SEARCH

SEARCH BY CITATION

Keywords:

  • allergy;
  • asthma;
  • ECP polymorphisms;
  • eosinophilic cationic protein;
  • genetic analysis

Abstract

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

Background:  Eosinophil cationic protein (ECP) is a potent cytotoxic secretory protein with bactericidal and antiviral properties. ECP is released by activated eosinophils and regarded as a marker of eosinophilic inflammation. High levels of ECP have been reported in cases of active asthma and other allergic diseases. This study aimed to assess whether three single-nucleotide polymorphisms (SNPs) in the ECP gene (RNASE3) on chromosome 14 q24–q31 or their haplotypes are associated with asthma, allergy, or related phenotypes.

Methods:  The three SNPs −38CA, +371CG and +499CG in RNASE3 and their haplotypes were analyzed for associations with asthma, serum-ECP (s-ECP) levels, allergic sensitization (positive skin-prick test to common allergens), bronchial hyperresponsiveness (BHR) assessed by methacholine inhalation, and serum-IgE (s-IgE) levels in 177 families from Norway and the Netherlands identified through siblings with asthma.

Results:  Transmission disequilibrium test (TDT) demonstrated significant associations between the A-G-G haplotype and asthma as well as the specific phenotypes allergic asthma (but not non-allergic asthma), high s-ECP, high s-IgE and BHR, while the C-G-G haplotype was associated with reduced occurrence of these traits. In addition, the −38A allele was associated with high s-ECP levels and allergic asthma.

Conclusion:  The present study suggests that the A-G-G haplotype in the RNASE3 gene influences the development of asthma, in particular, an allergic form of asthma. Furthermore, as the −38CA SNP lies in close vicinity of known intron-regulatory sites, results of SNP analysis suggest that the detected association is possibly linked to a genetic transcriptional control of s-ECP levels.

Abbreviations:
ECP

eosinophil cationic protein

BHR

bronchial hyperresponsiveness

GATA-1

globin transcription factor-1

GAIN

Genetics of Asthma International Network

ICS

inhaled corticosteroids

NFAT

nuclear factor of activated T-cells

SNP

single-nucleotide polymorphism

SPT

skin-prick test

TDT

transmission disequilibrium test

UTR

untranslated region

A lifetime prevalence of asthma of 20.2% was recently demonstrated in 10-year-old children in Oslo, Norway (1), rendering asthma the most common chronic disease in children today (2). The inheritance pattern of asthma is complex because genes and environment interact (3) and the underlying mechanisms may vary, being reflected by phenotypic variation.

Eosinophilic airway inflammation is a characteristic feature of asthma (4), and serum eosinophil cationic protein (s-ECP), a granular protein derived from activated eosinophils, reflects the degree of activation of the circulating eosinophilic pool in the body (5). Assessment of s-ECP depends upon the sampling procedure (6), age and disease duration (7), medication use, and is influenced by circadian and seasonal variations (8) as well as inter-individual variation (9). On the other hand, because of the inter-individual variation in the asthmatic inflammatory process, s-ECP may be used to monitor the treatment of the individual patient (10). Recently, Noguchi et al. reported an association between a single-nucleotide polymorphism (SNP; −393CT) in the promoter region of the gene encoding for ECP (RNASE3) and s-ECP levels (11). However, this SNP has not been identified in Caucasian populations (12) and hence cannot explain all the inter-individual variation found.

Eosinophil cationic protein is a potent cytotoxic molecule (13, 14) and is suggested to be involved in tissue remodeling (15) as well as altering pulmonary surfactant structure and function in asthma patients and possibly in the mechanisms of airway obstruction (16). Furthermore, Jonsson et al. detected an association between allergy and allergic asthma and a 434GC SNP in RNASE3 (labeled +371CG in the present study) causing an arginine to threonine substitution (17), and more recently an association between a 562CG SNP in the untranslated region (UTR) region of RNASE3 (labeled +499GC in the present study) and cellular content of ECP (18).

