Rice DECUSSATE controls phyllotaxy by affecting the cytokinin signaling pathway

Authors


(e-mail anagato@mail.ecc.u-tokyo.ac.jp).

Summary

Phyllotaxy is defined as the spatial arrangement of leaves on the stem. The mechanism responsible for this extremely regular pattern is one of the most fascinating enigmas in plant biology. In this study, we identified a gene regulating the phyllotactic pattern in rice. Loss-of-function mutants of the DECUSSATE (DEC) gene displayed a phyllotactic conversion from normal distichous pattern to decussate. The dec mutants had an enlarged shoot apical meristem with enhanced cell division activity. In contrast to the shoot apical meristem, the size of the root apical meristem in the dec mutants was reduced, and cell division activity was suppressed. These phenotypes indicate that DEC has opposite functions in the shoot apical meristem and root apical meristem. Map-based cloning revealed that DEC encodes a plant-specific protein containing a glutamine-rich region and a conserved motif. Although its molecular function is unclear, the conserved domain is shared with fungi and animals. Expression analysis showed that several type A response regulator genes that act in the cytokinin signaling pathway were down-regulated in the dec mutant. In addition, dec seedlings showed a reduced responsiveness to exogenous cytokinin. Our results suggest that DEC controls the phyllotactic pattern by affecting cytokinin signaling in rice.

Introduction

Leaf initiation patterns vary among plant species and affect the aboveground plant architecture. The leaf initiation pattern may be described in terms of temporal and spatial aspects, i.e. the plastochron and phyllotaxy. The former is defined as the duration of two successive initiations of leaf primordia, while the latter is the spatial arrangement of leaves on a stem. Several different types of phyllotaxy are known in plants; these are usually categorized as alternate (distichous), opposite (decussate), whorled and spiral. In any phyllotaxy, the pattern of leaf positions around the shoot apex is regular.

As leaf initiation takes place in the shoot apical meristem (SAM), the SAM is a main target of phyllotaxy study. In fact, in several species, phyllotactic change is closely associated with alteration of SAM activity and/or structure (Clark et al., 1993; Jackson and Hake, 1999; Itoh et al., 2000). Models for explaining phyllotactic patterns have been proposed from various points of view (reviewed by Steeves and Sussex, 1989; Kuhlemeier, 2007). A recently proposed auxin-based model was supported by much molecular evidence. According to this model, dynamic changes in auxin concentration established by polar auxin transport in the SAM account for the stable and repetitive nature of leaf initiation (Reinhardt et al., 2000, 2003). In addition, several computer simulations based on auxin flow and its concentration in the SAM have been used successfully to reconstruct a specific phyllotaxy (Jonsson et al., 2006; Smith et al., 2006).

Another phytohormone, cytokinin (CK), plays an important role in the regulation of SAM activity and structure (To and Kieber, 2008; Gordon et al., 2009; Perilli et al., 2010; Chickarmane et al., 2012). A reduction in SAM size has been reported in multiple loss-of-function mutants of Arabidopsis ATP/ADP-ISOPENTENYLTRANSFERASE (IPT) genes (Miyawaki et al., 2006) and a single loss-of-function mutant of the rice and Arabidopsis LONELY GUY (LOG) gene (Kurakawa et al., 2007; Tokunaga et al., 2012), both of which encode enzymes acting in the CK biosynthesis pathway. A small SAM also resulted from over-expression of Arabidopsis CYTOKININ OXIDASE/DEHYDROGENASE (CKX) genes that encode a CK-degrading enzyme (Werner et al., 2001, 2003). The CK signaling pathway also affects meristem activity. Defects in CK receptor genes caused a reduction in SAM size (Higuchi et al., 2004). Downstream elements in signal transduction called type A and type B response regulator (RR) family proteins also affect SAM activity. Type A RRs act as negative regulators of CK signaling (Kiba et al., 2003; To et al., 2004, 2007), and type B RRs are transcriptional activators of CK targets, including the type A RR genes (Hwang and Sheen, 2001; Kakimoto, 2003; Mason et al., 2005; Taniguchi et al., 2007; Yokoyama et al., 2007). Analysis of loss-of-function mutants and transgenic plants constitutively expressing RRs revealed that a subset of type A RRs negatively regulates SAM size and activity (Leibfried et al., 2005; Hirose et al., 2007), and type B RRs positively regulate SAM function (Sakai et al., 2001; Imamura et al., 2003). The importance of CK signaling for control of phyllotaxy was shown by analysis of the ABERRANT PHYLLOTAXY1 (ABPH1) gene in maize. ABPH1 encodes a type A RR, and a loss-of-function mutant of ABPH1 exhibited a decussate (opposite) phyllotaxy, instead of the normal distichous (alternate) phyllotaxy (Giulini et al., 2004).

Key transcriptional regulators involved in SAM maintenance interact with the CK pathway. Over-expression of CLASS 1 KNOTTED1-LIKE HOMEOBOX (KNOX) genes, which are essential for SAM maintenance, induced up-regulation of CK biosynthesis IPT genes (Sakamoto et al., 2006). Another homeodomain transcriptional factor, WUSCHEL (WUS), which is required for stem cell maintenance in the SAM, directly represses a subset of type A RRs (Leibfried et al., 2005; Gordon et al., 2009; Chickarmane et al., 2012). In contrast to its positive effect on SAM function, CK is known to negatively regulate root growth and root apical meristem (RAM) activity (Mason et al., 2005; Miyawaki et al., 2006; Heyl et al., 2008). Reduction of endogenous CK levels and mutations in CK signaling genes result in a larger RAM (Werner et al., 2001, 2003). In addition, several type A RRs are required for stem cell specification in the RAM during embryogenesis (Müller and Sheen, 2008).

