SEARCH

SEARCH BY CITATION

Keywords:

  • Aedes aegypti;
  • Aedes albopictus;
  • Aedes vittatus;
  • Stegomyia;
  • Orissa;
  • multiplex PCR;
  • arboviral diseases;
  • vector surveillance
  • Aedes aegypti;
  • Aedes albopictus;
  • Aedes vittatus;
  • Stegomyia;
  • Orissa;
  • PCR multiplex;
  • arboviroses;
  • surveillance des vecteurs
  • Aedes aegypti;
  • Aedes albopictus;
  • Aedes vittatus;
  • Stegomyia;
  • Orissa;
  • PCR Multiplex;
  • enfermedades arbovíricas;
  • vigilancia vectorial

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Objective  To develop a single-step multiplex PCR to differentiate the aquatic stages of Aedes aegypti, Aedes albopictus and Aedes vittatus collected from different breeding spots in arbovirus endemic/epidemic areas and to detect the most abundant species by the multiplex PCR.

Methods  Aquatic stages of different mosquito species were sampled by inspecting artificial and natural breeding sites in domestic and peridomestic areas. DNA was isolated from different stages of the three Aedes species. Using novel primers based on 18S rDNA sequence, a single-step multiplex PCR was developed to clearly distinguish the three Aedes species. It was then evaluated in the aquatic stages of Aedes species collected from different areas.

Results  A total of 1150 aquatic stages were collected from 294 breeding spots, of which 156 contained Aedes species. Discarded tires were the major breeding spots of Aedes species. The aquatic stages were clustered into 230 pools; Ae. albopictus was detected in the largest number of pools, followed by Ae. aegypti and Ae. vittatus.

Conclusions  The Multiplex PCR clearly differentiated the aquatic stages of the three Aedes species and detected that Ae. albopictus was most profuse in different breeding spots surveyed, hence indicating to be the main vector in this region. So control measures can be designed against Ae. albopictus at an early stage to prevent any arboviral outbreak. This method is a convenient tool for precise identification of Aedes vectors during entomological surveys in arbovirus endemic/epidemic areas where several species coexist.

Objectif:  Développer une PCR multiplex àétape unique pour différencier les stades aquatiques des espèces Aedes aegypti, Aedes albopictus et Aedes vittatus, collectés dans différents endroits de reproduction dans des zones endémiques/épidémiques pour arbovirus et détecter les espèces les plus abondantes par PCR multiplex.

Méthodes:  Les stades aquatiques de différentes espèces de moustiques ont étééchantillonnés en inspectant les sites de reproduction artificiels et naturels dans les zones domestiques et péri domestiques. L’ADN a été isolé des différents stades des trois espèces d’Aedes. En utilisant des amorces basées sur la séquence d’ADNr 18S, une PCR multiplex àétape unique a été développée pour distinguer clairement les trois espèces du genre Aedes. Elle a ensuite étéévaluée sur les stades aquatiques des espèces d’Aedes recueillies dans différents endroits.

Résultats:  1150 stades aquatiques ont été recueillis dans 294 endroits de reproduction dont 156 contenaient des espèces Aedes. Les pneus usagés étaient les principaux points de reproduction des espèces du genre Aedes. Les stades aquatiques ont été regroupés en 230 pools. Ae. albopictus a été détecté dans le plus grand nombre de pools, suivie par Ae. aegypti et Ae. vittatus.

Conclusions:  La PCR multiplex différencie clairement les stades aquatiques des trois espèces Aedes et a trouvé qu’Ae. albopictusétait la plus abondante dans les différentes zones de reproduction sondées étant par conséquent, le principal vecteur dans cette région. Ainsi, les mesures de contrôle pourraient être conçues contre Ae. albopictusà un stade précoce afin de prévenir toute épidémie à arbovirus. Cette méthode est un outil pratique pour l’identification précise des vecteurs Aedes lors des enquêtes entomologiques dans des zones endémiques/épidémiques pour arbovirus où plusieurs espèces cohabitent.

