyledons and coats of developing pea and bean seeds respectively.

image

Figure 5.  Expression pattern of specified SUT/SUF in plant organs. (a) PvSUT1 (bsl00001) and PvSUF1 (□) in specified organs of bean. (b) PsSUF1 (bsl00001) and PsSUF4 (□) in specified organs of pea. Relative expression, by semi-quantitative RT-PCR, of each sucrose transporter normalized to expression of bean and pea actin genes. Values are the means ± SE from three separate RNA extractions. ScL, source leaves; SkL, sink leaves; Fl, flower; St, stem; Rt, root; SC, seed coats; Cot, cotyledons.

Download figure to PowerPoint

Cellular localization of transcript was examined in bean and pea seed coats by hybridizing tissue sections (1 μm thick) with DIG-labelled RNA probes specific to each gene. For bean seed coats, PvSUT1 and PvSUF1 were localized to vascular bundles, ground and branch parenchyma cells (Figure 6b,c,e cf. a, d). In contrast, PsSUT1, PsSUF1 and PsSUF4 transcripts were localized to all coat tissues except the palisade and hypodermis (Figure 6f cf. g–i). In the thin-walled parenchyma and thin-walled parenchyma transfer cells the signal was located around the periphery of the cells, consistent with the highly vacuolated nature of these cell types (Patrick and Offler, 2001). Comparison of signal in these two tissues suggests stronger expression in the thin-walled parenchyma transfer cells bordering the seed coat/cotyledon interface. The apparently stronger signal in the chlorenchyma probably reflects their denser cytoplasm.

image

Figure 6.  Cellular localization of SUT/SUF transcripts in seed coats of bean and pea. Light micrographs illustrating in-situ hybridization of DIG-labelled sucrose transporter sense (a, d, f) and anti-sense (b, c, e, g–i) riboprobes to coat transverse sections of developing seeds. (a–e) Bean seed coat sections treated with riboprobes to PvSUF1 (a, b, d, e) and PvSUT1 (c). Signal is localized in vascular, ground parenchyma inward of the vascular bundles and branch parenchyma tissues. (f–i) Pea seed coat sections treated with riboprobes to PsSUT1 (f, g), PsSUF1 (h) and PsSUF4 (i). Signal for all three genes occurs in all tissues except the palisade and hypodermis (g–i cf. f). Bar = 37.5 μm (a–c, f–i). Bar = 150 μm (d, e). bp, branch parenchyma; c, chlorenchyma; gp, ground parenchyma; h, hypodermis; p, palisade; tc, thin-walled parenchyma transfer cells; tp, thin-walled parenchyma; vb, vascular bundle.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Transporters responsible for high rates of sucrose efflux at sites of apo-/symplasmic exchange, such as phloem loading and biotrophic interfaces, have not been identified (Lalonde et al., 2004). Coats of developing seeds are functionally committed to secrete sucrose into the seed apoplasm at high fluxes to meet a carbohydrate demand of the growing embryo (Patrick and Offler, 2001) and thus could be enriched in sucrose effluxers. Hence, we attempted to clone putative sucrose effluxers from legume seed coats based on a presumed conserved homolog with known SUTs. This led to the discovery of a suite of new sucrose transporters that clustered in Clade I (PsSUF1; PvSUT1 and PvSUF1) and Clade II (PsSUF4) with the new Clade I members forming a distinct phylogenetic sub-group (Figure 2). The new sucrose transporters exhibited molecular structures and transport properties not previously reported. The transport properties of some of these, which function as facilitators, may contribute to sucrose secretion from legume seed coats. These issues are discussed in turn below.

Structures and transport properties of pea and bean sucrose transporters

To date all characterized sucrose transporters function as proton symporters (Lalonde et al., 2004). In this context, our most novel finding is that PsSUF1, PsSUF4 and PvSUF1, when expressed in yeast, exhibited transport properties consistent with facilitated diffusion. In contrast to features of proton-coupled symport displayed by PsSUT1 and PvSUT1, sucrose transport mediated by these transporters was unaffected by CCCP (Table 1b) and was pH independent (Figure 4g,h). These behaviours demonstrate that their sucrose transport functions are not proton coupled and contrast with ‘neutral’ transporters (PmSUC1 in Plantago major L. and AtSUC1 in Arabidopsis). The latter are inhibited by metabolic uncouplers and are pH insensitive between 4 and 6 but sensitive at more alkaline pHs (Gahrtz et al., 1996). Involvement of secondary active transport coupled with any ion moving down its electrochemical gradient or direct energization by ATP hydrolysis (primary active transport) were deemed unlikely. This claim is supported by the observation that SUF transport rates were unaffected when ATP generation was blocked by antimycin A (Table 1b). Further evidence that these transporters function as sucrose facilitators is that the intracellular sucrose concentrations of yeast cells, expressing these transporters, equilibrated with the external concentration (Table 1a) and supported high rates of sucrose efflux (Table 1c). In contrast, proton-coupled sucrose transport mediated by PsSUT1 and PvSUT1 supported accumulation of intracellular sucrose levels above their external concentrations (Table 1a) and coupling of transport to the vectorial pmf mitigated against sucrose efflux from [14C]sucrose preloaded cells (Table 1c). However, the present study can not exclude the possibility that the observed sucrose facilitator function of PsSUF1, PsSUF4 and PvSUF1 can be replaced by proton symport at more negative membrane potentials than found in yeast at pH 4.5 (−50 mV and see Boxman et al., 1984). This issue will be resolved by voltage clamp studies using Xenopus oocytes expressing the transporter proteins.