As stated above, the CK pathway profoundly affects SAM activity/size. However, the scarcity of phyllotactic mutants means that elucidation of the association of the CK pathway with phyllotaxy is problematic.

In this study, we identified two allelic mutants, decussate-1 (dec-1) and decussate-2 (dec-2), both of which exhibited a decussate phyllotaxy that is never observed in wild-type rice or grass species. The dec mutant exhibited enhanced SAM activity but reduced RAM activity. In addition to the opposite SAM and RAM phenotypes, the dec mutation caused decreased expression of type A RRs and a decreased sensitivity to CK application. The DEC gene encodes a protein of unknown function. Our analysis revealed that DEC is a genetic factor that controls phyllotaxy and modulates the CK signaling pathway in rice.

Results

dec mutants show decussate phyllotaxy in early vegetative development

Two allelic mutants, dec-1 and dec-2, were originally identified as embryonic mutants exhibiting abnormally shaped mature embryos. As dec-1 and dec-2 showed almost identical phenotypes, we focused on dec-1. In mature dec-1 embryos, although all embryonic organs and three leaf primordia were present, a malformed scutellum (Figure S1a,b) and an enlarged SAM were observed (Figure 1a,b).

Figure 1.

Phenotypes of the dec-1 mutant. (a, b) Longitudinal sections of mature wild-type (a) and dec-1 (b) embryos. Insets show enlarged views of the SAM. (c) Seedlings of wild-type (left) and dec-1 (right) at 5 DAG. (d, e) Cross-sections of wild-type (d) and dec-1 (e) shoot apices at 5 DAG. (f, g) Phenotype of the wild-type (f) and dec-1 (g) plants 1 month after germination. Arrows in (d–g) indicate the positions of leaves. SC, scutellum; SM, shoot apical meristem. Scale bars = 100 μm (a, b, d, e), 1 cm (c) and 5 cm (f, g).

After germination, the majority of dec-1 seedlings produced short and erect leaves with an abnormal phyllotaxy (Figure 1c). Cross-sections of the shoot apex revealed that the wild-type displayed a distichous phyllotaxy with a divergence angle of 180°. In contrast, approximately half of dec-1 seedlings exhibited a decussate phyllotaxy, except for the first embryonic leaf (Figure 1d,e). Thus, the dec mutation caused conversion of a distichous phyllotaxy to a decussate phyllotaxy during early vegetative development. The remaining dec-1 seedlings showed irregular, spiral or distichous-like phyllotaxy (Figure S1c,d), but all dec-1 seedlings were easily distinguished from wild-type seedlings by their severe dwarfism.

During the 5 days after germination (5 DAG), two leaves emerged in the wild-type, and two pairs of decussate leaves appeared in dec-1, indicating that the leaf initiation rate per node was not affected. After producing three or four pairs of decussate leaves (Figure 1f,g), dec-1 plants recovered a distichous phyllotaxy, but the leaves remained short, and the internodes were incompletely differentiated in the stem (Figure S1e,f). Although the anatomy of dec leaves was normal, they died before reproductive development. The mortality of dec plants appears to be caused by defects in the roots described below.

dec seedlings have a larger SAM in which cell divisions are activated

As phyllotactic change frequently accompanies structural alteration of the SAM, we observed the SAM size/shape in wild-type and dec-1 seedlings. In the early vegetative phase, the dec-1 SAM was much larger than that of the wild-type (Figure 2a,b). At 3, 5, 7 and 10 DAG, the width of the dec-1 SAM was approximately twice that of the wild-type, although no significant difference was detected in SAM height (Figure S2a,b). Accordingly, the phyllotaxic change during early vegetative development of dec-1 is probably associated with a wider or enlarged SAM. We also measured SAM cell size. In the L1 layer, the cell size along the tangential direction of dec-1 SAMs was 16% smaller than that of the wild-type, although the thickness of the layer remained unchanged. Cell sizes in the L2 and L3 layers of dec-1 SAMs were 19% larger than that of the wild-type (Figure S2c). These data indicate that the enlargement of SAM size in dec-1 was caused mainly by enhanced cell division rather than cell enlargement.

Figure 2.

Shoot apical meristem in the dec-1 mutant. (a, c, e) Wild-type. (b, d, f) dec-1. (a, b) Longitudinal sections of shoot apices at 5 DAG. (c, d) In situ expression pattern of histone H4 mRNA in the shoot apex at 5 DAG. (e, f) In situ expression pattern of OSH1 mRNA in the shoot apex at 5 DAG. Arrowheads indicate the SAM. Arrows in (e) and (f) indicate down-regulation of OSH1 expression in the P0 region. Scale bars = 50 μm.

To confirm activation of cell division in the dec-1 SAM, we performed mRNA in situ hybridization with the rice histone H4 gene that is specifically expressed in the S phase of the cell cycle. dec-1 SAMs showed more hybridization signals than wild-type SAMs (Figure 2c,d). In the wild-type, the mean number of cells expressing the histone H4 gene per median longitudinal section was 1.9. In contrast, the mean number of cells exhibiting a hybridization signal was 6.2 in dec-1 (Figure S2d). These results indicate that the SAM of dec-1 has higher cell division activity than the wild-type.