Objetivo:  Desarrollar una PCR multiplex realizada en un solo paso para diferenciar estadios acuáticos de Aedes aegypti, Aedes albopictus y Aedes vittatus recolectados de diferentes focos de reproducción en áreas endémicas / epidémicas para arbovirus y detectar las especies más abundantes mediante PCR multiplex.

Métodos:  Los estadíos acuáticos de diferentes especies de mosquito se muestrearon inspeccionando focos de reproducción artificiales y naturales en áreas domésticas y peridomésticas. Se aisló el ADN de diferentes estadíos de las tres especies de Aedes. Utilizando cebadores basados en la secuencia del ADNr 18S, se desarrolló una PCR multiplex de un solo paso para distinguir claramente entre las tres especies de Aedes. Después se evaluó en los estadíos acuáticos de especies de Aedes recolectados de diferentes áreas.

Resultados:  Se recolectaron 1150 estadíos acuáticos de 294 focos de reproducción, de los cuales 156 contenían la especie Aedes. Las ruedas abandonadas eran los principales focos de reproducción de la especie Aedes. Los estadíos acuáticos estaban agrupados en 230 charcos; Ae. albopictus fue la especie detectada en un mayor número de charcos, seguido por Ae. aegypti y Ae. vittatus.

Conclusiones:  La PCR multiplex diferencia claramente los estadíos acuáticos de las tres especies de Aedes. Se detectó que Ae. albopictus era la especie más abundante en los diferentes focos de reproducción estudiados, indicando que se trata del principal vector en esta región. Por lo tanto, podrían diseñarse medidas de control frente a Ae. albopictus en un estadío temprano para prevenir un brote de arbovirus. Este método es una herramienta convencional para la identificación precisa de vectores de Aedes durante estudios entomológicos en áreas endémicas / epidémicas para arbovirus en donde coexisten varias especies.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Correct identification of the Aedes species involved in arbovirus transmission is essential for vector surveillance and control programmes. Aedes (Stegomyia) mosquitoes are the major vectors of arboviral diseases such as yellow fever, dengue and chikungunya worldwide. Aedes aegypti L is the primary vector, followed by Aedes albopictus Skuse. Since 2006, the coastal areas of Orissa have been repeatedly affected by arboviral outbreaks. The major Stegomyia species found in and around this region are Ae. aegypti, Ae. albopictus, Aedes novalbopictus, Aedes unilineatus and Aedes vittatus, which are capable of transmitting arbovirus such as dengue and chikungunya virus (Barraud 1934; Mourya & Banerjee 1987; Jupp & McIntosh 1990; Lahariya & Pradhan 2006). Previous epidemiological studies showed that the major Aedes species involved in arboviral outbreaks in Orissa include the three morphologically similar Stegomyia species: Ae. aegypti, Ae. albopictus and Ae. vittatus (Dwibedi et al. 2010).

Although the process of conventional identification of Aedes (Stegomyia) species is based on morphological characters such as white scale patterns on the scutum and white bands on legs, certain identification requires well-preserved specimens (Huang 1979). Damage to adult specimens during collection often complicates the species identification process. Moreover, the day biting habit of the Aedes (Stegomyia) species renders adult collection cumbersome. Although collection of aquatic stages (larvae and pupae) is relatively easy, their identification is very difficult owing to overlapping morphological characteristics among the species of the subgenus Stegomyia. Rearing early instars of Aedes larvae into adults is not always feasible under laboratory conditions. Mortality is high during the rearing process. Rearing is time-consuming, and it takes about 10 days before identification can be made. Molecular species identification methods are very precise irrespective of stage and quality of the specimen (Marrelli et al. 2006).

The advent of molecular biology has led to the expansion of identification protocols by providing molecular tools to distinguish ‘cryptic’ species of Anopheles, Aedes and Culex mosquitoes. This has greatly improved our understanding of the transmission and epidemiology of vector-borne diseases (Smith & Fonseca 2004). Beebe et al. (2007) developed a molecular identification technique for container-breeding mosquito species, including Ae. aegypti and Ae. albopictus, which allowed them to differentiate mosquito species using PCR. However, this method requires the use of restriction enzymes after PCR. Hence, a multiplex PCR method would be cheaper, faster and precise in identifying the species.