The most compelling evidence that PsSUF1, PsSUF4 and PvSUF1 function as facilitative carriers and not channels is that yeast cells, transformed with these SUTs, exhibited counter-transport (Figure 4c,d noting broken lines and cf. Stein, 1986). Interestingly, counter transport was not detected in yeast cells transformed with the sucrose symporters, PsSUT1 and PvSUT1 (Figure 4a,b). This is most likely attributable to the experimentally imposed chemical potential of the transmembrane sucrose concentration differences being less than the opposing pmf gradient (see Borstlap and Schuurmans 2004). As a consequence, sucrose transport function would have been polarized for influx by the prevailing inward-directed pmf thus preventing efflux through the symporter (cf. Carpaneto et al., 2005).

The structural basis for the functional difference between sucrose symporters and facilitators may be subtle as indicated by PsSUF1, PvSUT1 and PvSUF1 transporters clustering together in Clade I, and PsSUF4 grouping closely with LjSUT4 in Clade II (Figure 2). Consistent with this claim are the findings that a single amino acid replacement shifts transport from a proton-coupled to an uncoupled mechanism in bacterial lactose and yeast mitochondrial carriers (Pao et al., 1998). A similar situation exists in animal glucose transporters that contain one fructose transporter, one proton/myo-inositol symporter (HMIT) and ten glucose facilitators (Joost and Thorens, 2001). However, the suggested role of the negatively charged asparagine in TM IV, conserved in all SUTs, in proton coupling (Lemoine, 2000), must now be questioned as this site is also present in PsSUF1, PsSUF4 and PvSUF1 (Figure 1). In addition, and in contrast to sucrose/H+ symporters (Lalonde et al., 2004 and Table 1b and d), transport activities of the sucrose facilitators were unaffected by DEPC and maltose indicating that the sucrose active site (cf. Lu and Bush, 1998) differs between these two functional groups. Significantly His65 in loop I/II, purported to be located at the sucrose active site (Lu and Bush, 1998), is conserved across these two groups (Figure 1). This suggests that either the active site is located elsewhere in the carriers or that other nearby residues influence sucrose binding.

The phylogenetic sub-group containing new Clade I members (Figure 2) includes a sucrose proton symporter (PvSUT1) and two sucrose facilitators (PsSUF1 and PvSUF1). One functional property that these Clade I members share is their high apparent Km values ranging from 8.5 for PvSUT1 to 99.8 mm for PsSUF1 (Figure 4e,f). Together with an apparent Km value of 37.8 mm for PsSUF4 (Figure 4e), these values are much higher than the generally reported range of 0.2 to 2.0 mm for SUT1s and 5 to 10 mm for SUT4s (Lalonde et al., 2004). However, whether the Clade I/SUT1 and perhaps Clade II/SUT4 phylogenetic sub-groups of low affinity SUTs are causally related requires further investigation. Indeed exceptions reported in the literature would not support this claim. For instance, GmSUT1 in Clade I has an apparent Km value of 5.4 mm at pH 4.0 (Aldape et al., 2003). Thus, phylogenetic classification may merely reflect evolutionary relationships of sucrose transporters, as for the animal GLUTs (Joost and Thorens, 2001). Of more significance, the facilitators with apparent Km values greater than 25 mm sucrose correspond to the kinetic properties reported for the saturable low affinity component of sucrose transport detected in transport studies using tissues, protoplasts and membrane vesicles (Lemoine et al., 1996; Ritchie et al., 2003).