To examine the cellular status of the SAM, we observed the expression pattern of OSH1, which is specifically expressed in indeterminate cells of the SAM (Sentoku et al., 1999). In the wild-type, OSH1 is expressed throughout the SAM, except in the L1 layer, but is down-regulated in leaf founder cells (Figure 2e). The OSH1 expression domain in dec-1 was much larger than that in the wild-type due to its larger SAM size, but similar down-regulation in leaf initiation sites was observed (Figure 2f). Thus, mutation of dec-1 affects the number of indeterminate cells in the SAM, but not the cellular organization.

Short root and reduced root apical meristem in the dec mutant

In addition to the phyllotaxic conversion in the shoot, several abnormalities were detected in the roots of dec-1. The rice root system consists of two kinds of roots: seminal and crown (Itoh et al., 2005). The seminal and crown roots in dec-1 were short and thin, and the number of crown roots was greatly decreased (Figure 1c). This suggests that the dec-1 mutation affected maintenance of the RAM of seminal and crown roots, and the formation of crown roots. A longitudinal section showed a smaller RAM region in the seminal root and slit-like empty spaces in the cortex region in dec-1 (Figure 3a,b). Comparison of cross-sections at the same distance from the root tip revealed that the diameter of the dec-1 seminal root decreased, although the radial arrangement of cell layers appeared normal (Figure 3c,d). In the wild-type, the number of cells in the circumference direction of the outer cortical region was larger than that in the inner region to compensate for the increase in circumference. However, in the dec-1 mutant, the number of cortex cells in the outer layer was comparable to that in the inner region. This scarcity of cells in the outer region is a possible cause of the empty spaces in the cortex region. Therefore, the cell division frequency appeared to be affected in the dec-1 RAM. To confirm whether cell division activity was affected in the dec-1 RAM, we again observed histone H4 expression in the root apex. Hybridization signals were much fewer in dec-1 than in the wild-type. In particular, histone H4 signals were rarely observed in the dec-1 cortical region cell division zone (Figure 3f), while relatively more signals were detected in the wild-type root (Figure 3e). These results indicate that cell divisions were suppressed in the dec-1 root. In addition, detailed observations of the RAM revealed that the pattern of cell division at the endodermal layer was also affected in the dec-1 mutant (Figure S1i–l).

Figure 3.

Root phenotypes in the dec-1 mutant. (a, c, e, g) Wild-type. (b, d, f, h) dec-1. (a, b) Longitudinal sections of seminal roots. (c, d) Cross-sections of seminal roots. (e, f) In situ expression pattern of histone H4 mRNA in the seminal root. (g, h) In situ expression pattern of OsSCR mRNA in the seminal root. The red dotted line in (a) and (b) indicates the outline of the RAM. Arrows in (b) and (d) indicate empty spaces in the cortex of dec-1. CO, cortex. Scale bars = 100 μm.

To clarify whether the radial pattern and cellular identities in the dec-1 root were affected, we observed the expression pattern for rice SCARECROW (OsSCR), which is specifically expressed in root endodermal cells (Figure 3g,h) (Kamiya et al., 2003a). A ring-like expression pattern was observed in both wild-type and dec-1 roots, indicating that endodermal cell identity, as represented by OsSCR gene expression, was conserved in the dec-1 mutant.

Positional cloning of DEC

We isolated the DEC gene by applying a map-based cloning strategy using F2 and F3 populations of a cross between DEC-1/dec-1 and cv. Kasalath. The DEC locus was mapped on the long arm of chromosome 12, and was closely linked with the PCR marker RZ869. Fine mapping using 680 dec-1 and 1200 wild-type siblings of F3 plants revealed that DEC is located within three bacterial artificial chromosome clones (OSJNBa0054H15, OJ1008_A01 and OSJNBb0088J13; Figure 4a). The Rice Annotation Project Database (RAP-DB: http://rapdb.dna.affrc.go.jp/) predicts approximately 50 genes in this region. We determined the nucleotide sequence of several candidate genes in this region, and found a single base substitution from G to T in a gene (Os12g0465700) that is annotated as encoding an expressed hypothetical protein (Figure 4b). This substitution generates a premature stop codon in the predicted protein. Introduction of a 6.5 kb genomic DNA fragment containing the 4.3 kb coding region plus 1.5 kb upstream and 0.7 kb downstream of the predicted gene rescued the phenotypes of dec-1 plants (Figure S3a–c). In addition, transgenic plants constitutively expressing an artificial microRNA that specifically reduced DEC transcripts mimicked dec phenotypes (Figure S3d,e). Therefore, we conclude that Os12g0465700 is the causal gene of the dec-1 mutation. In dec-2, we failed to amplify any genomic fragments of the DEC coding region or fragments of several mapping markers near DEC, indicating that the dec-2 mutant possibly contains a large genomic deletion that includes DEC (Figure 4a).

Figure 4.

Molecular characterization of the DEC gene. (a) Map position of DEC. The location of the deletion in dec-2 is indicated. (b) Structure of DEC. Two exons are indicated by boxes. Gray and black boxes indicate the glutamine-rich region and unknown conserved domain, respectively. The position of the dec-1 mutation is indicated. (c) Deduced amino acid alignment of DEC and its homologous proteins in other plants. Dotted and solid lines indicate the glutamine-rich region and unknown conserved domain, respectively. (d) Amino acid alignment of conserved motifs in the unknown domain of DEC and homologous proteins from other organisms, including fungi and animals. (e) Real-time RT-PCR analysis of DEC. The expression level of DEC is shown relative to eEF-1α. WT, 5 DAG whole wild-type seedling; dec-1, 5 DAG whole dec-1 seedling; dec-2, 5 DAG whole dec-2 seedling; SA, shoot apex including young leaf primordia; IL, immature leaf; IA, 5 mm long inflorescence apex; IP, 5 cm long immature panicle; FL, immature flower; EM, embryos 5 days after pollination; RT, root.