Ribosomal DNA has been mainly used for molecular identification because it is one of the multigene families frequently distributed in the genome. Many researchers have used ribosomal DNA regions for molecular studies of Aedes mosquitoes (Hill et al. 2008; De Jong et al. 2009). Eukaryotic ribosomal DNA (rDNA) contains two internal transcribed regions (ITS1 and ITS2), flanked by the 18S ribosomal region and the 28S ribosomal region, which are more conserved. Comparisons of rDNA sequences of different species have shown that while regions within ribosomal RNA coding sequences 18S rDNA and 28S rDNA are evolutionarily very highly conserved, the sequence of the spacer regions is highly variable even between closely related species. The highly conserved nature of the 18S rDNA among the Aedes species makes it an invaluable tool for designing the primers for species identification (Gale & Crampton 1989).

Studies aimed at the molecular identification of Aedes vectors are limited in comparison with malaria research, despite the medical importance of diseases such as dengue, yellow fever and chikungunya (Cook et al. 2005). Our main objective was to develop a simple and rapid single-step multiplex PCR assay to clearly differentiate the aquatic stages of Ae. aegypti, Ae. albopictus and Ae. vittatus collected from different breeding spots in arbovirus endemic/epidemic areas and to detect the most abundant species in the region.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Selection of study area

The state of Orissa is divided into four distinct physiogeographical regions: northern plateau, central tableland, coastal plains and Eastern Ghats. The coastal plains have been the most endemic areas for arboviral outbreaks as per the Government of Orissa, Health Department. In our study, various areas were selected from the coastal belt for the collection of samples (Figure 1). The study was carried out in four districts of Orissa, India, that is Puri, Khurdha, Kendrapara and Jagatsinghpur. The aquatic stages were collected from different containers in urban and rural areas of each district.

image

Figure 1.  Map of Orissa showing the study areas shaded.

Download figure to PowerPoint

Collection of samples

Larval and pupal samples were collected by a collection team, which consisted of mosquito scouts, a collector and a recorder. Their collecting kit consisted of the usual equipment for collecting mosquito larvae (electric torch, pipettes, ladles, etc.) and plastic bottles, each labelled to correspond with the different categories of breeding habitats. All indoor and outdoor water-containing receptacles were searched for mosquito larvae and pupae in domestic houses and business centres. Various breeding spots with water, viz. discarded tires, earthen pots, cement tanks, tree holes, air coolers, discarded small and large wastes were searched thoroughly. Larvae were collected from each occupied habitat by dip method or by a Pasteur pipette in case of small containers (WHO 1975). They were then transferred into a collection bottle, labelled and brought to the laboratory. When a pupa was found, it was transferred to a collection bottle by pipette and then classified according to its breeding spot.

Laboratory processing

Initially, DNA was extracted from larvae, pupae and adult stages of known samples of Ae. aegypti, Ae. albopictus and Ae. vittatus, collected from different geographical locations of Orissa. Genomic DNA was extracted by phenol–chloroform method (Coen et al. 1982). The extracted DNA was stored at −20 °C for further use.

The 18S rDNA sequences of Ae. aegypti, Ae. albopictus and Ae. vittatus were retrieved from GenBank and aligned using ClustalW. The 18S rDNA universal forward 5′-TCAAAATTAAGGGTAGTGGT-3′ and universal reverse 5′-GACTTCAACTGGCTTGAACT-3′ primers were designed from the conserved regions in the 18S ribosomal DNA of the three Aedes species by using Primer3 software. The PCR mixture consisted of 1× PCR buffer, 1.5 mm MgCl2, 200 μm dNTP, 0.6 μm of each primer, 1 unit of Taq DNA polymerase (Genei, Bangalore, India), 50 ng DNA of larva, pupa and adult and nuclease-free water per 30 μl reaction. Negative control (PCR mix without DNA) was added in the reaction for testing the correctness of the PCR reagents. The PCR was carried out individually for each stage so that precise amplification of the 18S rDNA was achieved for each stage. The samples were initially denatured at 94 °C for 5 min, followed by 35 cycles of amplification at 94 °C for 30 s, 60.5 °C for 40 s and 72 °C for 1 min. Final extension was carried out at 72 °C for 5 min. To check the amplification, 10 μl of the PCR product was subjected to electrophoresis in 1.5% agarose gel with 1× TBE buffer and stained with ethidium bromide. The PCR product was excised from gel, purified using QIAquick Spin Column (Qiagen, Hilden, Germany) and directly sequenced in a 16 capillary automated DNA sequencer (Applied Biosystems, Foster City, CA, USA) with both the universal forward and universal reverse primer in two sets of reaction following the manufacturer’s instructions. The sequences generated were submitted to GenBank and used for designing species-specific primers of the three Aedes mosquitoes.