Expression of sucrose facilitators in organs containing loading (source leaves) and transport (stems/roots and see Figure 5) phloem raises questions about their function in these physiological contexts. For apoplasmic phloem loading species, such as pea and bean, sucrose facilitators could function in releasing sucrose to the leaf apoplasm down a favourable concentration gradient prior to retrieval into sieve-element companion cell complexes by proton-coupled SUTs (Lalonde et al., 2004). A similar function could be envisaged along the transport phloem whereby phloem loading of remobilized sucrose from storage depends upon an apoplasmic step (cf. Patrick, 1997).

Functional significance of sucrose transporters expressed in seed coats of pea and bean

Our observations (Figure 5) add to the growing evidence that sucrose transporters are expressed in maternal tissues of developing seeds of both mono- (Bagnall et al., 2000; Furbank et al., 2001; Weschke et al., 2000) and dicots (Meyer et al., 2004; Tegeder et al., 1999; Weber et al., 1997). For pea seed coats, chlorenchyma together with thin-walled parenchyma and thin-walled parenchyma transfer cells form a symplasmic continuum with phloem cells (see Tegeder et al., 1999 but cf. van Dongen et al., 2003). All sucrose transporters were expressed relatively strongly in these cell types but their transcripts also were detected in ground parenchyma cells (Figure 6f–i and see van Dongen et al., 2003). A similar finding was made for bean seed coats. The symplasmically-isolated branch parenchyma cells exhibited densities of gene transcripts comparable to those located in phloem and ground parenchyma cells (Figure 6a–e). The latter cells are considered to be the principal sites of sucrose efflux from bean seed coats (Wang et al., 1995).

That sucrose/H+ symport and sucrose facilitated diffusion operate concurrently in legume seed coats is supported by physiological observations. For bean seed coats, sucrose transport exhibits behaviours suggestive of a high affinity and sulfhydryl modifier-sensitive sucrose/H+ symport at low sucrose concentrations (less than 10 mm) and low affinity and sulfhydryl modifier-independent facilitated transport at high sucrose concentrations (Ritchie et al., 2003). This transport behaviour is consistent with the combined transport activities and kinetics (Km) of PvSUT1 (sucrose/H+ symporter; DEPC sensitive) and PvSUF1 (sucrose facilitator; DEPC independent) when expressed in yeast (Figure 4 and Table 1). Moreover, substrate specificity of PvSUF1 (Table 1) reflects a glucose/fructose competitive inhibition of sucrose uptake by bean seed coats (Ritchie et al., 2003). Less clear, but similar conclusions can be drawn for sucrose transport behaviours exhibited by native membranes of pea seed coats. Here, concentration-dependent uptake of sucrose by whole seed coats was found to exhibit non-saturating linear kinetics and an independence from prevailing proton gradients (de Jong et al., 1996). However, in a subsequent study using plasma membrane vesicles, isolated from seed coats, evidence for sucrose/H+ symporter activity was obtained (de Jong and Borstlap, 2000). This transport behaviour would be expected on combining transport activities and kinetics (Km) of PsSUT1 (sucrose/H+ symporter; DEPC sensitive) with PsSUF1 and PsSUF4 (sucrose facilitators; DEPC independent) when expressed in yeast (Figure 4 and Table 1). Indeed the PsSUF1 apparent Km value of 100 mm (Figure 4) might account for the linear component dominating concentration-dependent uptake of sucrose by pea seed coats (de Jong et al., 1996). Overall, the consistency between the transport properties of the sucrose/H+ symporters and facilitators (Figure 4 and Table 1) and sucrose transport behaviours of pea (de Jong and Borstlap, 2000; de Jong et al., 1996) and bean (Ritchie et al., 2003) seed coats provides persuasive circumstantial evidence that these proteins are transport active in their native membranes.

For carriers (PsSUF1; PsSUF4; PvSUF1) to release sucrose by facilitated diffusion from seed coats depends upon there being an outward-directed gradient of sucrose across the plasma membranes of their unloading cells. Modest concentration differences of 10 and 30 mm have been estimated for seed coats of French and broad bean respectively (Patrick and Offler, 2001). There are no estimates of concentration differences available for pea seed coats, but these probably approximate those of the closely-related broad bean (see above). Thus, PvSUF1 could contribute to the component (50% of the total) of sucrose efflux from excised bean seed coats that is proton-uncoupled and insensitive to sulfhydryl modifiers (Walker et al., 1995). The remaining energy-coupled component of sucrose efflux, possibly in antiport with protons (Walker et al., 1995), cannot be accounted for by our current findings. The role of PsSUF1 and PsSUF4 in sucrose release from pea seed coats is less certain as this has been suggested to occur through non-selective pores that are closed by sulfhydryl modifiers (van Dongen et al., 2001; de Jong et al., 1996). However, membrane proteins that function as non-selective pores are yet to be cloned from legume seed coats (cf. Schuurmans et al., 2003).

