Association study of mast cell chymase polymorphisms with atopy

Abstract

Background:  Atopic disorders are the result of complex interactions between genetic and environmental factors. Associations analyses between the promoter polymorphism rs1800875 in the mast cell chymase gene (CMA1) and atopy-related phenotypes have yielded inconsistent results.

Methods:  We sequenced the CMA1 locus in 24 unrelated healthy individuals with serum IgE levels <50% percentile and 24 individuals with atopic eczema and serum IgE levels >90% percentile. Seven CMA1 single nucleotide polymorphisms (SNPs) were evaluated for evidence of associations with atopic phenotypes within a large population of German adults (n = 1875). Subjects were phenotyped by standardized questionnaires and interviews, skin prick testing and serum IgE measurements. Genotyping was performed using MALDI-TOF MS (Matrix-Assisted Laser Desorption Ionization–Time of Flight mass spectrometry).

Results:  Promoter polymorphism rs1800875 was significantly associated with atopic eczema. No associations between any other single SNP and atopic phenotypes could be detected. Haplotype reconstruction revealed four of 128 possible haplotypes reaching estimated frequencies of 3% or more. Two of these haplotypes showed a borderline-significant association with atopic eczema, which did not remain significant after correction for multiple testing.

Conclusions:  Results confirm previous observations of a significant association between the CMA1 promoter polymorphism rs1800875 and atopic eczema, but not with serum IgE levels, and support the hypothesis that CMA1 serves as candidate gene for atopic eczema.

Atopy is defined as personal or familial tendency to produce IgE antibodies in response to low doses of enviromental allergens, and to develop atopic diseases (asthma, rhinoconjunctivitis, atopic eczema) (1). Over the last decades, the prevalence of atopic diseases has shown a steady increase in Western countries, now having plateaued (2). Current pathophysiologic concepts suggest interactions between susceptibility genes, the host's environment and immunological factors (3). Mast cells (MCs) represent key effector cells of IgE-dependent immediate reactions, and also contribute significantly to certain features of IgE-associated late-phase reactions and chronic allergic inflammation [reviewed in (4)]. In addition, MCs have been shown to exert beneficial functions such as tissue repair [reviewed in (5)] and as participants in innate and acquired immune resonses (6).

Mast cells express a complete and functional high-affinity IgE receptor, whose aggregation via IgE molecules leads to MC activation, granule exocytosis, and release of preformed mediators such as histamine, tryptase and chymase, as well as newly synthesized products such as prostaglandin D₂ and leukotrien C₄ [reviewed in(7)]. Although the pivotal role of MCs in allergic inflammation is well known, the role of chymase, which is present in large quantities in the secretory granules, is not fully understood yet. There is accumulating evidence that chymase contributes to fibrosis and tissue remodelling by directly activating procollagenase, initiating collagen fibril formation, releasing transforming growth factor beta 1 from the extracellular matrix and by converting angiotensin I to angiotensin II. In addition, human MC chymase has been shown to promote vascular and epithelial permeability and to induce the in-vivo-recruitment of neutrophils and other leukocytes [reviewed in (8)].

Atopy and atopic disorders are likely to result from complex interactions between several genetic and environmental factors. Genome-wide searches have detected a number of regions linked to atopic phenotypes, and a variety of gene variants have been associated with atopy-related traits [reviewed in (9)]. However, most reported associations are not robust and lack reproducibility (10). Among the genomic regions linked to atopy is the long arm of chromosome 14 (14q11), where CMA1 encoding chymase is located (11, 12). There have been several reports about a significant association between a CMA1 promoter polymorphism (rs1800875) and atopic eczema in Japanese adults and school-children (13–15). These results could not be confirmed in another Japanese study with 100 patients and 69 patient-parents-trios (16) and an Italian study with 70 patients (17). Recently, a family-based association study in Caucasians revealed a significant association of this polymorphism with total IgE levels in patients with self-reported atopic eczema (18). To further clarify a possible association between the CMA1 gene and atopy related phenotypes we systematically sequenced all five exons, parts of the neighbouring introns, and the promoter region of the gene in 48 unrelated persons. Seven densely spaced SNPs, which cover the whole gene (Fig. 1) were selected for further analyses and genotyped in a large population-based cohort of 1875 adults.