Species-specific primer design

Species-specific primers were designed from the sequence of individual specimens, which were generated by sequencing and submitted to GenBank. The 18S rDNA sequences of all the three species were aligned using ClustalW, and primers were designed (Figure 2). Species-specific primers were designed in such a way that minimum of one nucleotide variation within the primer sequence in each of the three species was present. The location for primer sequences was chosen from the regions of nucleotide differences between the three Aedes species, and care was taken to obtain PCR products that could be easily distinguished on agarose gel. The PCR primers for the assay were designed using Primer3 software24 to assist the assessment of primer melting temperature (Tm) compatibility and hairpin formation. Table 1 provides the oligonucleotide sequences for each primer as well as the Tm and GC% of the primers.

image

Figure 2.  Sequence alignment of the three Aedes species showing the location of the universal and species-specific primers AUF and AUR denote universal forward and reverse primers respectively. AEG, AEL and AEV denote species-specific primers for Aedes aegypti, Aedes albopictus and Aedes vittatus, respectively.

Download figure to PowerPoint

Table 1.   Primers used for the multiplex PCR assay with nucleotide sequences, respective melting temperatures (Tm), GC % and size of amplified fragments
SpeciesPrimer nameSequence (5′–3′)Tm (°C)No. of basesGC (%)Size (bp)
Universal forward primerAUFTCAAAATTAAGGGTAGTGGT55.22035577
Universal reverse primerAURGACTTCAACTGGCTTGAACT58.52045
Aedes vittatusAEVGTGAGCAGCAACGCGTATCCT69.22157265
Aedes albopictusAELGCAACGGTCGCTCGCGACAC79.32070440
Aedes aegyptiAEGGACACCGAGGCGCCCATTGC76.22070157

Validation and optimization of species-specific PCR

The species-specific PCR was validated by testing primer with known larval, pupal and adult pools of Ae. aegypti, Ae. albopictus and Ae. vittatus collected from different geographical locations of Orissa. Universal forward (AUF) and reverse primers (AUR) were mixed with each of the three species-specific primers, that is Ae. aegypti (AEG)/Ae. albopictus (AEL)/Ae. vittatus (AEV), in three reaction tubes, and PCR was carried out to clearly differentiate the three species. To ensure primer specificity, the species-specific PCR was validated by performing PCR with the combination of species-specific primers with template DNA from the three mismatched Aedes species and also with non-target species like Anopheles, Culex etc. collected from different areas and identified. The species-specific PCR was optimized in a final volume of 25 μl containing 1× PCR buffer (Genei), 1.5 mm MgCl2, 300 μm dNTP mix, 0.6 μm AUF, AUR and 1 μm AEG/AEL/AEV, 1 unit of Taq polymerase (Genei), 100 ng of DNA of larva, pupa and adult pools of Ae. aegypti, Ae. albopictus and Ae. vittatus, nuclease-free water and a negative control. The PCR was carried out individually for each stage using species-specific primers so as to check the sensitivity of the primer with each stage. After an initial denaturation procedure at 94 °C for 5 min, 35 cycles were programmed as follows: 94 °C for 30 s, 60.5 °C for 40 s and 72 °C for 1 min and final extension at 72 °C for 5 min. It was ensured that none of the amplified products interfered with each other to get a better visualization of PCR assay in the gel. Amplicons were resolved by electrophoresis on a 1.5% agarose gel with 1× TBE buffer and stained with ethidium bromide.