Speculation that the same membrane protein may function as a H+ symporter or a facilitator in seed coats, depending upon the transmembrane concentration difference of sucrose (Ritchie et al., 2003), is not sustained by finding that the sucrose/H+ symporters and sucrose facilitators are structurally and functionally different proteins (Figures 1 and 4; Table 1). Depending upon the pmf and opposing transmembrane sucrose concentration difference, sucrose/H+ symporters can function in efflux mode by counter exchange (Borstlap and Schuurmans, 2004) or by reversal of sucrose/H+ symport (Carpaneto et al., 2005). Counter exchange does not result in net transport (Borstlap and Schuurmans, 2004) whereas reversal of sucrose/H+ symport does (Carpaneto et al., 2005). Assuming a sucrose/H+ stoichiometry of one, the following derivative of the Nernst equation predicts the intracellular (Ci) and external (Co) sucrose concentration differences at which sucrose/H+ symport will reverse for a given proton motive force comprised of membrane potential (Δψ) and proton (ΔpH) differences:

  • image(1)

Membrane potentials of seed coats are −40 to −50 mV (van Dongen et al., 2001; Walker et al., 1995) with proton differences of one pH unit (Walker et al., 1995) giving an inward directed pmf of −100 mV for the lesser membrane potential. Estimates of sucrose concentrations in seed apoplasmic spaces of grain legumes range from 5 to 200 mm (Patrick and Offler, 2001) with bean seed coats at 80 mm. For a pmf of −100 mV, Equation 1 predicts sucrose/H+ symport will reverse to an efflux mode at intracellular sucrose concentrations of 251 or 3981 mm when apoplasmic sucrose concentrations are 5 or 80 mm respectively. These predicted intracellular sucrose concentrations exceed estimates of 100 to 120 mm of seed coat tissues (Patrick and Offler, 2001). Therefore, PsSUT1 and PvSUT1 are likely to function in sucrose retrieval modes in non-vascular cells of seed coats. However, assuming a phloem sucrose concentration of 500 mm, PsSUT1 and PvSUT1 could function as effluxers from sieve elements/vascular parenchyma for apoplasmic concentrations up to 10 mm (predicted from Equation 1) that, at best, might account for 10% of the released sucrose (Patrick and Offler, 2001). Thus, sucrose/H+ symporters in seed coats may play a minor role in modulating rates of net sucrose release from seed coats and, under depleted apoplasmic sucrose concentrations, could contribute to efflux from sieve elements/vascular parenchyma cells.

Conclusions

A suite of sucrose transporter genes, PsSUF1, PsSUF4, PvSUT1 and PvSUF1, was isolated from bean and pea seed coats. Heterologous expression in yeast showed they encoded functional sucrose transporters. Functional characterization showed PsSUF1, PsSUF4 and PvSUF1 were high Km, pH-independent, antimycin A-, CCCP- and DEPC-insensitive sucrose carriers. The expression of these genes suggests they might have a broad role in sucrose influx and efflux throughout the plant. Genes encoding sucrose proton symporters (PsSUT1 and PvSUT1) and sucrose facilitators (PsSUF1, PsSUF4 and PvSUF1) are expressed in developing seed coats of pea and bean, with their transcripts localized in those cells involved in sucrose efflux. Taken together, these novel sucrose transporters may play a role in sucrose efflux from maternal seed coats to the seed apoplasm.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Plant growth conditions

Plants of Phaseolus vulgaris L. (cv. Redland Pioneer) and Pisum sativum (cv BC3) were raised under glasshouse conditions with partial temperature control (20–26°C by day and 18–24°C by night). Plants were grown singly in 3-l volumes of potting mixture (for details, see Fieuw and Patrick, 1993). Mineral nutrients were supplied in half-strength Hoagland's No. 1 solution, at rates of 100 ml per pot per 7 days. Developing seeds were used for experimentation when cotyledon expansion growth approached completion but dry weight gains were rapid and linear.

Cloning of sucrose transporter cDNAs

Total RNA was extracted from pea seed coats using RNeasy kit (Qiagen: http://www.qiagen.com/). For bean seed coats, total RNA was extracted according to Heim et al. (1993). Extracted RNA was reverse transcribed with Superscript reverse transcriptase and oligo (dT) (Invitrogen: http://www.invitrogen.com/). The resulting cDNA was subjected to degenerate PCR using primers 5′-GG(ACGT)GT(ACGT)CA(AG)TT(CT)GG(ACGT)TGGGC-3′ and 5′-TT(ACGT)CCCATCCA(AG)TC(ACGT)GT(AG)TC-3′. The PCR reactions were performed at 30 cycles with annealing temperature at 55°C. The PCR products were cloned into pGEMT vector (Promega: http://www.promega.com/) and sequenced. To isolate full-length sucrose transporter genes, total RNA from pea and bean seed coats was subjected to 5′ and 3′ SMART RACE RT-PCR followed by full-length amplification (BD Bioscience: http://www.bdbiosciences.com). For each 5′ or 3′ RACE PCR product, about ten clones were sequenced and their sequence information used to design primers for full-length amplification. Five full-length clones (SUT-pGEMT) from each SUT gene were sequenced in double strands. The resulting sequences were compared to those obtained from degenerate PCR and 5′/3′ RACE clones and analysed by Sequencher (version 4.1) and ANGIS (Australian National Genomic Information Service).

