SEARCH

SEARCH BY CITATION

Keywords:

  • Lassa fever;
  • Arenavirus;
  • Nigeria
  • fièvre de Lassa;
  • arenavirus;
  • Nigéria
  • fiebre de Lassa;
  • Arenavirus;
  • Nigeria

Abstract

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

Objectives  To estimate the burden of Lassa fever in northern and central Edo, a state in south Nigeria where Lassa fever has been reported.

Methods  Blood samples were obtained from 60 patients hospitalised at the Irrua Specialist Teaching Hospital (ISTH), Irrua, with a clinical suspicion of Lassa fever and from 451 febrile outpatients seen at the ISTH and hospitals in Ekpoma, Iruekpen, Uromi, Auchi and Igarra. All samples were tested retrospectively by Lassa virus-specific RT-PCR. Outpatients were additionally screened for Lassa virus-specific antibodies by indirect immunofluorescent antibody assay.

Results  Lassa virus was detected in 25 of 60 (42%) patients with a clinical suspicion of Lassa fever. The disease affected persons of all age groups and with various occupations, including healthcare workers. The clinical picture was dominated by gastrointestinal symptoms. The case fatality rate was 29%. Lassa virus was detected in 2 of 451 (0.44%) febrile outpatients, and 8 (1.8%) were positive for Lassa virus-specific IgG.

Conclusions  Lassa fever contributes to hospital mortality in Edo State. The low prevalence of the disease among outpatients and the low seroprevalence may indicate that the population-level incidence is not high. Surveillance for Lassa fever should focus on the hospitalised patient.

Objectifs:  Estimer la charge de morbidité de la fièvre de Lassa dans le nord et le centre d’Edo, un Etat du sud du Nigeria, où la fièvre de Lassa a été rapportée.

Méthodes:   Des échantillons sanguins ont été obtenus à partir de 60 patients hospitalisés à l’Hôpital d’Enseignement Spécialisé de Irrua (ISTH), avec une suspicion clinique de fièvre de Lassa et à partir de 451 patients ambulatoires fébriles vus à l’ISTH et dans les hôpitaux de Ekpoma, Iruekpen, Uromi, Auchi et Igarra. Tous les échantillons ont été analysés rétrospectivement avec le test RT-PCR spécifique du virus de Lassa. Les patients ambulatoires ont en plus été dépistés pour les anticorps spécifiques du virus de Lassa par un test indirect d’immunofluorescence.

Résultats:  Le virus de Lassa a été détecté chez 25 des 60 (42%) patients avec une suspicion clinique de fièvre de Lassa. La maladie affectait les personnes de tous les groupes d’âge et de diverses professions, y compris les agents de la santé. Le tableau clinique était dominé par des symptômes gastro-intestinaux. Le taux de létalitéétait de 29%. Le virus de Lassa a été détecté chez 2 des 451 (0,44%) patients ambulatoires fébriles et 8 (1,8%) d’entre eux étaient positifs pour les IgG spécifiques du virus de Lassa.

Conclusions: La fièvre de Lassa contribue à la mortalité hospitalière dans l’État d’Edo. La faible prévalence de la maladie chez des patients ambulatoires et la faible séroprévalence pourrait indiquer que l’incidence à l’échelle de la population n’est pas élevée. La surveillance de la fièvre de Lassa devrait se concentrer sur les patients hospitalisés.

Objetivos:  Calcular la carga por fiebre de Lassa en el norte y centro de Edo, un estado del sur de Nigeria, en donde se han reportado casos de fiebre de Lassa.

Métodos:  Se obtuvieron muestras de sangre de 60 pacientes con sospecha clínica de fiebre de Lassa, hospitalizados en el Hospital Universitario de Irrua, y de 451 pacientes febriles atendidos en las consultas externas del ISTH y los hospitales de Ekpoma, Iruekpen, Uromi, Auchi, e Igarra. Todas las muestras fueron testadas de forma retrospectiva mediante una RT-PCR específica para el virus de Lassa. A las muestras de los pacientes vistos en consultas externas se les realizó adicionalmente un ensayo de inmunofluorescencia indirecta para buscar anticuerpos específicos contra el virus de Lassa.

Resultados:  Se detectó el virus de Lassa en 25 de 60 (42%) pacientes con una sospecha clínica de fiebre de Lassa. La enfermedad afectaba a personas dentro de todos los grupos de edad y con diferentes ocupaciones, incluyendo a trabajadores sanitarios. El cuadro clínico estaba dominado por síntomas gastrointestinales. La tasa de mortalidad era del 29%. Se detectó el virus de Lassa en 2 de 451 (0.44%) pacientes externos febriles; y 8 (1.8%) tenían un resultado positivo en la prueba de IgG específico para el virus de Lassa.