Evaluation of multiplex PCR

Initially, aquatic stages (larvae and pupae) of different mosquito species were collected from different areas and categorized systematically according to breeding spots. A total of 1150 aquatic stages were collected and grouped into 230 pools (200 larval pools and 30 pupal pools). The pool size depended on the number of larvae/pupae collected from different breeding spots. Five larvae/pupae per pool were used for DNA isolation. DNA was extracted from each pool by phenol–chloroform method (Coen et al. 1982). A single-step reaction was developed for the detection of the three Aedes species using all the species-specific primers. In a final volume of 25 μl, the PCR mix contained 1× PCR buffer, 2 mm MgCl2, 300 μm dNTP mix, 1 μm AEG primer, 1.5 μm AEV primer, 1 μm AEL primer, 1.5 unit of Taq polymerase (Genei), 100 ng of DNA template, nuclease-free water and a negative control. After initial denaturation at 94 °C for 5 min, 35 cycles were programmed as follows: 95 °C for 30 s, 61 °C for 40 s, 72 °C for 1 min and final extension at 72 °C for 5 min. The PCR products were subjected to electrophoresis on 2% agarose gel stained with ethidium bromide.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Collection of samples

Three species of Aedes were identified from eight types of breeding spots both from indoors and outdoors (Table 2). Most habitats were artificial and were present near to human dwellings in the areas surveyed. Of 294 breeding spots searched, 156 contained aquatic stages of Aedes species. The greatest number was collected from peridomestic breeding spots, that is tires and large and small discarded wastes. Discarded tires were the most common breeding spots in the regions surveyed.

Table 2.   Distribution, classification, number of breeding spots and type of species identified by multiplex PCR
Relative distributionType of breeding spotNo. of spots searchedNo. of larvae positive spotsType of species identified by multiplex PCR
IndoorsEarthen pots4716Aedes albopictus
Air coolers, jars282Ae. albopictus
OutdoorsDiscarded tires7960Ae. albopictus, Aedes aegypti
Tree holes197Ae. aegypti, Aedes vittatus
Stony pits104Ae. vittatus
Cement tanks154Ae. albopictus
Discarded small wastes, plastic, glass bottles6539Ae. albopictus, Ae. aegypti
Discarded large waste drums, jars3124Ae. albopictus, Ae. aegypti
Total8 types294156 

Polymerase chain reaction and sequencing of 18S rDNA region

Genomic DNA of the Aedes mosquitoes was amplified using 18S rDNA common primers, AUF and AUR, yielding a product size of 577 bp. The common band 577 bp was distinctly found in larva, pupa and adult stages of the three Aedes species (Figure 3). The novel sequences obtained in the process were submitted to GenBank, NCBI [GenBank Accession Nos: JN008729 (Ae. vittatus larva), JN008730 (Ae. vittatus pupa) JN008731 (Ae. vittatus adult) HM486433 (Ae. aegypti larva), HM486434 (Ae. aegypti pupa), HM486436 (Ae. aegypti adult), JN008732 (Ae. albopictus larva), JN008733 (Ae. albopictus pupa) and JN008734 (Ae. albopictus adult)].

image

Figure 3.  Agarose gel of 18S rDNA PCR using universal primers showing the common band of 577 bp in different stages of the three Aedes species, which was used to design species-specific primers after sequencing. Lanes 1, 2 and 3 represent larva, pupa and adult stages of Aedes aegypti; lanes 4, 5 and 6 represent larva, pupa and adult stages of Aedes albopictus; and lanes 7, 8 and 9 represent larva, pupa and adult stages of Aedes vittatus, respectively. M is the 100 bp ladder and NC represents negative control.

Download figure to PowerPoint

Species-specific PCR

The lengths of amplified species-specific products of the larva, pupa and adult samples of the three Aedes species were 157 bp for Ae. aegypti, 440 bp for Ae. albopictus and 265 bp for Ae. vittatus, along with a common band of 577 bp in all three species (Figure 4). The species-specific PCR precisely amplified only the target species and did not amplify any non-target species irrespective of template DNA concentration of the non-target species in the reaction.

image

Figure 4.  Species-specific PCR gel in larva, pupa and adult pools of Aedes species: all lanes demonstrated a common band of 577 bp. Lanes 1,2 and 3 represent larva, pupa and adult stages of Aedes aegypti showing specific band at 157; lanes 4, 5 and 6 represent larva, pupa and adult stages of Aedes albopictus showing specific band at 440 bp; and lanes 7,8 and 9 represent larva, pupa and adult stages of Aedes vittatus showing specific band at 265 bp. M is the 100 bp DNA ladder and NC is the negative control.