Functional analysis of sucrose transporters expressed in SUSY7/ura3 yeast

Full-length sucrose transporter genes in pGEMT vectors were cut with EcoRI and ligated into the yeast expression vector, pDR196 (Rentsch et al., 1995), then transformed into yeast strain SUSY7/ura3 (Barker et al., 2000; Riesmeier et al., 1992). The correct incorporation of identical full length genes after yeast transformation was verified by sequencing the plasmid DNA recovered from yeast. Colonies containing verified sucrose transporter genes were prepared as glycerol stocks for further assays.

For complementation assays, single colonies of each sucrose transporter clone were streaked onto 2% glucose plates (ura), and single colonies re-streaked onto identifiable sections of sucrose plates (ura), then incubated at 30°C for up to 10 days for observation. For sucrose uptake assays, single colonies of yeast containing a single transporter gene, were grown to the early logarithmic phase in minimal medium containing 2% glucose, washed and resuspended with 25 mm Na-Pi buffer, pH 5.5. For pH-dependence assays, solutions at specified pHs were buffered with 25 mm HEPES–Mes. A culture containing 1 × 109 yeast cells was used. Glucose (10 mm) or ethanol (100 mm), as specified, was added to bathing media containing yeast cells 1 min before exposure to [14C]sucrose. After incubation for specified times at 25°C with shaking, cells were collected onto microfibre filters (0.7 μm pore, GF/C; Whatman) under vacuum. Filters were rapidly washed three times with 4 ml of ice-cold water and radioassayed by liquid scintillation counting. Concentration dependence, metabolic inhibition and sugar specificity studies were completed over 4 min in 1 mm sucrose solutions buffered at pH 4.5 with 25 mm HEPES–Mes. For inhibitor assays, final concentrations of 1.5 mm DEPC, 50 μm CCCP or 10 μm antimycin A were added to energised yeast cells 30 sec before addition of [14C]sucrose. For sugar specificity assays, a ten-fold excess of competing sugar species was used. For ‘counter transport’ analysis, yeast cells were first incubated with 50 mm unlabelled sucrose or sorbitol (as an iso-osmotic control) in 25 mm Na-Pi pH 5.5 for 30 min at 25°C, then centrifuged, washed at 4°C, and resuspended in 50 mm sorbitol in the same buffer for [14C]sucrose uptake assays as described above. For sucrose efflux measurements, yeast cells were preloaded with [14C]sucrose in a 0.2 mm [14C]sucrose solution (buffered at pH 4.5 with 25 mm HEPES–Mes) for 10 min at 25°C. Apoplasmic [14C] sucrose was removed by washing cells rapidly with 4 ml ice-cold water. Cells were then washed over a 10-min period with 20 ml of fresh buffer (25 mm HEPES–Mes, pH 4.5) at 25°C on microfibre filters. On completion of the wash cycle, cells were radioassayed to determine amounts of 14C label remaining. Chromatography by TLC of the residual intracellular 14C-label demonstrated that 98 ± 1% remained as [14C] sucrose (data not shown). The empty vector control transport rates were subtracted from all transport data except those involving time courses of sucrose uptake.

Semi-quantitative PCR

Total RNA, extracted from various plant tissues, was reverse transcribed as described above. Semi-quantitative PCR reaction was performed within the linear range of amplification for each targeted fragment examined at 32 cycles with 65°C as annealing temperature. Gene-specific primers for PsSUF1 were CTTGCAGTTGGACTTGCCATGACTATAGTC and TCTTGACTAATGAAATCCACCCGCAATTGG, for PsSUF4 were GAGGGGGAGGTTGAAATCTTGAGGAGAGG and GGACTGCCGATGTTCCTTGGTATCAC; for PvSUF1 were CTTGTGAGAAAACAGAACACAGTGAGAGAC and GTGCCGCCACGGGCTTGTCCTTTACG and for PvSUT1 were CAGGTGGAAACAGGAGAACGGCAAC and GAGGGTTGTTAGCGTTGACACAATCTGGTG. The pea actin gene was amplified using primers AATGGAACTGGAATGGTGAAGGCTGG and TGCCAGATCTTCTCCATGTCATCCC, the bean actin gene was amplified using primers GGGACGACATGGAGAAGATCTGGC and TCCAGAACAATACCAGTTGTACGGCCAC. Actin gene expression levels served as internal positive controls for quantification of relative amounts of cDNA.