Figure 1. Structure of CMA1 gene. Gene structure of CMA1 showing the location of all SNPs genotyped in this study indicated by arrows (round-tailed arrows indicate exonic SNPs). The CMA1 locus spans 4.6 kb (CMA1 gene 2.8 kb additional promotor 1.8 kb).

Methods

Study population

Subjects were recruited from the KORA C (Cooperative Health Research in the Augsburg Region) and KORA S4 survey, which were large population-based cross-sectional studies on Caucasian adults carried out 1994–1995 and 1999–2001 in the city and region of Augsburg, South Germany. The sampling frames and study designs have been described previously (19, 20). Briefly, from KORA C subjects were selected so as to provide 50% with and 50% without demonstration of specific IgE to common environmental allergens in the Radio-Allergo-Sorbent-Test (RAST), and, furthermore, so that within these groups 50% suffered from respiratory atopy. From KORA S4, subjects which had not been part of KORA C were selected so as to provide 50% with atopic eczema and 50% without. Finally, we ended up with n = 1991 persons aged 25–74 years in our study population for case–control analysis. DNA samples were available from 1875 subjects.

All study methods were approved by the Ethics committee of the ‘Bayerische Landesärtzekammer’ Munich.

A written and informed consent was obtained from all participants prior to the beginning of the study.

Phenotyping

All subjects had to complete a standardized questionnaire, which next to demographic data included the basis allergy questions of the European Community Respiratory Health Survey (ECRHS) on respiratory health (21). In addition, all probands were interviewed in a standardized manner to report on symptoms of atopic diseases, basic family data and parental history of atopic diseases.

All subjects received a conventional lancet skin prick test and and total and specific IgE measurements (enzyme-immuno assay; CAP-FEIA, Pharmacia, Uppsala, Sweden) using a sample of common allergens (grass, birch, rye, mugwort pollen, Alternaria, Cladosporium, cat, dog, and Dermatophagoides pteronyssinus). Saline and histamine were used as controls (ALK-Scherax, Hamburg, Germany). Subjects were classified as having allergic rhinoconjunctivitis or asthma when they reported a doctor's diagnosis of hay fever or asthma, respectively. Specific sensitization was defined to be present if at least one of the specific IgE antibodies was positive (CAP class ≥1, corresponding to ≥0.35 KU/l) or if a positive skin prick test reaction (wheal diameter ≥3 mm after subtraction of the negative control) against at least one of the allergens was observed.

Individuals from KORA S4 received a skin examination by experienced senior dermatologists who had been additionally trained before the start of the study according to the criteria of Hanifin & Rajka (22) and the UK diagnostic criteria for atopic eczema (23).

Genetic analyses

Sequencing.  To detect up to now unknown DNA variants in the human CMA1 gene we sequenced all exons, including parts of the neighbouring introns, and the predicted promoter region of the gene in 24 unrelated healthy individuals with serum IgE levels <50% percentile and 24 individulas with atopic eczema and serum IgE levels >90%. PCR was performed in a volume of 20 μl in 96-wells each containing 20 pmol of each primer, 20 ng genomic DNA, 0.4 U of HotstarTaq polymerase (Qiagen, Hilden, Germany), 20 μmol of dNTPs and the appropriate PCR-Puffer (Qiagen). Thermocycling started with an initial denaturation step of 95°C for 15 min followed by 35 cycles of 95°C for 30 s, 60°C for 45 s, and 72°C for 60 s. A final extension step at 72°C for 10 min was implemeted. PCR-products were purified utilizing MultiScreen^®-PCR Filter Plate Kit (Millipore, Eschborn, Germany) according to the manufacturer's protocol. Subsequently cycle sequencing of the purified PCR products was performed according to a standardized protocol for BigDye Terminator v3.1 (Applied Biosystems, Foster City, CA). Sequence detection was carried out on the ABI prism 3730 Genetic Analyser (Applied Biosystems).

Genotyping

Genomic DNA was extracted from leukocytes with a commercial DNA isolation kit (Gentra Systems, Minneapolis, MN, USA) according to the manufacturer's recommendation. Genotyping analyses were carried out by using the MassARRAY system (Sequenom, San Diego, CA, USA) as described previously (19).