Download figure to PowerPoint

Multiplex PCR

The lengths of amplified products were 157 bp for Ae. aegypti, 440 bp for Ae. albopictus and 265 bp for Ae. vittatus (Figures 5 and 6). None of the amplified products interfered with each other and so gave a better visualization of the single PCR assay in the gel. Of 230 pools (200 larval pools and 30 pupal pools) examined by multiplex PCR, 214 pools (191 larval pools and 23 pupal pools) consisted of Aedes species. Remaining pools consisted of mosquito species other than Aedes, which did not amplify by the multiplex PCR. Aedes albopictus was detected in 91 larval pools derived from cement tanks, air coolers, discarded tires, earthen pots, discarded small wastes and discarded large wastes and 14 pupal pools obtained from pots, tires, tanks and small wastes. Aedes aegypti was detected in 55 larval pools derived from discarded tires, tree holes, discarded small wastes and discarded large wastes and five pupal pools obtained from tires and tree holes. Aedes vittatus was detected in 31 larval pools, and three pupal pools derived from stony pits. Aedes albopictus and Ae. aegypti was detected together in five, four and two larval pools derived from discarded tires, discarded small plastic wastes and large wastes and one pupal pool obtained from tires. Aedes aegypti and Ae. vittatus was both detected in three larval pools derived from tree holes (Tables 3 and 4).

image

Figure 5.  Multiplex PCR gel: ethidium bromide–stained agarose gel picture showing Aedes larval pools collected from different breeding spots. Lane 1, 2 and 6 showed a single band of 440 bp (Aedes albopictus) collected from earthen pots, air coolers and cement tanks; lane 3, 7 and 8 showed two bands 440 and 157 bp (Ae. albopictus and Aedes aegypti) collected from discarded tires, discarded small wastes and large wastes; lane 4 showed two bands of 265 and 157 bp (Aedes vittatus and Ae. aegypti) collected from tree holes; and lane 5 showed single band of 265 bp (Ae. vittatus) collected from stony pits. M is the 100 bp DNA ladder and NC is the negative control.

Download figure to PowerPoint

image

Figure 6.  Multiplex PCR gel: ethidium bromide–stained agarose gel picture showing pupal pools of Aedes species collected from different breeding spots. Lane 1, 5 and 6 showed a single band of 440 bp (Aedes albopictus) collected from earthen pots, cement tanks and small wastes, plastic; lane 2 showed two bands 440 and 157 bp (Ae. albopictus and Aedes aegypti) collected from discarded tires; lane 3 showed single band of 157 bp (Ae. aegypti) collected from tree holes; and lane 4 showed single band of 265 bp (Aedes vittatus) collected from stony pits. M is the 100 bp DNA ladder and NC is the negative control.

Download figure to PowerPoint

Table 3.   Number of larval pools of Aedes species tested and identified by multiplex PCR collected from different breeding spots (total larvae tested n = 1000/200 pools)
Species identifiedCement tanksAir coolersDiscarded tires*Tree holes†Stony pitsEarthen potsDiscarded small wastes*Discarded large wastes*Total no of pools
  1. *Five, four and two pools derived from discarded tires, small wastes and large wastes comprised both Aedes albopictus and Aedes aegypti.

  2. †Three pools derived from tree holes comprised both Aedes aegypti and Aedes vittatus.

No. of pools tested114582721124720200
Aedes aegypti181216955
Aedes albopictus104321225891
Aedes vittatus112031
Table 4.   Number of pupal pools of Aedes species tested and identified by multiplex PCR collected from different breeding spots (total pupae tested n = 150/30 pools)
Species identifiedEarthen potsDiscarded tiresTree holes*Stony pitsCement tanksSmall wastes, plasticTotal no. of pools
  1. *One pool from discarded tires comprised both Aedes aegypti and Aedes albopictus.