In situ hybridization

Seed coat tissue was fixed for 6 h at 4°C in 4% (v/v) paraformaldehyde containing 50 mm Pipes, pH 7.2. Fixed tissue was then washed, dehydrated through an ethanol series and embedded in methacrylate as described by Bulbert et al. (1998). Sections (1 μm thick) were cut with a Reichert Ultracut microtome and mounted onto APES-coated slides. Digoxigenin (DIG)-labelled sense and anti-sense riboprobes were synthesized by in vitro transcription from PCR products with a T7 promoter sequence incorporated upstream or downstream of the sucrose transporter fragments (Roche). Probes, 200 to 270bp were designed to target a specific unique sequence of each SUT. The primers binding to the transporter gene sequence regions were: GTCCCCGCGTTTAATATGGAAGAAG and GGGCTGAGTCCTGCTCTAGCAGGATTTG for PsSUT1, GGGCGGCCGTCATCAGTGGTGTATTAG and GGGCATGCCACAGAATGGAATTTGG for PsSUF1, GGTTCTCAAAAGCCTAGAAACCCAG and GGTCATCCTATTGCAGAAAAGACGG for PsSUF4, CTTTTCCGGTTCACGGAAACCGAG and GGCAGTCACAAGCATCAACATCAAC for PvSUT1 and GGGTCTTTCAGTGGTCTGCATAAG and GGGTCTTTTGAGCTCCTTCAACGCC for PvSUF1. In situ hybridization was performed as described by Harrington et al. (1997). Sections were viewed using a Zeiss (http://www.zeiss.com/) Axiophot microscope equipped with standard FITC/Rhodamine/DAPI filter sets, and photomicrographs were taken using an Olympus (http://www.olympus-global.com/) digital camera C-5050 Zoom.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We are indebted to Mr Kevin Stokes for supplying healthy plant material for experimentation and to Professor Wolf Frommer for commenting on an earlier draft. In addition, preliminary attempts to clone novel sucrose transporters by Dr Mimmi Throne-Holst, under the direction of Dr Sylvie Lalonde and Professor Wolf Frommer, is recognized as contributing a solid start point for the project. Financial support from the Australian Research Council is gratefully acknowledged.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Aldape, M.J., Elmer, A.M., Chao, W.S. and Grimes, H.D. (2003) Identification and characterization of a sucrose transporter isolated from the developing cotyledons of soybean. Arch. Biochem. Biophys. 409, 243250.
  • Bagnall, N., Wang, X.-D., Scofield, G.N., Furbank, R.T., Offler, C.E. and Patrick, J.W. (2000) Sucrose transport-related genes are expressed in both maternal and filial tissues of developing wheat grains. Aust. J. Plant Physiol. 27, 10091020.
  • Barker, L., Kuhn, C., Weise, A., Schulz, A., Gebhardt, C., Hirner, B., Hellmann, H., Schulze, W., Ward, J.M. and Frommer, W.B. (2000) SUT2, a putative sucrose sensor in sieve elements. Plant Cell, 12, 11531164.
  • Borstlap, A.C. and Schuurmans, J.A.M.J. (2004) Sucrose transport into plasma membrane vesicles from tobacco leaves by H+ symport or counter exchange does not display a linear component. J. Membr. Biol. 198, 3142.
  • Boxman, A.W., Dobbelmann, J. and Borst-Paulwels, G.W.F.H. (1984) Possible energization of K+ accumulation into metabolizing yeast by the proton motive force. Binding correction to be applied in the calculation of the yeast membrane potential from tetraphenylphosphonium distribution. Biochim. Biophys Acta, 772, 5157.
  • Bulbert, M.W., Offler, C.E. and McCurdy, D.W. (1998) Polarized microtubule deposition coincides with wall ingrowth formation in transfer cells of Vicia faba L. cotyldeons. Protoplasma, 201, 816.
  • Carpaneto, A., Geiger, D., Bamberg, E., Sauer, N., Fromm, J. and Hedrich, R. (2005) Phloem-localized, proton-coupled sucrose carrier ZmSUT1 mediates sucrose efflux under control of the sucrose gradient and the proton motive force. J. Biol. Chem. 280, 2143721443.
  • Cirillo, V.P. (1989) Sugar transport in normal and mutant yeast cells. Meth. Enzymol. 174, 617622.