Statistics

Descriptive statistics for quantitative and qualitative values are given by mean ± standard deviation (SD) and relative frequencies or absolute numbers, respectively. For descriptive statistics SPSS version 11.5 was used. Association of quantitative traits with SNP genotype was tested with t-tests for two independent samples or Satterthwaite tests using the SAS statistical software package version 9.1. Deviation from Hardy–Weinberg equilibrium was tested with PROC ALLELE in SAS/Genetics for any of the SNP's under consideration. Linkage disequilibrium was assessed with procedure ldmax in the software package gold. Haplotype frequencies were estimated from genotype data using the EM algorithm (24, 25). To evaluate associations with quantitative and qualitative traits, haplotype trend regression models were applied including estimated probabilities of haplotypes in a linear and logistic regression approach as independent variables (25), respectively. Further independent variables were study population (KORA C or KORA S4), age, family size, and sex. Because smoking is an essential influence factor on IgE levels and atopic diseases (26), smoking status was included as independent variable in multiple regressions.

The same covariates were included in logistic regressions testing associations of qualitative traits with SNP genotypes. Results are reported after applying backward elimination and stepwise variable selection. All haplotype analyses were implemented using the SAS/genetics module (27). Odds ratios (ORs) are given with two-sided P-values in parentheses. The patterns of linkage disequilibrium between markers were visualized using the gold 1.0 package (http://www.well.ox.ac.uk/asthma/gold).

Results

Since regression analyses revealed no significant population effect, both studies (KORA C, KORAS4) were analyzed together. 8.9% (n = 167) of the individuals with available DNA samples (n = 1875) were diagnosed with asthma, 12.9% (n = 242) were suffering from atopic eczema, and 26.0% (n = 488) from allergic rhino-conjunctivitis. IgE serum levels of more than 100 kU/l were detected in 32.2% (n = 604). Between 1809 and 1868 samples (average call rate 97.6%) were genotyped successfully for the respective CMA1 polymorphisms (Fig. 1).

Phenotyping as well as genotyping details and allele frequencies are given in Tables 1 and 2.

Table 1.  Phenotype characteristics of adults included in analyses (n = 1875)

	Total study population (n = 1875)
Male gender	866 (46.2%)
Mean (±SD) age	49.0 (±13.6)
Asthma	167 (8.9%)
% with specific sensitization	76.3
Allergic rhinoconjunctivitis	488 (26.0%)
% with specific sensitization	81.8
Atopic eczema	242 (12.9%)
% with specific sensitization	50.8
Total serum IgE >100 kU/l	604 (32.2%)
Mean (±SD) ln(total serum IgE)	3.9 (±1.4)

Table 2. CMA1 polymorphisms, dbSNP accession number, localization, call rates, allele frequencies, and genotyping primers

SNP Id+	Location	Allele	Allele frequency (%)	Call rate (%)	Direction	PCR primer	Extension primer
+SNP number according to dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP)
rs1800875	5′ flanking	G	47.4	96.4	fwd	ACGTTGGATGCCTATTCCATTTCCTCACCC	CCAAGACTTAAGTTTTGCT
		A	52.6		rev	ACGTTGGATGGCATCAAGATTCAGATCCAC
rs1956923	5′ flanking	C	74.4	97.3	fwd	ACGTTGGATGACTGAACGTTCAGTGCAAAG	CTCCACTCCATTCCACTACAC
		T	25.6		rev	ACGTTGGATGAAATGGGGTTGTTGCTCAAG
rs5244	5′ flanking	C	19.4	97.4	fwd	ACGTTGGATGCTCTCACTCTGAATTGGCTG	GGTGATTCTAGGGGAACTTC
		T	80.6		rev	ACGTTGGATGTCAGGGCTCAAGTTCCTTTC
rs5246	Exon 2	C	0.6	96.5	fwd	ACGTTGGATGCGTCAGCACAAAGTTCCGTC	ACCACCACAAAATTTTGAGGGACC
		G	99.4		rev	ACGTTGGATGCATGGCCTACCTGGAAATTG
rs5247	Exon 2	G	02.0	99.2	fwd	ACGTTGGATGACTCTGGTTGTTCATCTCCC	CTGTTGTCTCACCTTCCTGCACAA
		A	98.0		rev	ACGTTGGATGAGACGGAACTTTGTGCTGAC
rs5248	Intron 2	A	92.0	98.9	fwd	ACGTTGGATGCATCACTGTCGCTCCTTTTC	CCTTCCTTCTTCCTCACA
		G	08.0		rev	ACGTTGGATGTATGTTATGGGCTCCAAGGG
rs5250	3′ flanking	C	88.4	97.7	fwd	ACGTTGGATGGAGAGTTCTGTGACCTGTAG	TGGTCCCTCAGCCACAA
		T	11.6		rev	ACGTTGGATGTGCCACTCATTCTGGTCTAC