No. of pools tested27636630
Aedes aegypti235
Aedes albopictus234514
Aedes vittatus33

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Timely and accurate identification of possible incursion species during arboviral surveillance is important in terms of providing rapid control measures for the success of vector control programs. Molecular-based study has its own advantages, as it is easier to perform, sensitive, applicable to all stages of both sexes, does not require highly skilled personnel and can be applied to specimens that are unsuitable for morphological taxonomy, that is injured or damaged field-collected specimens (Swain et al. 2010). Conventional identification methods have limitations for sibling and closely related species of mosquitoes, stage and quality of the specimen used, and this could be overcome by DNA-based identification methods using molecular markers such as the 18S rDNA, which do not demand intact or undamaged specimens.

In this study, we describe a simple multiplex PCR assay that clearly distinguished the aquatic stages of the three Aedes species, that is Ae. aegypti, Ae. albopictus and Ae. vittatus in a pool of mixed populations. Using sequences within the 18S rDNA, we were able to identify regions that were suitable for primer design and that were conserved within, but variable among the three species of Aedes mosquitoes. The 18S rDNA sequence was similar in larva, pupa and adult stage of each species. Few nucleotide differences, which were observed in the 18S rDNA of the three Aedes species, were exploited to design the three species-specific primers positioned along the 18S rDNA region of the respective species. The method was validated using known larva, pupa and adult stages of the three Aedes species and yielded good PCR results. Thus, this method can be used for the identification of adult as well as aquatic stages of the three Aedes vectors during vector surveillance in arboviral outbreaks like chikungunya, where recent studies have shown the possibility of transovarial transmission of chikungunya virus by Aedes species (Mavale et al. 2010; Niyas et al. 2010). The specificity of the multiplex PCR method was checked by performing PCR with DNA templates of non-target species (Anopheles, Culex), which in turn produced fragments of only the target species that will clearly differentiate the three Aedes species without amplifying the non-target species. This was important for accurate identification, because when collecting aquatic stages, mixed populations of different species such as Aedes, Culex and Armigeres were gathered owing to their morphological similarities, whereas only Aedes species were amplified in a pool of mixed species by the multiplex PCR.

The study showed that most collections of Aedes species were carried out from outdoor breeding spots viz, discarded tires and small and large wastes. Indoor breeding spots were very rare, which indicated Aedes species breeds mainly in peridomestic and outdoor areas. Aedes albopictus was detected in the majority of breeding spots, followed by Ae. aegypti. Aedes vittatus was rare and found in stony pits and tree holes. The detection of Ae. aegypti and Ae. albopictus together in most of the breeding spots indicates that both species interbreed and hence can influence the vectorial attributes of each other during transmission of arbovirus. As Ae. albopictus was the most abundant species detected in different breeding spots, it can be inferred as the main vector found in this region and attributed to recent outbreaks of arboviral diseases in the areas surveyed. Therefore, appropriate control measures must be taken against Ae. albopictus to prevent an arboviral outbreak in near future.