  • Van Dongen, J.T., Laan, R.G.W., Wouterlood, M. and Borstlap, A.C. (2001) Electrodiffusional uptake of organic cations by pea seed coats. Further evidence for poorly selective pores in the plasma membrane of seed coat parenchyma cells. Plant Physiol. 126, 16881697.
  • Van Dongen, J.T., Ammerlaan, A.M.H., Wouterlood, M., Van Aelst, A.C. and Borstlap, A.C. (2003) Structure of the developing pea seed coat and the post-phloem transport pathway of nutrients. Ann. Bot. 91, 729737.
  • Fieuw, S. and Patrick, J.W. (1993) Mechanism of photosynthate efflux from Vicia faba L. seed coats. J. Exp. Bot. 44, 6574.
  • Furbank, R.T., Scofield, G.N., Hirose, T., Wang, X.D., Patrick, J.W. and Offler, C.E. (2001) Cellular localization and function of a sucrose transporter OsSUT1 in developing rice grains. Aust. J. Plant Physiol. 28, 11871196.
  • Gahrtz, M., Schmelzer, E., Stolz, J. and Sauer, N. (1996) Expression of the PmSUC1 sucrose carrier gene from Plantago major L. is induced during seed development. Plant J. 9, 93100.
  • Harrington, G.N., Franceschi, V.R., Offler, C.E., Patrick, J.W., Tegeder, M., Frommer, W.B., Harper, J.F. and Hitz, W.D. (1997) Cell specific expression of three genes involved in plasma membrane sucrose transport in developing Vicia faba seed. Protoplasma, 197, 160173.
  • Heim, U., Weber, H., Bäumlein, H. and Wobus, U. (1993) A sucrose-synthase gene of Vicia faba L. expression pattern in developing seeds in relation to starch synthesis and metabolic regulation. Planta, 191, 394401.
  • Jones, D.T., Taylor, W.R. and Thornton, J.M. (1992) The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275282.
  • De Jong, A. and Borstlap, A.C. (2000) A plasma membrane-enriched fraction isolated from the coats of developing pea seeds contains H+-symporters for amino acids and sucrose. J. Exp. Bot. 51, 16711677.
  • De Jong, A.J., Koerselmann-Kooij, J.W., Schuurmans, J.A.M.J. and Borstlap, A.C. (1996) Characterization of the uptake of sucrose and glucose by isolated seed coat halves of developing pea seeds. Evidence that a sugar facilitator with diffusional kinetics is involved in seed coat unloading. Planta, 199, 486492.
  • Joost, H.-G. and Thorens, B. (2001) The extended GLUT-family of sugar/polyol transport facilitators: nomenclature, sequence characteristics, and potential function of its novel members. Mol. Membr. Biol. 18, 247256.
  • Kühn, C., Hajirezaei, M.R., Fernie, A.R., Roessner-Tunali, U., Czechowski, T., Hirner, B. and Frommer, W.B. (2003) The sucrose transporter StSUT1 localizes to sieve elements in potato tuber phloem and influences tuber physiology and development. Plant Physiol. 131, 102113.
  • Lalonde, S., Wipf, D. and Frommer, W.B. (2004) Transport mechanisms for organic forms of carbon and nitrogen between source and sink. Annu. Rev. Plant Biol. 55, 341372.
  • Lemoine, R. (2000) Sucrose transporters in plants: update on function and structure. Biochim. Biophys. Acta, 1465, 246262.
  • Lemoine, R., Kühn, C., Thiele, N., Delrot, S. and Frommer, W.B. (1996) Antisense inhibition of the sucrose transporter in potato: effects on the amount and activity. Plant Cell Environ. 19, 11241131.
  • Lu, J.M.-Y. and Bush, D.R. (1998) His-65 in the proton-sucrose symporter is an essential amino acid whose modification with site-directed mutagenesis increases transport activity. Proc. Natl Acad. Sci. USA, 95, 90259030.
  • Meyer, S., Lauterbach, C., Niedermeier, M., Barth, I., Sjolund, R.D. and Sauer, N. (2004) Wounding enhances expression of AtSUC3, a sucrose transporter from Arabidopsis sieve elements and sink tissues. Plant Physiol. 134, 684693.
  • Pao, S.S., Paulsen, I.T. and Saier, M.H., Jr (1998) Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62, 134.
  • Patrick, J.W. (1997) Phloem unloading: sieve element unloading and post-sieve element transport. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 191222.
  • Patrick, J.W. and Offler, C.E. (2001) Compartmentation of transport and transfer events in developing seeds. J. Exp. Bot. 52, 551564.