We isolated a full-length cDNA of DEC. The coding sequence of DEC consists of 1254 nucleotides encoding 417 amino acid residues, and is composed of two exons (Figure 4b). Database analysis revealed that homologous proteins exist in several plant species (Figures 4a and S4a), all of which contain a conserved domain with unknown function, preceded by an N-terminal glutamine-rich region (Figure 4b,c). Although the combination of the conserved domain and the N-terminal glutamine-rich region exists only in plants, the core motif in the conserved domain, RLLPYH, is shared by fungi and animals (Figure 4d). However, the function of proteins with this motif remains unknown.

We examined the transcription level of DEC in dec-1 and dec-2 by real-time RT-PCR. DEC expression was reduced in dec-1 and not detected in dec-2 (Figure 4e), indicating that dec-2 is a null allele.

To investigate the DEC expression pattern, we performed RT-PCR using RNA isolated from several organs and tissues (Figure 4e). DEC mRNA was detected in all organs, and a relatively high level of expression was observed in the immature inflorescence apex. We also examined the spatial DEC expression pattern by mRNA in situ hybridization. However, no tissue- or organ-specific expression was observed, indicating that DEC is constitutively expressed in the entire plant body. We generated transgenic plants over-expressing DEC cDNA using the ACTIN promoter. However, the transgenic plants showed no abnormal phenotype (Figure S3f,g).

To examine the subcellular localization of DEC, DEC-GFP and GFP-DEC fusion constructs under the control of the constitutive CaMV 35S promoter were introduced into onion epidermal cells by particle bombardment. As a transformation control, plastid-localizing rice S9 ribosomal protein fused with RFP was co-transfected with 35S:DEC-GFP or 35S:GFP-DEC. Green fluorescence representing DEC protein localization was preferentially detected in nuclei, although signals were also observed in the cytoplasm for both 35S:DEC-GFP and 35S:GFP-DEC constructs (Figure S4). This indicates that DEC may play a role in the nucleus, although no nuclear localization signal was predicted in the DEC protein.

Cytokinin contents and expression profile of cytokinin-related genes in the dec shoot

Two characteristic phenotypes of dec, the opposite responses of the SAM and RAM and the phyllotactic conversion, suggest that DEC function is related to CK, which plays opposite roles in meristem activity in the shoot and root (Werner et al., 2001, 2003). In addition, the maize abpyl1 mutant showing phyllotactic conversion is defective in a type A RR that acts in the CK signaling pathway (Giulini et al., 2004). These facts suggest that DEC acts in a CK-related pathway.

We first measured the concentration of CKs and their precursors (Sakakibara, 2006) in dec-1 shoots (Figure 5a). The level of trans-zeatin (tZ), one of the active CKs, was below the detection limit. The concentrations of other active CKs, cis-zeatin (cZ) and N6-(∆2-isopentenyl) adenine (iP) in dec-1, were lower than that in the wild-type, although the change in iP concentration was not statistically significant. The levels of several CK intermediates were altered in dec-1 mutants, the most affected being cZ riboside 5′-phosphates (4.2-fold lower than the wild-type). However, changes in the levels of tZ riboside and tZ riboside 5′-phosphates, precursors of the most active CK, were limited. Although the concentration of cZ in dec-1 was significantly lower than that in the wild-type, the content of other active CKs appeared not to be markedly affected in dec-1.

Figure 5.

Cytokinin (CK) content and expression of CK-related genes. (a) Endogenous CK contents. tZR, trans-zeatin riboside; tZRPs, tZR 5′-phosphates; cZ, cis-zeatin; cZR, cZ riboside; cZRPs, cZR 5′-phosphates; iP, N6-(∆2-isopentenyl) adenine; iPR, iP riboside; iPRPs, iPR 5′-phosphates. Means were calculated from three independent samples. Vertical bars indicate the SD. (b) Changes in the expression of putative CK-related genes in dec-1 revealed by an Affymetrix GeneChip rice genome array. The vertical axis indicates dec-1 expression relative to that of the wild-type. Means were calculated from three independent samples. Vertical bars indicate the SE. (c) Real-time RT-PCR analysis of type A response regulator genes OsRR5, OsRR6 and OsRR9/10. The expression levels of OsRR genes relative to eEF-1α are indicated. Vertical bars indicate the SE. Datasets marked with single and double asterisks differ significantly from the wild-type as assessed by Student's t test at < 0.05 and < 0.01, respectively.

Next, we examined the expression profile of CK-related genes in wild-type and dec-1 seedlings using an Affymetrix GeneChip rice genome array (Figure 5b). Of the CK-related genes annotated in the rice genome (Hirose et al., 2007), we excluded those that were statistically verified as not expressed in this analysis. The expression levels of CK biogenesis genes, including four putative adenosine phosphate isopentenyltransferase (OsIPT) genes and LOG were unchanged. In contrast, expression of the CK-degrading CK oxidase/dehydrogenase genes OsCKX2, OsCKX9 and OsCKX11 was up-regulated, that of OsCKX5 was down-regulated, and that of OsCKX2 and OsCKX9 fluctuated greatly among the replicate samples. Expression of His protein kinase (OHK) and His-containing phosphotransfer protein (OHP) genes that encode proteins acting as CK receptors and mediators of the phosphorelay signal, respectively, was relatively unchanged. These data suggest that dec-1 does not affect the expression of CK biosynthesis genes and most CK receptor genes.