Conclusiones:  La fiebre de Lassa contribuye a la mortalidad hospitalaria en el Estado de Edo. La baja prevalencia de la enfermedad entre los pacientes externos y la baja seroprevalencia podría indicar que la incidencia a nivel de la población no es alta. La vigilancia de la fiebre de Lassa debería centrarse en los pacientes hospitalizados.

Lassa fever is an acute and often fatal febrile illness caused by Lassa virus. It is a public health problem in Nigeria since its first description in 1969 in Lassa town in north-eastern Nigeria (Frame et al. 1970). Lassa virus is transmitted by the rodent Mastomys natalensis, which serves as a reservoir of the virus (Lecompte et al. 2006). The virus may further be transmitted from human to human causing nosocomial epidemics (Fisher-Hoch et al. 1995). The first incidence that implicated Lassa virus circulation in Edo State was in 1989, when a man died of Lassa fever in the USA after returning from a visit to Ekpoma, central Edo (Holmes et al. 1990). In 2002, clinical surveillance started at Irrua Specialist Teaching Hospital (ISTH), Irrua, Edo State. Pilot investigations at ISTH in 2003 and 2004 demonstrated ongoing transmission of Lassa virus (Omilabu et al. 2005), but still there were no facilities for adequate laboratory diagnosis. Consequently, data on incidence and public health burden of Lassa fever are lacking. Since 2005, surveillance at ISTH has been intensified and extended to five other major hospitals in the northern and central part of Edo State. The results of these surveillance efforts are presented here.

Blood samples from 60 hospitalised patients with a clinical suspicion of Lassa fever were collected in the clinical and emergency departments of ISTH from November 2005 to February 2008 (2005, 1; 2006, 1; 2007, 12; 2008, 45). Lassa fever was suspected in a febrile patient if malaria or bacterial infection were rendered unlikely by laboratory investigation or if fever persisted despite anti-malarial and antibiotic treatment. In addition, known signs of Lassa fever were considered (McCormick et al. 1987). The doctor responsible for the patient’s care raised the suspicion. Demographic data of patients and main symptoms at the time of sampling were recorded. In 2008, 451 blood samples were collected from febrile patients seen at outpatient departments of ISTH (n = 159) and five other hospitals, namely General Hospital Ekpoma (n = 51), General Hospital Iruekpen (n = 98) and Central Hospital Uromi (n = 59) located in the Edo Central Senatorial District; Central Hospital Auchi (n = 38) and General Hospital Igarra (n = 46) located in the Edo North Senatorial District (Figure 1). Patients were not selected, and malaria and typhoid fever were not excluded. Blood and demographic data were collected after obtaining informed consent from the patients or their relatives. The Ethics Committee of ISTH and the Hospitals Management Board of Edo State approved this study.

image

Figure 1.  Map of Edo State showing locations of study sites. The Southern, Northern and Central Senatorial District is indicated in white, light grey and dark grey, respectively. Benin City is the Capital of Edo State.

Download figure to PowerPoint

Serum samples were stored at −20 °C and tested retrospectively. Viral RNA was extracted from serum using the QIAamp viral RNA Mini Kit (Qiagen, Hilden, Germany). Sera from outpatients were pooled by four for initial screening. A 320-base pair fragment of the glycoprotein gene was amplified by using the QIAGEN OneStep RT-PCR Kit and primers 36E2 (ACCGGGGATCCTAGGCATTT) and LVS-339-rev (GTTCTTTGTGCAGGAMAGGGGCA TKGTCAT) as described (Ölschläger et al. 2010). Amplified fragments were purified and sequenced.

Serum specimens of outpatients were additionally screened for Lassa virus-specific IgM and IgG by indirect immunofluorescent antibody assay using Lassa virus-infected cells. Cells were infected with Lassa virus in the biosafety level 4 laboratory in Hamburg, Germany, and spread onto immunofluorescence slides, air dried and acetone-fixed. The cells were incubated with serum diluted at 1:20 or higher. Antibodies against Lassa virus were detected by anti-human IgM or IgG labelled with fluorescein isothiocyanate (Dianova, Germany). Samples were considered positive if a typical cytoplasmic dot-like fluorescence pattern was observed and the titre was ≥1:20.

