Novel quadruple mutations in dihydropteroate synthase genes of Plasmodium falciparum in West Bengal, India

Authors


Corresponding Author Somenath Roy, Immunology and Microbiology Laboratory, Department of Human Physiology with Community Health, Vidyasagar University, Midnapore 721 102, West Bengal, India. Fax: +91 3222 275329; E-mail: roysomenath@hotmail.com

Abstract

Objective  To evaluate the anti-folate (sulphadoxine)-resistant pattern in Kolkata, one of the malaria endemic zones of Eastern India.

Methods  At first, 107 P. falciparum suspected cases were enrolled in this study. Ninety isolates (84.11%) of 107 suspected cases were analysed, as they had mono-infection with P. falciparum. In vitro susceptibility assays were performed in all 90 isolates. Parasitic DNA was isolated by phenol-chloroform extraction method and polymerase chain reaction was followed by restriction fragment length polymorphism analysis of different codons of the pfdhps gene (436, 437, 540, 581 and 613).

Results  Among 90 isolates from Kolkata, dhps mutant isolates at codons 436, 437, 540, 581 and 613 were found in 53.33%, 67.78%, 46.66%, 15.56% and 45.55%, respectively. In vitro sulphadoxine resistance was found in 49 isolates (54.44%). Interestingly we found 33 isolates (36.67%) with quadruple AGEAT mutant allele, of which 32 isolates (96.97%) were highly sulphadoxine resistant (P < 0.01) in vitro.

Conclusion  Our present findings implicate that because of enormous drug (sulphfadoxine) pressure, novel AGEAT mutation was highly correlated (P < 0.01) with sulphadoxine resistance.

Abstract

Objectif:  Evaluer le profile résistant anti-folate (sulfadoxine) à Kolkata, l’une des zones endémiques du paludisme dans l’est de l’Inde.

Méthodes:  Dans un premier temps, 107 cas suspects de P. falciparum ont été enrôlés dans cette étude. 90 isolats (84,11%) des 107 cas suspects ont été analysés, comme ils avaient des mono infections àP. falciparum. Des tests de susceptibilitéin vitro ont été réalisés sur tous les 90 isolats. L’ADN du parasite a été isolé par la méthode d’extraction au phénol chloroforme et la PCR a été réalisée suivie par l’analyse des fragments de restriction des différents codons du gène pfdhps (codons 436, 437, 540, 581et 613).

Résultats:  Parmi les 90 isolats de Kolkata, des isolats mutants pour le dhps au niveau des codons 436, 437, 540, 581 et 613 ont été retrouvés dans 53,33%, 67,78%, 46,66%, 15,56% et 45,55% respectivement. La résistance in vitroà la sulfadoxine a été trouvée chez 49 isolats (54,44%). De façon intéressante, nous avons trouvé 33 isolats (36,67%) avec une mutation quadruples de l’allèle AGEAT et 32 de ces isolats (96,97%) étaient hautement résistants à la sulfadoxine (P <0,01) in vitro.

Conclusion:  Nos résultats présents suggèrent qu’en raison de la forte pression du médicament (sulfadoxine) ces novelles mutations AGEAT étaient fortement corrélées (P <0,01) avec une résistance à la sulfadoxine.

Abstract

Objetivo:  Evaluar los patrones de resistencia a antifolatos (sulfadoxina) en Kolkata, una zonas endémica para malaria de la India oriental.

Métodos:  En un principio se incluyeron en el estudio 107 casos con sospecha de infección por P. falciparum. Se analizaron 90 aislados (84.11%) de los 107 casos sospechosos, puesto que tenían una infección única con P. falciparum. Se realizaron pruebas de susceptibilidad in vitro a los 90 aislados. Se aisló ADN del parásito mediante el método de extracción con fenol-cloroformo y se realizó un análisis de polimorfismo de fragmentos de restricción de diferentes codones del gen pfdhps (436, 437, 540, 581 y 613).

Resultados:  Se hallaron mutaciones en los codones 436, 437, 540, 581 y 613 del gen dhps en un 53.33%, 67.78%, 46.66%, 15.56% y 45.55% de los 90 aislados de Kolkata, respectivamente. Se observó resistencia in vitro a la sulfadoxina en 49 aislados (54.44%). Más aún, encontramos 33 aislados (36.67%) que presentaban un alelo con mutación cuádruple AGEAT, y de estos 32 aislados (96.97%) tenían una alta resistencia in vitro a la sulfadoxina (P<0.01).