Sequence analysis of all exons of the gene with adjacent intronic sequences as well as of the promoter region in 48 probands revealed no up to now unknown DNA variants. Seven SNPs with very dense average spacing of 0.7 kB were chosen. Thus we could systematically cover the whole gene region and evaluate evidence for association with atopy-related phenotypes. One of the analysed SNPs was rs1800875, which was already tested in different previous studies with conflicting results. Considering multiple testing and the two-sided significance level of 5% none of the genotyped polymorphisms showed a significant deviation from Hardy–Weinberg equilibrium. Using a normalized correlation coefficient the degree of linkage disequilibrium was assessed between single polymorphisms and expressed in a gold plot as indicated in Fig. 2.

Figure 2. gold linkage disequilibrium map of the CMA1 SNPs applying a normalized correlation coefficient. Pairwise estimations of Lewontin's measure of disequilibrium D’ are shown from unrelated subjects on a scale of 1 (complete linkage disequilibrium: red) to 0 (blue). Marker positions are shown as a schematic rather than as actual distances apart.

In the single SNP analyses homozygosity (GG) at rs1800875 was significantly associated with atopic eczema with an OR of 1.91 (P = 0.002, 95% CI = 1.25–2.86). None of the other SNPs genotyped in this study showed any significant association results with atopic eczema.

For haplotype analysis 1730 samples were available in which genotyping was successful in each of the seven CMA1 polymorphisms (Fig. 1). The EM algorithm showed four of 128 possible haplotypes exceeding a frequency of 3%. 95% confidence intervals for frequencies are small because of the large study populations indicating sufficiently high accuracy (Table 3). For haplotype GCCGAGC we observed a tendency for association with atopic eczema (P = 0.05, OR = 2.64, 95% CI = 1.00–7.00), whereas haplotype ACTGAAC was slightly protective against the development of atopic eczema (P = 0.05, OR = 0.617, 95% CI = 0.38–1.00). However, these associations did not remain significant after correction for multiple testing. No associations for SNPs or haplotypes were seen for the following traits: asthma, allergic rhinoconjunctivitis, allergic sensitization, total serum IgE levels, total serum IgE levels in individuals with asthma or atopic eczema. When allergic sensitization was defined as CAP class ≥2 against at least one of the allergens tested, no associations were observed.

Table 3.  Frequency of CMA1 SNP genotypes and haplotypes in atopic eczema and controls. Haplotypes with frequencies <3% were not considered

SNP ID	Location and genotypes	Genotype, haplotype frequencies
		Atopic eczema	Control numbers	Total study population
rs1800875	5′ flanking
	AA	26.8	28.8	28.5
	AG	44.8	48.6	48.0
	GG	28.4	22.6	23.5
rs1956923	5′ flanking
	CC	54.8	55.4	55.3
	CT	36.1	38.7	38.4
	TT	9.1	5.9	6.3
rs5244	5′ flanking
	CC	5.1	3.9	4.1
	CT	33.5	30.6	31.0
	TT	61.4	65.5	64.9
rs5246	Exon 3
	CC	0	0	0
	CG	0.8	1.3	1.2
	GG	99.2	98.7	98.8
rs5247	Exon 3
	AA	94.0	95.7	95.5
	AG	6.0	4.3	4.5
	GG	0	0	0
rs5248	Intron 4
	AA	83.4	85.2	85.0
	AG	16.6	14.1	14.4
	GG	0	0.7	0.6
rs5250	3′ flanking
	CC	74.8	77.8	77.4
	CT	22.8	21.1	21.4
	TT	2.4	1.1	1.2
	A-C-T-G-A-A-C	46.0	50.5	49.9
	G-C-C-G-A-A-T	13.5	11.5	11.8
	G-C-C-G-A-G-C	8.0	7.5	7.6
	G-T-T-G-A-A-C	26.5	24.6	24.9