The RNASE3 gene is located on chromosome 14 q24–q31, an area linked to asthma (19). Zhang and Rosenberg (12) sequenced RNASE3 and identified seven SNPs in various ethnic groups. Of these SNPs, three were identified in Caucasian populations (−38CA, +371CG, and +499GC). The −38CA SNP disrupts a globin transcription factor-1 (GATA-1)-binding site (a transcription factor which regulates eosinophil development) (20, 21), and is also located in close vicinity of a potential intron-enhancer site [nuclear factor of activated T-cells (NFAT)] in RNASE3 (22) (Fig. 1), suggesting that the −38CA SNP is an interesting candidate for regulation of ECP transcription.

image

Figure 1.  The ECP gene and flanking 200 bp. The ECP gene illustrated with the exons highlighted in red and bold, and untranslated regions highlighted in gray. Translational start codon is underlined and bold in black. The NFAT-binding site and GATA-binding site in the intron are underlined. *UTR, untranslated region.

Download figure to PowerPoint

Among the Norwegian families taking part in a genetic study of asthma (23) there was a tendency for familial clustering of high or normal s-ECP levels (K.L. Carlsen and K. Carlsen, unpublished observations), raising the question of whether there was a genetic basis for variation in s-ECP levels. Thus, the present study aimed primarily at investigating whether the ECP polymorphisms identified in Caucasian populations were associated with asthma or asthma-related phenotypes, and whether this could be linked to a genetic control of s-ECP levels.

Subjects and methods

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

Study design

Families were recruited at two European centers (Oslo in Norway and Groningen in the Netherlands) as part of a multinational genetics study of families with asthmatic members, the Genetics of Asthma International Network (GAIN) (23). The two sites enrolled 102 (Oslo) and 75 (Groningen) families identified through a sibling pair with asthma, who were subjected to identical investigations. Entry criteria for families were a minimum of two siblings (age 7–35 years) with physician-diagnosed asthma, bronchial obstruction, and/or use of beta-2 agonists during the previous year for the proband and asthma symptoms after 6 years of age for the sibling, and both biological parents available for participation. More siblings 7 years or older (affected and unaffected), were included if present. Families were excluded if the proband or parents suffered from serious chronic pulmonary disease other than asthma, or if any parent or sibling had disease (including myocardial infarction or heart failure within the last 1 or 3 years, respectively) or treatment (β-blockers) that would contraindicate methacholine challenge. The study was approved at the individual sites by the local/regional Institutional Review Board or Medical Ethics Committee and the Norwegian Data Inspectorate.

Subjects

Families having the first two siblings with asthma were included in the present study. Mean age was 14 years for the probands and 13.4 years for the first sibling (57% and 54% boys respectively). Further demographic and clinical data based on the 177 families are given in Table 1. Asthma was ascertained in all the probands (n = 177) and siblings (n = 177), allergic asthma in 175 probands and 176 probands, s-ECP in 173 probands and 174 siblings, s-IgE in 176 probands and 177 siblings, and bronchial hyperresponsiveness (BHR) in 148 probands and 155 siblings. None of children had received long-acting beta-2 agonists or leukotriene antagonists, whereas 81% of the probands and 66% of the siblings received inhaled corticosteroids (ICS). At the time of examination, none of the subjects had suffered respiratory infections within the previous month. All subjects underwent clinical investigation, structured interview, baseline spirometry, skin-prick test (SPT), methacholine challenge and blood sampling for DNA extraction, s-ECP and total serum immunoglobulin E (s-IgE) analyses.

Table 1.   Demographics of the subjects included in the study
 OsloGroningenTotal
  1. The variables were analyzed using the Pearson's chi-squared test.

  2. * Significant difference between Oslo and Groningen based on Pearson's chi-squared test and 5% significance level.

  3. † Number of subjects.

Total no. family10275177
Probands (n†)10275177
 Age (SD)14.6 (6.1)13.2 (4.9)14.0 (5.7)
 Gender (% male)575757
 Allergic asthma (%) *528063
 Non-allergic asthma (%) *482037
 s-ECP (>16 μg/l) (%)344137
 PC20 (≤8 mg/ml) (%)445047
 IgE (>119 kU/l) (%)*497058
 FEV1 (≤80%) (%)576
First sibling (n)10275177
 Age (SD)13.7 (6.2)13.0 (5.5)13.4 (5.9)
 Gender (% male)565254
 Allergic asthma (%)*498062
 Non-allergic asthma (%)*512038
 s-ECP (>16 μg/l) (%)*295339
 PC20 (≤8 mg/ml) (%)385043
 IgE (>119 kU/l) (%)*496455
 FEV1 (≤80%) (%)*4138
Parents (n)202150354
 Age (SD)43.4 (6.5)43.6 (6.6)43.5 (6.6)
 Asthma (%)*352430
 Allergic asthma (%)211920
 Non-allergic asthma (%)*1349
 Sensitized (%)*604855
 s-ECP (>16 μg/l) (%)*233729
 PC20 (≤8 mg/ml) (%)131413
 IgE (>119 kU/l) (%)252525
 FEV1 (≤80%) (%)777