Conclusión:  Nuestros hallazgos muestran que, debido a la enorme presión ejercida por los fármacos (sulfadoxina) una nueva mutación AGEAT está significativamente relacionada (P < 0.01) con la resistencia a la sulfadoxina.

Introduction

Malaria is a major vector-borne disease in world, particular in India. In India, chloroquine (CQ) was the first-line drug against Plasmodium falciparum malaria for more than five decades. After emergence of CQ-resistant P. falciparum, sulphadoxine-pyrimethamine (SP) was used as second-line therapy for the treatment for-CQ-resistant P. falciparum malaria, before the use of Artemisinin Combination Therapy (ACT) according to the National Vector Borne Disease Control Programme (NVBDCP) (Guidelines for diagnosis and treatment of malaria in India 2009). Extensive and haphazard use of SP for more than two decades finally led to the development of SP-resistant P. falciparum. Resistance to antifolates generally occurs because of certain point mutations in the dihydrofolate reductase (dhfr) (Basco et al. 1995) and dihydropteroate synthase (dhps) gene (Diourte et al. 1999). Polymorphism in dhfr codon 108 (Ser-108 to Asn-108) represents the core mutation, while additive mutations in dhfr N51I and C59R confer higher levels of resistance. Mutation in dhps Gly-437 is associated with sulphonamide resistance, while additional changes (436-Ala, 540-Glu, 581-Gly, 613- Ser) appear to increase the degree of resistance (Wernsdorfer & Noedl 2003). In our previous laboratory report, we reported that in vitro resistance to pyrimethamine is caused by a double mutation of dhfr (Asn-108 + Ile51) gene (Das et al. 2012). Hence, this study aimed to investigate the genetic diversity of the pfdhps gene in relation to in vitro sulphadoxine resistance after the introduction of ACT in West Bengal, India.

Materials and methods

Study populations

The study was carried out in Kolkata from November 2010 to October 2011 after the launch of ACT by NVBDCP. Initially 107 individuals suspected to have P. falciparum infection were enrolled. Inclusion criteria were fever at consultation or history of fever within the past 24 h, mono-infection with P. falciparum based on the microscopic examination of Giemsa-stain thin and thick blood smears, a parasite density of 1000-200 000 asexual parasites/μl blood and no recent history of self-medication with antimalarial drugs (Andriantsoanirina et al. 2010). Patients with signs and symptoms of severe and complicated malaria, as defined by WHO (2003), were excluded. After confirmation of mono-infection with P. falciparum, samples were processed for in vitro assays, and aliquots were stored at −20 °C before genomic DNA extraction.

Separation of red blood cell (RBC)

Five microliter of venous blood samples were collected from each patient in a vacutainer (BD falcon) coated with an anticoagulant (EDTA). Erythrocytes were separated using Histopaque 1077 density gradient followed by centrifugation at 350 g for 45 min at 4 °C. An aliquot of 1.5–2 ml of red blood cell pellet was obtained. Finally RBC was washed in folate and p-amino benzoic acid-free RPMI 1640 medium three times as described previously (Das et al. 2012).

In vitro drug sensitivity assay

In vitro drug sensitivity tests of clinical isolates were adapted to in vitro culture conditions as described previously (Trager & Jensen 1976; Das et al. 2012). If the blood sample had a parasitemia >1.0%, fresh uninfected O+ erythrocytes were added to adjust the parasitemia to 0.6–1%. Cell culture grade DMSO was used to prepare stock solutions and dilutions of sulphadoxine. The final concentrations were ranged from 12.5 to 25 600 nm for sulphadoxine. Finally, 200 μl per well of the suspension of parasitised erythrocytes were distributed in micro-culture plates (WHO plate), and 25 μl of each concentration of drug was distributed. Two control wells (without drug) were used for the experiment, and each concentration was studied in duplicate or triplicate. Plates were incubated for 48 h at 37 °C in an atmosphere of 5% O2 and 5% CO2. After hypoxanthine incorporation, plates were frozen at −20 °C prior to processing and radioactive counting for determining the IC 50 values (Basco & Ringwald 2000). Calculation was based on the nonlinear regression analysis of the logarithm of concentrations plotted against the percentage growth inhibition. Isolates were defined as susceptible to sulphadoxine when IC50 values were <640 nm, moderately resistant at 640–3000 nm and resistant at >3000 nm. Two culture-adapted cloned strains of P. falciparum (SP-sensitive strain 3D7, SP-resistant W2) were used for quality control.