Among six type A RR (OsRR) genes, four were significantly down-regulated, and the rest were unchanged. Expression of one of five type B RR (ORR) genes was unchanged, but the rest were slightly up-regulated. Of the four type A RR genes down-regulated in dec-1, OsRR5 is the closest homolog to maize ABPH1 (Jain et al., 2006) and OsRR6 is known to be a negative regulator of CK signaling (Hirose et al., 2007). We further confirmed by real-time PCR that expression of three type A RR genes (OsRR5, OsRR6 and OsRR9/10) was down-regulated in dec-1 shoots (Figure 5c), although the expression levels of OsRR9 and OsRR10 were indistinguishable due to their identical coding sequences.

The above results suggest that DEC is most likely associated with CK signaling rather than biosynthesis.

Reduced cytokinin sensitivity in the dec mutant

Defects in CK signaling cause aberrant CK sensitivity. Thus, we examined the response of the dec mutant to exogenous CK application (Figure 6). Wild-type seedlings cultured for 5 days in medium containing 1 μm kinetin exhibited a twisted seminal root tip, which is a characteristic response to kinetin application. However, this response was not observed in the dec-1 root (Figure 6a,b). Higher kinetin concentrations more severely inhibited shoot and root elongation and crown root formation in the wild-type (Figure 6c,d). In contrast, kinetin treatment had no marked effect on shoot and root growth in the dec mutant (Figure 6c,d). We also tested the response of the dec mutant to the natural cytokinins tZ and cZ. Although the effects on wild-type shoot and root growth and the number of the crown roots slightly differed between cZ and tZ, dec exhibited weaker responses to cZ and tZ than wild-type (Figure S5). Thus, CK treatment had less effect on both the shoot and root of dec-1 seedlings. These data indicate that responsiveness to CK is weakened in dec-1.

Figure 6.

Effect of kinetin treatment on dec-1 seedlings. (a) Control wild-type seedlings cultured for 5 days. (b) Wild-type (left) and dec-1 (right) seedlings cultured for 5 days in medium containing 1 μm kinetin. A twisted root tip was observed in the wild-type (arrow). (c) Kinetin-treated wild-type and dec-1 seedlings 1 week after germination cultured in media containing 0, 0.1, 1 or 10 μm kinetin (left to right). Scale bar = 1 cm. (d) Effect of kinetin treatment on shoot and root growth in wild-type and dec-1 plants 2 weeks after germination and cultured in media containing 0, 0.1, 1 or 10 μm kinetin. Vertical bars indicate the SD.

Discussion

DEC regulates phyllotactic patterns

Of several models proposed to explain the repetitive and regular nature of phyllotaxy, an auxin transport-based model was established based on molecular evidence. According to this model, ordered leaf initiation is regulated by PIN1-directed changes in local auxin concentration in the SAM (Reinhardt et al., 2000, 2003). Recently, phyllotactic alteration was shown in quadruple loss-of-function mutants of auxin influx carrier genes in Arabidopsis (Bainbridge et al., 2008). Furthermore, a subset of PLETHORA (PLT) transcriptional factor genes was found to control the phyllotactic pattern by regulating the PIN1 level in the SAM. A triple plt3 plt5 plt7 mutant showed delayed phyllotactic transition from decussate to spiral during vegetative development, as well as phyllotactic alteration of inflorescence branches (Prasad et al., 2011). These reports suggest that auxin is important for phyllotactic control, although few auxin-related mutants displaying an altered phyllotactic pattern have been reported. In addition, computer simulation of an auxin transport model of phyllotaxy suggested that manipulation of one auxin-related parameter is not enough to convert one phyllotactic pattern to another (Smith et al., 2006). This suggests that factors other than auxin are involved in phyllotactic shifts.

One of the most important factors causing a phyllotactic shift in the dec mutant is an altered SAM geometry, because phyllotactic change is correlated with such an alteration in several mutants (Clark et al., 1993; Jackson and Hake, 1999; Itoh et al., 2000). However, a modified SAM geometry does not always accompany phyllotactic change. For example, plastochron1 (pla1) and plastochron2 (pla2) mutants with large SAMs show a shortened plastochron but normal phyllotaxy (Itoh et al., 1998; Kawakatsu et al., 2006). In the case of pla mutants, the shape of the SAMs is similar to that of the wild-type, indicating that a change in SAM volume alone is not sufficient for phyllotactic alteration. The SAMs of shoot organization (sho) mutants are flat, low and wide, but the shape fluctuates widely. The sho mutants show random phyllotaxy with rapid leaf production (Itoh et al., 2000). Considering these mutants together, specific alteration of SAM shape/size is necessary to generate regular phyllotaxy. In the case of the dec mutant, a wide SAM with unaltered height contributes to the establishment of decussate phyllotaxy without affecting the plastochron. Accordingly, one of the main functions of DEC was maintenance of SAM shape/size, which is required for phyllotactic regulation, but not plastochron regulation.