  • Rentsch, D., Laloi, M., Rouhara, I., Schmelzer, E., Delrot, S. and Frommer, W.B. (1995) NTR1 encodes a high affinity oligopeptide transporter in Arabidopsis. FEBS Lett. 370, 264268.
  • Riesmeier, J.W., Willmitzer, L. and Frommer, W.B. (1992) Isolation and characterization of a sucrose carrier cDNA from spinach by functional expression in yeast. EMBO J. 11, 47054713.
  • Ritchie, R.J., Fieuw-Makaroff, S. and Patrick, J.W. (2003) Sugar retrieval by coats of developing seeds of Phaseolus vulgaris L. and Vicia faba L. Plant Cell Physiol. 44, 163172.
  • Rosche, E., Blackmore, D., Tegeder, M., Richardson, T., Schroeder, H., Higgins, T.J.V., Frommer, W.B., Offler, C.E. and Patrick, J.W. (2002) Seed-specific overexpression of a potato sucrose transporter increases sucrose uptake and growth rates of developing pea cotyledons. Plant J. 30, 165175.
  • Schmidt, H.A., Strimmer, K., Vingron, M. and Von Haeseler, A. (2002) TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics, 18, 502504.
  • Schuurmans, J.A.M.J., Van Dongen, J.T., Rutjens, B.P.W., Boonman, A., Pieterse, C.M.J. and Borstlap, A.C. (2003) Members of the aquaporin family in the developing pea seed coat include representatives of the PIP, TIP, and NIP subfamilies. Plant Mol. Biol. 53, 655667.
  • Scofield, G.N., Hirose, T., Gaudron, J.A., Upadhyaya, N.M., Ohsugi, R. and Furbank, R.T. (2002) Antisense suppression of the rice sucrose transporter gene, OsSUT1, leads to impaired grain filling and germination but does not affect photosynthesis. Funct. Plant Biol. 29, 815826.
  • Stein, W.D. (1986) Transport and Diffusion across Cell Membranes. Orlando: Academic Press.
  • Tegeder, M., Wang, X.-D., Frommer, W.B., Offler, C.E. and Patrick, J.W. (1999) Sucrose transport into developing seeds of Pisum sativum L. Plant J. 18, 151161.
  • Tegeder, M., Thomas, M., Hetherington, L., Wang, X.-D., Offler, C.E. and Patrick, J.W. (2000) Genotypic differences in seed growth rates of Phaseolus vulgaris L. II. Factors contributing to cotyledon sink activity and sink size. Aust. J. Plant Physiol. 27, 119128.
  • Traven, A. and Heierhorst, J. (2005) SQ/TQ cluster domains: concentrated ATM/ATR kinase phosphorylation site regions in DNA-damage-response proteins. Bioessays, 27, 397407.
  • Viola, R., Roberts, A.G., Haupt, S., Gazzani, S., Hancock, R.D., Marmiroli, N., Machray, G.C. and Oparka, K.J. (2001) Tuberization in potato involves a switch from apoplasmic to symplastic phloem unloading. Plant Cell, 13, 385398.
  • Walker, N.A., Patrick, J.W., Zhang, W.-H. and Fieuw, S. (1995) Efflux of photosynthate and acid from developing seed coats of Phaseolus vulgaris L.: a chemiosmotic analysis of pump driven efflux. J. Exp. Bot. 46, 539549.
  • Wang, X.-D., Harrington, G., Patrick, J.W., Offler, C.E. and Fieuw, S. (1995) Cellular pathway of photosynthate transport in coats of developing seed of Vicia faba L. and Phaseolus vulgaris L. II. Principal cellular site(s) of efflux. J. Exp. Bot. 46, 4963.
  • Weber, H., Borisjuk, L., Heim, U., Sauer, N. and Wobus, U. (1997) A role for sugar transporters during seed development: molecular characterization of a hexose and sucrose carrier in Fava bean seeds. Plant Cell, 9, 895908.
  • Weise, A., Barker, L., Kühn, C., Lalonde, S., Buschmann, H., Frommer, W.B. and Ward, J.M. (2000) A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plant cells. Plant Cell, 12, 13451355.
  • Weschke, W., Panitz, R., Sauer, N., Wang, Q., Neubohn, B. and Wobus, U. (2000) Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant J. 21, 455467.
  • Williams, L.E., Lemoine, R. and Sauer, N. (2000) Sugar transporters in higher plants – a diversity of roles and complex regulation. Trends Plant Sci. 5, 283290.

Accession numbers: PsSUF1: DQ221698; PsSUF4: DQ221697; PvSUT3: DQ221701; PvSUT1: DQ221699; PvSUF1: DQ221700.