Lassa virus was detected by RT-PCR in 25 of 60 patients (42%; 15 men, 10 women) with a clinical suspicion of Lassa fever. Sequencing the diagnostic PCR fragment or virus isolation (successful for strains Nig08-A37, Nig08-A41 and Nig08-A47) confirmed the diagnosis. A representative set of 18 sequences (strains Nig05-A08, Nig07-A09, Nig07-A14, Nig07-A76, Nig08-A34, Nig08-A37, Nig08-A40, Nig08-A41, Nig08-A45, Nig08-A47, Nig08-A53, Nig08-A55, Nig08-A57, Nig08-A61, Nig08-A64, Nig08-A72, Nig08-A77 and Nig08-A80) has been submitted to GenBank (accession nos. GU481074GU481079 and HM143866HM143881) and analysed phylogenetically in a previous study (Ehichioya et al. 2011). Twenty-one (84%) of the samples were collected between October 2007 and February 2008 suggesting an epidemic during this dry season (Harmattan). However, a sampling bias because of increased awareness may not be excluded. The median age of Lassa fever patients was 25 years, although all age groups were affected (range: 1.5–61 years). Most of the patients (68%) originated from the vicinity of ISTH: 6 from Irrua, 6 from Ekpoma, 4 from Uromi and 1 from Iruekpen (all Edo Central Senatorial District). Two patients came from Auchi and 2 from other parts of the Edo North Senatorial District. The remaining patients came from other parts of Edo or other States. Lassa fever was diagnosed in persons with various occupations: 10 (38%) students 17–26 years, 5 (19%) traders, 2 (8%) business people, 2 (8%) motor bike riders, 2 (8%) children ≤2 years, 1 (4%) clergy, 1 (4%) farmer and 1 (4%) medical doctor (ISTH staff). A wide spectrum of symptoms was observed in Lassa fever patients (Figure 2). Apart from fever, the clinical presentation was dominated by gastrointestinal symptoms, while bleeding was seen only in few patients. Nearly all patients (84%) were treated with ribavirin on the basis of the clinical suspicion. The case fatality rate was 29%.

image

Figure 2.  Spectrum of clinical symptoms in patients with Lassa fever. Clinical data were available for 22 patients (100%).

Download figure to PowerPoint

In the second part of the survey, 451 serum specimens were obtained from febrile patients attending outpatient departments at several hospitals in the Edo North and Central Senatorial Districts (Figure 1). Out of these, only 2 (0.44%) febrile patients, seen at the hospitals in Uromi and Ekpoma in 2008, were positive by Lassa virus RT-PCR. The sequences of the PCR products have been submitted to GenBank (strains Nig08-MO and Nig08-EO4, accession nos. JQ511991JQ511992). They were closely related but not identical to the other sequences from Edo State. Both patients were Lassa virus IgM and IgG-negative and viral load was low. Except of fever, no major symptoms were recorded. Thus, both cases probably were a mild form of Lassa fever. Lassa virus-specific IgG antibodies were found in 8 patients (1.8%): 4 from ISTH and 4 from Central Hospital Uromi. Lassa virus-specific IgM was not detected in any of the patients.

This study confirms the endemic occurrence of Lassa fever in Edo State. The disease affects persons of all age groups and with various occupations. It is likely that the medical doctor who was diagnosed in this study with Lassa fever and died from the disease (Lassa virus was also detected in a post-mortem sample) became infected in the hospital. In conjunction with our recent report on Lassa fever among healthcare workers in other States of Nigeria (Ehichioya et al. 2010), this indicates that nosocomial transmission of the virus is still a major problem and may be tackled only if Lassa fever patients are identified in time to facilitate appropriate case and contact management. Indeed, no more healthcare workers died at ISTH from Lassa fever since a laboratory for routine testing of Lassa virus was established directly at the hospital end of 2008 (D. Asogun and S. Günther, unpublished data).

The high proportion of students among Lassa fever patients is also alarming, as this may suggest that the housing conditions of students are poor and facilitate transmission of virus from rodents to humans. The observed clinical symptoms largely correspond to those reported previously in other Lassa fever endemic areas (McCormick et al. 1987).

It is important to note that gastrointestinal symptoms rather than bleeding dominated the clinical picture, which is relevant when raising a suspicion. Rather unexpectedly, the incidence of Lassa fever among outpatients was low. This suggests that the severity of Lassa fever is usually of a magnitude such that patients attend the emergency rather than the general outpatient department. This has implications for hospital-based surveillance for Lassa fever, which should focus on hospitalised patients.

Similarly, the low prevalence of Lassa virus-specific IgG antibodies among outpatients was surprising, as this group may roughly reflect the general population in the area. However, it has to be considered that the population served by the study hospitals (Edo North and Central Senatorial Districts) is estimated to be 1.5 million (Anonymous 2006). Thus, even if a considerable number of severe Lassa fever cases are seen in the hospital, the morbidity rate in this large population may be low. Population-based studies to determine the overall prevalence and incidence of Lassa fever in the area, as well as risk factors for transmission are needed.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

The study was supported by grant I/82 191 from the Volkswagen Foundation, grant GU 883/1-1 from the German Research Foundation (DFG), and FP7 grant 228292 (European Virus Archive) from the European Community. We thank the Chief Medical Directors and the staff of the study centres for their cooperation, Ebunoluwa Momodu and Joy Ehichioya for help with sampling, and Adeniyi Adeneye for help with data analysis. The Department of Virology of the Bernhard-Nocht-Institute is a WHO Collaborating Centre for Arbovirus and Haemorrhagic Fever Reference and Research (DEU-000115).

References

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References