The dec mutants showed pleiotrophic abnormalities other than decussate phyllotaxy, including abnormal embryo shape, dwarfism, suppressed root development and lethality. This suggests that DEC function is essential for key aspects of plant development throughout the life cycle. This is consistent with the fact that DEC was expressed throughout the plant body. This expression pattern differs from that of ABPH1, whose expression is specifically detected in the SAM during embryogenesis and in the leaf initiation site of a vegetative SAM (Giulini et al., 2004). In addition, expression of OsRR5, the closest homolog of ABPH1, was suppressed in dec-1. These results suggest that DEC acts upstream of phyllotaxy-specific genes such as ABPH1. Accordingly, DEC is probably a regulator of the phyllotactic pattern as well as other developmental processes.

DEC oppositely controls cell proliferation in the shoot apical meristem and root apical meristem

Enhanced cell division in the SAM affected its size and shape. However, enlargement of the SAM was not uniform but intensified to the width direction. OSH1 expression in the SAM indicated that cellular organization in the dec SAM was normal. Accordingly, DEC negatively affects SAM activities by controlling the cell division pattern without affecting cellular identity.

Similar, but oppositely oriented, events occurred in dec roots, as evidenced by the small RAM and patchy empty spaces in the cortex layers. The spaces in the cortex may have been caused by preferential reduction of cortical cell division. Therefore, both cell division frequency and the specific cell division pattern were impaired in dec-1. However, cellular organization in the dec root was normal, as OsSCR is normally expressed in the endodermal layer. Thus, the dec mutation had opposite effects on cell division in the SAM and RAM: activation in the SAM and suppression in the RAM. Taken together, DEC probably controls the specific cell proliferation pattern without affecting cellular organization in both the SAM and RAM. We discuss the opposite functions of DEC in the SAM and RAM in relation to CK signaling below.

DEC is possibly involved in the cytokinin signaling pathway

Maintenance of an appropriate CK level is important for maintaining meristematic activity in the shoot and root. Rice Gn1a, the most effective quantitative trait locus associated with high grain productivity, encodes a CK oxidase/dehydrogenase, OsCKX2, that degrades bioactive CK (Ashikari et al., 2005). A loss-of-function mutant of rice LOG, encoding a CK-activating enzyme, formed small panicles with a decreased number of branches and spikelets (Kurakawa et al., 2007). In Arabidopsis, over-expression of a CKX gene resulted in reduced content of active CKs, a smaller SAM and an enlarged RAM (Werner et al., 2001, 2003). This phenotype is opposite to that of dec, which has an enlarged SAM and reduced RAM, suggesting an increased CK content. However, the active CK content of dec-1 was not markedly different. On the contrary, the level of cZ in dec-1 was lower than that in the wild-type (Figure 5). Thus, the meristematic activity phenotypes of dec are not directly associated with the CK content. This is consistent with the unchanged expression of CK biosynthesis genes in dec-1. One explanation for the decreased concentration of endogenous cZ and the decreased CK responsiveness in dec is negative feedback regulation of increased SAM size and/or the increased number of proliferative cells. In this case, CK may not be directly involved in dec phenotypes.

Another possibility is that DEC is directly involved in CK signaling, which is supported by the fact that expression of several type A RR genes was suppressed in the dec mutant (Figure 5). In addition, one of the down-regulated genes was OsRR5, which is the closest homolog of maize ABPH1, whose loss-of-function mutation in maize causes phyllotactic conversion from distichous to decussate, as does the dec mutation (Giulini et al., 2004). Multiple loss-of-function mutants of type A RR (ARR) genes in Arabidopsis showed enlarged inflorescence meristems and abnormal phyllotaxy of the inflorescence branches (Leibfried et al., 2005; Zhao et al., 2010). In contrast, over-expression of OsRR6 caused reduced panicle branches in rice (Hirose et al., 2007). Thus, type A RRs negatively regulate SAM activities in both Arabidopsis and rice. These facts strongly suggest that DEC is involved in the CK signaling pathway. Although the mechanism for the reduced sensitivity to CK exhibited by the dec mutant is unclear, dec phenotypes may be explained by constitutive activation of CK signaling.

Our results suggest that a major role of DEC is positive regulation of type A RR gene expression. Several type A RRs are known to be positively regulated by type B RRs (Hwang and Sheen, 2001; Mason et al., 2005; Taniguchi et al., 2007; Yokoyama et al., 2007). However, the expression levels of some type B RRs were not down-regulated, but were instead slightly up-regulated in dec-1. Although the mechanism underlying the down-regulation of type A RRs is unclear, one hypothesis is that DEC functions in transcriptional activation of type A RRs downstream of type B RRs. If this is the case, expression of type B RRs was activated in the dec mutant through reversal of the negative regulation by type A RRs.

In terms of the opposite effects of the dec mutation on SAM and RAM activities, recent studies suggest that genetic regulation of stem cell maintenance differs between the SAM and the RAM, which is partially explained by cross-talk between auxin and CK (Moubayidin et al., 2009; Bishopp et al., 2011). In Arabidopsis, auxin represses a subset of type A RRs by direct interaction with an auxin response factor in the SAM (Leibfried et al., 2005; Zhao et al., 2010), but positively regulates type A RRs during stem cell-specific processes in the RAM (Müller and Sheen, 2008). In addition, CK signaling negatively regulates auxin transport in the root (Dello Ioio et al., 2008). As phyllotaxy and root development are known to be affected by auxin, DEC may also be involved in auxin flow or concentration through complex cross-talk between CK signaling and auxin. This idea is supported by the fact that a maize abph1 mutant exhibited abnormalities in auxin content and polar auxin transport, as well as in CK signaling (Lee et al., 2009). Further analysis of the relationships between auxin and CK signaling in dec are necessary.