Isolation of parasitic DNA

Parasitic DNA was extracted from patient erythrocytes as described previously (Basco & Ringwald 2000). Erythrocytes (infected and uninfected) were suspended in 10 ml of ice-cold NET buffer (150 mm NaCl, 10 mm EDTA, 50 mm Tris, pH 7.5) and lysed with 0.015% Saponin (Sigma). The lysate was centrifuged at 2000 g for 10 min at 4 °C, and the pellet was transferred to a 1.5-ml micro-centrifuge tube and suspended in 500 μl of NET buffer. The mixture was treated with 1% N-lauroylsarcosine (Sigma) and RNAse A (100 μg/ml) at 37 °C for 1 h and proteinase K (200 μg/ml) at 50 °C for 1 h. Parasite DNA was extracted three times in equilibrated phenol (pH 8), phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform-isoamyl alcohol (24:1) and precipitated by the addition of 0.3 m sodium acetate and cold absolute ethanol. The extracted DNA was air-dried and re-suspended in TE buffer (10 mm Tris, 1 mm EDTA). Parasite DNA was stored at −20 °C until use. The DNA was quantified by agarose gel electrophoresis and spectrophotometrically by calculating the A 260/A 280 ratios and the A 260 values to determine protein impurities and DNA concentrations.

Detection of genotypic variation of pfdhps gene

The primer design was based on the published pfdhps sequences of P. falciparum (GenBank accession number Z30659) aided by primer designing software primer -3 (Table 1). The method used to detect point mutations was based on the nested PCR. Amplification with R2- R/primer produced an amplicon after nest I reaction. In nest II reaction amplification with K-K/primers produced an amplicon with 436, 437 and 540 codons of the dhps gene. An additional nest (nest III) of L-L/was designed to amplify the 581 and 613 codons.

Table 1.   Sequences of the primers used for the detection of polymorphism in dihydropteroate synthase (dhps) genes
Target GenePrimer namePrimer sequencePCR cycling conditionsAmplicon size
DenaturationAnnealingElongationCycle No.
Nest I
 pfdhps R2 (F)5′AACCTAAACGTGCTGTTCAA3′95 °C for 30 s50 °C for 30 s;72 °C for 1 min40 cycles484 bp
R/(R)3′AATTGTGTGATTTGTCCACAA5′
Nest II
 pfdhps K (F)5′TGCTAGTGTTATAGATATAGGatGAGcATC3′95 °C for 30 s58 °C for 40 s;72 °C for 1 min44 cycles438 bp
K/(R)3′CTATAACGAGGTATTgCATTTAATgCAAGAA5′
NEST III
 pfdhps L (F)5′ATAGGATACTATTTGATATTGGAccAGGATTcG3′95 °C for 30 s52 °C for 30 s72 °C for 1 min30 cycles161 bp
L/(R)3′TATTACAACATTTTGATCATTCgcGCAAccGG5′

The regions of the pfdhps gene surrounding the polymorphisms of interest were amplified by the polymerase chain reaction using an Eppendorf thermal cycler under proper conditions (Table 1). Single-nucleotide polymorphism analysis of the pfdhps gene at their specific codon was determined by enzymatic digestion of specific restriction enzymes. In the dhps gene, the amplicon produced by K-K/was cut by MnlI to identify 436-serine, whereas 436-alanine was detected by MspAI enzyme. AvaII enzyme detected 437-glycine. 437-Alanine was recognised by MwoI digestion, while FokI enzyme detected the mutant 540-glutamic acid. The amplicon of L-L/was digested by BstUI to detect 581-alanine, whereas Bsl1 was used to detect 581-glycine. 613-Alanine was identified by MwoI digestion, while AgeI detected the mutant 613-threonine allele. BsaWI was used to discriminate between 613-threonine and serine (Duraisingh et al. 1998).

Assessment of isolate clonality

The multiplicity of infection, defined as the highest number of alleles detected at either of the two loci, was estimated by using an allelic family-specific nested PCR (MAD20 and K1, for pfmsp-1 and 3D7 Africa and FC27 for pfmsp-2) (Snounou et al. 1999). All PCR amplifications contained a positive control (genomic DNA from 3D7 Africa) and a negative control (no target DNA). Multi-locus genotype analysis for drug-resistant markers was performed with monoclonal isolates, that is, isolates in which a single pfmsp-1 and/or pfmsp-2 allelic form was detected.

Ethical Approval

Informed consent was obtained from the respective patient and the patient’s guardian both adult and child patients. The experimental protocol of this study was followed as per World Health Organisation (WHO) guidelines and was duly approved by the Institutional Ethical Committee.