PCR-based identification of closely related mosquito species, such as the three Stegomyia species studied here, proved an appropriate method. The multiplex PCR method was very sensitive and successful with different life stages. Multiplex PCR assay provided a rapid means for identifying the three Stegomyia species with a high degree of accuracy and could be a useful tool for detecting and effectively monitoring Aedes species, mainly in arbovirus endemic/epidemic areas where several species coexist.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We are grateful to Mr B. Pradhan, Mr C. S. Tripathy, Mr G. Simachalam and Mr S. S. Beauria for technical help. We are very grateful to B. K. Das, U. Mohanty, S. Das, S. Mohanty and Dr R. Das, Professor, PGIMER, Chandigarh, for their immense support during the course of the study. This work was supported by the extramural funds of Indian Council of Medical Research, Government of India. Biswadeep Das was supported by the junior research fellowship of Indian Council of Medical Research (ICMR), New Delhi.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Barraud PJ (1934) The fauna of British India, including Ceylon and Burma. Diptera, V, Family Culicidae, Tribe Megharini and Culicini Taylor and Francis, London, pp. 217246.
  • Beebe NW, Whelan PI, Van den Hurk AF, Ritchie SA, Corcoran S & Cooper RD (2007) A polymerase chain reaction-based diagnostic to identify larvae and eggs of container mosquito species from the Australian region. Journal of Medical Entomology 44, 376380.
  • Coen E, Strachan T & Dover G (1982) Dynamics of concerted evolution of ribosomal DNA and histone gene families in the melanogaster species subgroup of Drosophila. Journal of Molecular Biology 158, 1735.
  • Cook S, Diallo M, Sall AA, Cooper A & Holmes EC (2005) Mitochondrial markers for molecular identification of Aedes mosquitoes (Diptera: Culicidae) involved in transmission of arboviral disease in West Africa. Journal of Medical Entomology 42, 1928.
  • De Jong L, Moreau X, Dalia J, Coustau C & Thiery A (2009) Molecular characterization of the invasive Asian tiger mosquito, Aedes (Stegomyia) albopictus (Diptera: Culicidae) in Corsica. Acta Tropica 112, 266269.
  • Dwibedi B, Mohapatra N, Beuria MK, Kerketta AS, Sabat J & Kar SK (2010) Emergence of chikungunya virus infection in Orissa, India. Vector Borne and Zoonotic Diseases 10, 347354.
  • Gale K & Crampton J (1989) The ribosomal genes of the mosquito, Aedes aegypti. European Journal of Biochemistry 185, 311317.
  • Hill LA, Davis JB, Hapgood G, Whelan PI, Smith GA & Ritchie SA (2008) Rapid identification of Aedes albopictus, Aedes scutellaris, and Aedes aegypti life stages using real-time polymerase chain reaction assays. American Journal of Tropical Medicine and Hygiene 79, 866875.
  • Huang YM (1979) The subgenus Stegomyia of Aedes in the Oriental region with keys to the species (Diptera: Culicidae). Contributions of the American Entomological Institute 15, 182.
  • Jupp PG & McIntosh BM (1990) Aedes furcifer and other mosquitoes as vectors of chikungunya virus at Mica, northeastern Transvaal, South Africa. Journal of the American Mosquito Control Association 6, 415420.
  • Lahariya C & Pradhan SK (2006) Emergence of chikungunya virus in Indian subcontinent after 32 years: a review. Journal of Vector Borne Diseases 43, 151160.
  • Marrelli MT, Sallum MAM & Marinotti O (2006) The second internal transcribed spacer of nuclear ribosomal DNA as a tool for Latin American anopheline taxonomy – a critical review. Memórias do Instituto Oswaldo Cruz 101, 817832.
  • Mavale M, Parashar D, Sudeep A et al. (2010) Venereal transmission of chikungunya virus by Aedes aegypti mosquitoes (Diptera: Culicidae). American Journal of Tropical Medicine and Hygiene 83, 12421244.
  • Mourya DT & Banerjee K (1987) Experimental transmission of Chikungunya virus by Aedes vittatus mosquitoes. Indian Journal of Medical Research 86, 269271.
  • Niyas KP, Abraham R, Unnikrishnan RN et al. (2010) Molecular characterization of Chikungunya virus isolates from clinical samples and adult Aedes albopictus mosquitoes emerged from larvae from Kerala, South India. Virology Journal 7, 189.
  • Smith JL & Fonseca DM (2004) Rapid assays for identification of members of the Culex (Culex) pipiens complex, their hybrids, and other sibling species (Diptera: Culicidae). American Journal of Tropical Medicine and Hygiene 70, 339345.
  • Swain S, Mohanty A, Tripathy HK, Mahapatra N, Kar SK & Hazra RK (2010) Molecular identification and phylogeny of Myzomyia and Neocellia series of Anopheles subgenus Cellia (Diptera: Culicidae). Infection, Genetics and Evolution 10, 931939.
  • WHO (1975) Manual on Practical Entomology in Malaria Part-II, Methods Tech. Offset Publication 13. World Health Organization, Geneva, pp. 1186. http://whqlibdoc.who.int/ofset/WHO_OFFSET_13_(part2).pdf. [Accessed 17 January 2008].