DEC encodes a plant-specific protein with a motif that is conserved among plants and animals

DEC encodes a plant-specific protein. Multiple alignment of DEC and DEC-like proteins from several plant species revealed that these proteins are characterized by a conserved domain with unknown function, preceded by an N-terminal glutamine-rich region. Although the sequence and length of these glutamine-rich regions was highly variable, two homologous genes exist in Arabidopsis, but not in the rice genome (Figure S4a).

Several glutamine-rich proteins act as transcriptional activators via interaction with a core component of the transcriptional machinery in both plants and animals (Saluja et al., 1998; Freiman and Tjian, 2002; Ding et al., 2006). In addition, the core motif in the conserved domain of DEC exists not only in plants but also in mammals and fungi, although proteins with both the glutamine-rich region and the conserved motif are plant-specific. One protein that contains this motif is the human GLIOMA TUMOR SUPPRESSOR CANDIDATE REGION GENE 1 (GLTSCR1), which was reported to be able to suppress some types of brain tumor (Smith et al., 2000). Deletion of the genomic region including GLTSCR1 and a single-nucleotide polymorphism in GLTSCR1 were correlated with the progression of oligodendroglioma (Yang et al., 2005). Thus, GLTSCR1 was suggested to be a strong candidate as a regulator of oligodendroglioma development. Recently, GLTSCR1 was shown to interact with a chromatin-associating protein, BROMODOMAIN PROTEIN 4 (BRD4) (Rahman et al., 2011). BRD4 is associated with several transcription complexes, such as the Mediator and Positive transcription elongation factor b complexes, and is considered to function as a transcriptional co-factor (Wu and Chiang, 2007). Knockdown of GLTSCR1 decreased the expression of BRD4 target genes, indicating that GLTSCR1 contributes to transcriptional regulation (Rahman et al., 2011). Although the role of GLTSCR1 in the BRD4 complex remains unknown, the conserved motif in both DEC and GLTSCR1 may be involved in interaction with a component of the transcriptional machinery common in all eukaryotes. On the basis of the glutamine-rich domain, the conserved motif and the nuclear localization, DEC-like proteins may function as transcriptional activators of several kinds of genes. If this is the case, it is possible that DEC affects transcription of several type A RR genes and a wide range of targets other than genes related to CK signaling.

In summary, we have identified a genetic factor, DEC, that is involved in determining the phyllotactic pattern in the vegetative phase. DEC negatively controls SAM activity and positively controls RAM activity via modulation of CK signaling.

Experimental Procedures

Plant materials

Two allelic recessive mutants of rice (Oryza sativa L.) showing abnormal embryos and seedlings were identified from an M2 population of cv. Taichung 65 mutagenized using N-methyl-N-nitrosourea and cv. Taichung 65 mutagenized using gamma radiation (300 Gy). We designated these decussate-1 (dec-1) and decussate-2 (dec-2), respectively, because they exhibited decussate phyllotaxy during the early vegetative phase. For observation of the early vegetative stage, mutant and wild-type seeds were sown on Murashige and Skoog (MS) medium supplemented with 3% sucrose and 1% agar at pH 5.8 in a plant box at 28°C. Otherwise, plants were grown in pots or in a paddy field. Transgenic plants were grown in a biohazard greenhouse at 30°C during the day and 25°C at night. For microarray and real-time PCR analysis, RNA samples were collected from seedlings of the wild-type and dec-1 at 5 days after germination.

Histological analysis

For paraffin sectioning, samples were fixed in FAA (formaldehyde/glacial acetic acid/ethanol. 1:1:18) for 24 h at 4°C, dehydrated using a graded ethanol series, and embedded in Paraplast plus (McCormick Scientific, www.mccormickscientific.com). Microtome sections (8 μm thick) were stained using Delafield's hematoxylin, Safranin or Fast Green FCF (Sigma-Aldorich, http://www.sigmaaldrich.com), and then observed under a light microscope.

In situ hybridization

Samples were fixed in 4% paraformaldehyde in 0.1 m sodium phosphate buffer for 24 h at 4°C, and then dehydrated in a graded ethanol series. The ethanol in the dehydrated samples was replaced with xylene, and the samples were embedded in Paraplast plus (McCormick Scientific). Paraffin sections (8 μm thick) were applied to microscope slides coated with APS (3-aminopropyltriethoxysilane) (Matsunami Glasses, http://www.matsunami-glass.co.jp/e-index.html). For the OSH1 probe, the full-length cDNA was used as a template. Digoxygenin-labeled antisense and sense RNA probes were used. The OSH1, histone H4 and OsSCR probes were prepared as described previously (Itoh et al., 2000; Kamiya et al., 2003a). As sense probes did not give specific signals, only data using antisense probes are presented. In situ hybridization and immunological detection with alkaline phosphatase were performed as described by Kouchi and Hata (1993).

Mapping and identification of DEC

Heterozygous DEC-1/dec-1 plants (ssp. japonica) were crossed with cv. Kasalath (spp. indica), and mutant plants showing the dec phenotype in the F2 and F3 populations were used for mapping. Using CAPS and STS markers, the DEC locus was mapped on three bacterial artificial chromosome clones (BACs) on the long arm of chromosome 12. We determined the nucleotide sequence of several candidate genes in the three BACs, and identified a single base substitution in a candidate DEC gene. Because this gene was annotated in the RAP-DB database (http://rapdb.dna.affrc.go.jp/) as a hypothetical expressed protein, a full-length DEC cDNA was amplified using a primer specific to the 3′ UTR of the annotated genes and an oligo(dT) primer. The amplified fragments were inserted into pCR4 TOPO (Invitrogen, http://www.invitrogen.com) and sequenced.