Statistical analysis

The data were expressed as mean ± SEM. The relationship between IC50 values of sulphadoxine and genotypes was assessed by Fisher’s exact and Mann–Whitney U-test. All analyses were performed using a statistical package, Origin 6.1, (Northampton, MA 01060 USA) and GraphPad InStat software 3.0.

Results

In vitro susceptibility to sulphadoxine

In the end, 90 patients (84.11%) of 107 suspected cases were enrolled, as they had mono-infection with P. falciparum. In vitro assay for sulphadoxine yielded interpretable results on all 90 isolates. Using the in vitro responses, 33 isolates (36.66%) were sulphadoxine sensitive (Geometric Mean IC50 = 235.50 nm, range = 25–600 nm) (Figure 1). Eight isolates (8.89%) were intermediately susceptible (Mean IC50 = 1038.65 nm, range = 650–2950 nm) to sulphadoxine. Forty-nine isolates (54.44%) were highly resistant to sulphadoxine (Mean IC50 = 3840.50 nm, range = 3050–5600 nm).

Figure 1.

 Relationship between in vitro IC50 value of sulphadoxine and different pfdhps genotype. The solid line (corresponding to 3000 nm, highly resistant) is hypothetical shows the in vitro sulphadoxine-resistant level.

pfdhps genotypes

The dhps gene was amplified by polymerase chain reaction (at first nest I then nest II followed by nest III reaction) and followed by digestion with specific restriction enzyme to detect each variant. Amplification with primer K and K/gave a 438 bp amplicon. The ser and ala variants of codon 436 were discriminated by MnlI and MspA1I. Forty-eight isolates (53.33%) and 61 isolates (67.78%) presented the mutant 436-ala and 437-gly allele, respectively. Interestingly, 42 isolates (46.66%) were found with mutant 540-glu alleles. Primer L and L/produced a 161 bp amplicon. Primer L was engineered to create a restriction site for both ala and gly-581 codons recognised by the enzyme BstU1 and Bsl1, respectively. Only 14 isolates (15.56%) with mutant 581-gly were observed. Three alternative polymorphic forms were observed at codon 613. Forty-one isolates (45.55%) were found with mutant 613-thr allele. Ninety isolates were typed for 436, 437, 540, 581 and 613 dhps loci. Twenty-one isolates (23.33%) contained wild-type SAKAA parasite populations. Single mutations with AAKAA and SGKAA haplotypes were found here. Most importantly, a quadruple AGEAT mutation was found in 33 isolates (36.67%). Triple mutations with SGKGT, AGEAA and SGEGA alleles were found in 8, 5 and 4 isolates, respectively (Figure 2).

Figure 2.

 The frequency of different pfdhps haplotype found in West Bengal, India.

Relation between pfdhps genotypes and in vitro data

The presence of dhps point mutations was linked to sulphadoxine resistance. The phenotype of in vitro susceptibility to sulphadoxine was associated with pfdhps genotypes at codon 436, 437, 540 and 613 but not with 581 in Kolkata (Fisher’s test, SDX: P < 0.01 for codon 436; P < 0.01 for codon 437; P < 0.01 for codon 540 and P < 0.01 for codon 613) (Table 2). Low IC50 values were associated with wild dhps genotypes, more specifically SAKAA haplotytpe, as opposed to mixed and mutant genotypes. Single mutations with AAKAA, SAKGA, SGKAA and double-mutant AGKAA alleles were also found with low IC50 values for sulphadoxine. In Kolkata, quadruple mutation was associated with AGEAT haplotype, a very high IC50 value for sulphadoxine and resistance to sulphadoxine (Fisher’s test P < 0.01) (Figure 1). Isolates with triple mutations (SGKGT and AGEAA) were also highly resistant to sulphadoxine (P < 0.01), while isolates with mixed mutations with 613 alleles were sensitive to sulphadoxine (Table 2).

Table 2.   Distribution of dhps genotype in relation to in vitro sulfadoxine susceptibility
No dhps genotype In vitro response to sulphadoxine
436437540581613 S I R
  1. Here in vitro test responses are classified as susceptible (S), intermediate (I) and resistance (R). Mutated amino acids are shown in boldface.

21SAKAA21
4 A AKAA4
5S G KAA32
6 A G KAA222
33 A G E A T 132
5 A G E AA23
8S G K G T 8
4S G E G A4
2SAK G A2
2SAKAA/T2

Prevalence of monoclonal infections

Multiplicity of infection was analysed for a subset of 107 isolates. Monoclonal P. falciparum isolates were confirmed by using allelic family-specific nested PCR. The proportion of monoclonal infections was very high. Of these 107 isolates, 90 (84.11%) contained a single allelic form that was considered as monoclonal infection. These monoclonal infections were included in this study.