Discussion

Chromosome 14q contains several important candidate genes, which could contribute to the genetic predisposition to atopy. Chromosome 14q.11 has been linked with specific allergic reactions, asthma and total IgE (11, 12, 28), suggesting the presence of a gene (or genes) in the region that predispose(s) to allergic diseases. Previous studies focussing on one BstXI polymorphism (rs1800875) within the promoter region have indicated association with atopy. Initially, in a Japanese cohort of adults, an association with atopic eczema was observed (13). In two subsequent studies this observation was confirmed, especially for atopic eczema with low total serum IgE levels (14, 15), whereas another study failed to replicate the association (16). In contrast, associations with raised IgE levels have been reported in patients suffering from both atopic eczema and asthma (15). However, the mentioned studies exhibit a variety of potential limitations, as for example rather low case numbers resulting in low statistical power, and limited comparability of Asian and Caucasian populations. Iwanaga et al. (18) recently confirmed the association with IgE levels in Caucasian patients with asthma and self-reported atopic eczema, but atopic eczema was not the primary trait examined within this study, and the number of atopic individuals without asthma was low, so that no conclusions concerning the effect on sensitization alone were possible.

We aimed to clarify this ambiguity concerning transmission of susceptibility to atopy and atopy-related traits by CMA1 polymorphisms. Sequencing of the predicted promoter region, all exons and adjacent intronic sequences in 48 persons enabled us to detect all common DNA variants. in functional regions of the gene.

We subsequently assessed seven SNPs in the CMA1 locus (4.8 kb), which were very densely spaced (average 650 bp), including the above mentioned promoter polymorphism rs1800875, on atopic phenotypes in a large population-based cohort of German adults (n = 1875). The traits examined included atopic eczema, asthma, allergic rhinoconjunctivitis, specific sensitization and total serum IgE levels.

In the single marker analyses, polymorphism rs1800875 showed significant association with atopic eczema confirming previous findings in small cohorts (13–15). However, no association was seen with high total IgE levels in subjects with eczema as reported previously (18), or with the other atopic traits. Thus, the present study underlines that despite a considerable overlap between atopic traits, they might also be influenced by unshared genetic determinants, and that eczema might be largely influenced by a different set of genetic loci (29).

Since it has been suggested that haplotype analyses may be of higher informative value to draw associations between phenotypes and genetic variation than SNPs (30), we also performed haplotype analyses using the EM algorithm. A borderline-significant tendency towards association with atopic eczema was seen for two CMA1 haplotypes, which did not remain significant after correction for multiple testing.

In conclusion, our data confirm and expand previous observations that the polymorphism rs1800875 in the promoter region of CMA1 is significantly associated with atopic eczema. Based on our analyses it seems unlikely that the associations of CMA1 with atopic eczema and related traits are caused by any other allele in the gene region.

It may be speculated whether this DNA variant alters the expression of chymase. Recently, it has been shown that MC chymase is increased in chronic atopic eczema skin lesions (31), and a potential role of chymase in the promotion of the skin barrier defect and cutaneous neovascularization has been suggested (32). Preliminary studies in animal models have indicated a therapeutic potential of chymase inhibitors in atopic eczema (33, 34). Functional studies and analyses considering interaction with other loci are needed to clarify the consequences of polymorphism rs1800875 in the CMA1 gene and might help to evaluate whether chymase may qualify as target for therapeutical interventions in atopic eczema.

Acknowledgments

The KORA research platform (KORA: Cooperative Research in the Region of Augsburg) was initiated and financed by the GSF–National Research Centre for Environment and Health, which is funded by the German Federal Ministry of Education, Science, Research and Technology and by the State of Bavaria. This work was supported by a research grant within the German National Genomic Research Network (NUW-S31T05) and by a research grant from the University Hospital ‘‘Rechts der Isar’’, Technical University Munich (KKF-07/04).