Multiple sequence alignments were performed and manually adjusted to optimize alignments using GENETYX software (Genetyx Co., http://www.genetyx.co.jp/). The phylogenetic tree was constructed based on full-length amino acid sequences by the neighbor-joining method using GENETYX software. The numbers at the branching points indicate the number of times that each branch topology was found during a bootstrap analysis (= 1000).

Transgenic plants

DEC genomic DNA, including 1.5 kb upstream and 0.7 kb downstream, was used in a complementation test. This fragment was introduced into Agrobacterium tumefaciens strain EHA101 and transformed into dec-1 homozygous plants by the Agrobacterium-mediated transformation method (Hiei et al., 1994).

For construction of a line over-expressing DEC artificial microRNA (amiDEC), a 21 nucleotide target located at the middle of the DEC gene (636–656 bp) was manually selected, and the potential efficiency of amiDEC (UAGGGUAGUAGCCUGUUGACG) was confirmed using Web MicroRNA Designer 3 (WMD3) (Ossowski et al., 2008). Based on the protocol for artificial microRNAs (Warthmann et al., 2008), the precursor of amiDEC was synthesized by fusion PCR using the osa-mir528 endogenous microRNA precursor as a template for the stem-loop backbone (Warthmann et al., 2008). Then it was inserted into a binary vector containing a cassette of the rice actin promoter and NOS terminator (Kamiya et al., 2003b).

For construction of a line over-expressing DEC, we inserted DEC cDNA into a binary vector containing a cassette of the rice actin promoter and NOS terminator (pACT::DEC). We then introduced these vectors into wild-type calli using the Agrobacterium-mediated transformation method (Hiei et al., 1994).

Particle bombardment

The coding sequence of DEC was fused to the 5′ and 3′ termini of the GFP gene, which was under the control of the CaMV 35S promoter. This construct and a construct expressing S9 ribosomal protein fused with RFP were simultaneously introduced into onion epidermal cells by particle bombardment using 1 mm gold particles according to the manufacturer's instructions (PDS-1000/He; Bio-Rad, http://www.bio-rad.com). After overnight incubation, the cells were stained with DAPI and observed by fluorescence microscopy (BZ-8000; Keyence Co., http://www.keyence.com).

Cytokinin measurement

Sampling of approximately 100 mg of fresh shoot samples from more than five seedlings was repeated three times for both dec-1 and the wild-type. Extraction and determination of CKs in each sample were performed using a liquid chromatography-tandem mass spectrometry system (ACQUITY UPLC/Quattro Premier XE; Waters, http://www.waters.com) as described previously (Kojima et al., 2009).

DNA microarray analysis

Microarray analysis was performed using a GeneChip® rice genome array (Affymetrix, http://www.affymetrix.com). Preparation of labeled target cRNA, subsequent purification and fragmentation were performed using One-cycle target labeling kit and control reagents (Affymetrix). Double-stranded cDNA was prepared from 10 μg total RNA of wild-type and dec-1 shoots at 5 DAG. Hybridization, washing, staining and scanning were performed according to the manufacturer's instructions. A 10 μg aliquot of fragmented cRNA was subjected to hybridization. Three independent replicates were used. Data analysis was performed using GeneChip® Operating Software (Affymetrix) and GeneSpring 7 (Agilent Technologies, http://www.home.agilent.com). For extraction of CK-related genes on the Affymetrix rice genome array, the list of rice putative CK-related genes described by Hirose et al. (2007) was used. For the CK-related genes, probe sets whose Affymetrix detection call was assigned as ‘A’ (absent expression) for all six gene chips were eliminated.

Real-time RT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. One microgram of RNA after DNase I digestion was used for first-strand cDNA synthesis, and a reverse transcription reaction was performed using High-Capacity RNA-to-cDNA Master Mix (Applied Biosystems, http://www.appliedbiosystems.jp). The cDNA products were diluted with water to a final volume of 200 μl, and 1.5 μl of cDNA solution was subjected to amplification by real-time PCR. For quantification of genes, a TaqMan assay was performed using TaqMan Fast Universal PCR Master Mix and FAM-labeled TaqMan probes for each gene (Applied Biosystems) and a StepOnePlus real-time PCR system (Applied Biosystems). The expression level of each sample was normalized to that of an internal control, eEF-1α. The primers and TaqMan probes used to specifically detect DEC, OsRR5, OsRR6, OsRR9/10 and eEF-1α are listed in Table S1.

Cytokinin treatment

Seeds were sterilized in 2% sodium hypochlorite, inoculated, and grown aseptically for 5 or 7 days on MS medium containing 3% sucrose, 1% agar (pH 5.8) and 0, 0.1, 1 or 10 μm kinetin, cis-zeatin and trans-zeatin in a plant box at 28°C.

Accession numbers

Sequence data for the DEC complete cDNA and DEC protein are available from the GenBank data library under accession number AB683949.

Acknowledgements

We would like to thank R. Soga and K. Ichikawa (The Institute for Sustainable Agro-ecosystem Services, University of Tokyo) for their assistance in cultivating rice plants at the Experimental Farm of the University of Tokyo, and S. Oyama (RIKEN) for microarray experiments. We also thank N. Tsutsumi, S. Arimura and M. Fujimoto for providing the S9-RFP construct. This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (20248001 to Y.N. and 23012006 to J.I.).

Ancillary