Discussion

Genetic diversity in Plasmodium is well known but how the diversity affects clinical manifestation and the epidemiology of malaria is under continuous investigation. Sulphadoxine competes with the substrate that binds to the parasite enzyme P. falciparum dihydropteroate synthetase (pfdhps). Mutations at several amino acid positions of this enzyme were reduced its binding capacity to the drug. Therefore, a higher amount of drug is required to inhibit the mutated pfdhps enzyme and the parasite growth (Triglia et al. 1997). There are five different amino acid positions (436, 437, 540, 580 and 613) where mutations can occur in pfdhps gene. The amino acid sequence of wild-type pfdhps allele at these positions is an SAKAA haplotype. Mutation in pfdhps may start settling at amino acid position 436 or 437, followed by the mutations at other amino acid positions. The higher the number of mutations in pfdhps gene, the higher is the level of drug resistance shown by the parasite (Sharma 2012). Previous studies showed the presence of eight pfdhps mutant alleles in the Indian P. falciparum population (Sharma 2012) and 11 genotypic variations of dhps alleles. The wild-type SAKAA allele of pfdhps was highly predominant in parasite populations of all regions of India except Andaman and Nicobar Island (Ahmed et al. 2004, 2006; Lumb et al. 2009; Das et al. 2010). Interestingly in the present study, only 22.22% isolates were found with this wild-type allele. The numbers of isolates with triple dhps mutations and quadruple dhps mutations had increased significantly, leading to a shift from lower to higher rates of dhps mutations that would translate into greater numbers of isolates with reduced sensitivities to sulphadoxine.

We detected 8 triple dhps (SGKGT) mutant alleles (8.88%) and 33 quadruple (AGEAT) mutant alleles (36.66%) in isolates from West Bengal, India. These quadruple mutant isolates were highly resistant to sulphadoxine in vitro (P < 0.01). In our previous study, we found predominance of double dhfr mutation (108N + 51I) (Das et al. 2012), whereas in the present investigation, we found predominance of quadruple dhps AGEAT mutant alleles. This allelic frequency for pfdhfr and pfdhps mutations is quite normal because under normal circumstances, pfdhfr mutations occur first, followed by pfdhps mutations (Sibley et al. 2001; Ahmed et al. 2004).

Generally triple dhps mutation (AGEAA) was the next most common mutation after the wild SAKAA haplotype and the single mutant FAKAA haplotype (Ahmed et al. 2004, 2006; Lumb et al. 2009). These AGEAA mutations were frequently found in Assam and Orissa (Sharma 2012), while single mutant SGKAA, SAKGA and double-mutant AGKAA haplotypes were also found in West Bengal and Assam (Ahmed et al. 2004; Sharma 2012). By contrast, some dhps genotypes (AAKAA and SGEGA) reported frequently from other countries, such as Kenya, Thailand (Ahmed et al. 2004) were seen among our isolates (Table 2).

SP was the most frequently prescribed drug in the public sector for nearly two decades. For the last few years, ACT (Artesunate + SP) has been the drug of choice for P. falciparum malaria. This might be the cause of the specific selective pressures exerted on the parasite population over SP drug in Kolkata, West Bengal, India. Additional factors contributing to the uncommon drug resistance situation in West Bengal might be its geographical position and the broad range of malaria epidemiological strata in which the three Plasmodium species (P. falciparum, P. vivax and P. malariae) were present, and inhabitants with multiple tribal ethnic origins.

In vitro resistance to sulphadoxine has been associated with the key mutation of dhps A437G; additional mutations in dhps S436A, K540E, A581G and A613T/S confer higher levels of resistance (Wernsdorfer & Noedl 2003). Here, we observed that a higher level of in vitro sulphadoxine resistance was associated with novel SGKGT or AGEAA or AGEAT mutation. From these results, we might conclude that extensive and haphazard use of SP and sometime ACT combination therapy arouses severe sulphadoxine resistance in Kolkata.

In conclusion, in vitro sulphadoxine resistances were strongly correlated with novel quadruple AGEAT mutation or sometime triple SGKGT or AGEAA mutation. It seems that SP drug pressure radically increases in this population and the clinical efficacy of SP might rapidly fade. New cheap antimalarial combinations (except Artesunate + SP) should be tested for treating drug-resistant Plasmodium falciparum.

Ancillary