Methods

Forced expiratory flow volume curves were measured by spirometry according to American Thoracic Society standards (24–26), after ensuring that the following medication was not taken for the given time prior to investigation: short-acting bronchodilator for 8 h, long-acting bronchodilator within 48 h, theophylline or leukotriene receptor antagonist for 48 h, long-acting antihistamine for 7 days, systemic steroids for a month, and antibiotics for respiratory infection within the preceding month.

Skin-prick tests were performed according to European guidelines, with a positive SPT defined as a mean wheal diameter of at least 3 mm larger than the negative control, read after 15 min (27). Antihistamines were suspended for at least 72 h and systemic prednisolone doses exceeding 10 mg/day were suspended 24 h prior to testing. The following standardized extracts from ALK (Copenhagen, Denmark) were used: histamine 10 mg/ml (positive control), saline (negative control), Dermatophagoides pteronyssinus, D. farinae, grass mix, cat and dog dander, Alternaria alternata, Cladosporium herbarum, and German cockroach. Additionally, the region-specific allergens, silver birch and mugwort (Norway) and Aspergillus fumigatus and tree mixes (The Netherlands), were included.

Bronchial hyperresponsiveness was assessed with a methacholine challenge test, and the interpolated methacholine concentration (mg/ml) which caused a fall in FEV1 of 20% (PC20) was identified. In Groningen, methacholine bromide was used (concentrations ranging from 0.038 to 19.6 mg/ml) instead of methacholine chloride (0.03 to 16.0 mg/ml) which was used in Oslo. The methacholine concentrations were comparable in the bromide and chloride solutions. Serum-ECP and s-IgE levels were analyzed by CAP fluoroenzyme immunoassay methods (FEIA) following strict sampling procedures according to the instructions of the manufacturer [Pharmacia Upjohn (Pharmacia Diagnostics), Uppsala, Sweden] (28).

SNP information

The SNP nomenclature chosen in the present study was defined by the first translated base given as +1 (see Fig. 1). The SNPs included were selected based on Caucasian allele frequencies (12), location (including 200 bp flanking either side of ECP gene), and SNPs analyzed in earlier studies (11, 17). Three of the selected SNPs were identified in the Caucasian population (12), −38CA (rs17792481), +371CG (rs2073342), and +499CG (rs2233860), and were thus included in the present study. The +371 CG SNP has previously been labeled 124 Arg/Thr or 434 GC (11, 17), while the +499GC SNP has previously been labeled 562CG (18). Restriction fragment analysis was performed in 63 samples for the −393CT SNP (rs11575981) reported in the Japanese population using the enzyme RsaI (New England Biolabs, Ipswich, MA, USA) (11). The SNP was not detected in our population, and was thus excluded from further analysis.

Genotyping

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

DNA extraction was done at Duke University (Durham, NC, USA) using the Purigene c system (Gentra, Minneapolis, MN, USA). SNP analysis was performed using the TaqMan® SNP genotyping assay under standard conditions on an ABI 7900HT Sequence Detection System (see http://home.appliedbiosystems.comfor details; accessed 23 January 2007). Primers and MGB-probes for the three SNPs are shown in Table 2. These sequences were blasted using the NCBI blast algorithm http://www.ncbi.nlm.nih.gov/BLAST, and although ECP shares ∼70% sequence homology with eosinophil-derived neurotoxin (EDN), for each included SNP at least two of the four probe and/or primer sequences were unique. To further verify specificity of our primers and probes, 17 individuals were sequenced for the entire RNASE3 sequence and this confirmed the polymorphisms detected by the genotyping assay. Genotyping failure caused by technical difficulties was as follows: −38CA in four probands and 15 parents, +371CG in seven parents, and +499CG in five probands and 17 parents.

Table 2.   Primers and probes for the ECP polymorphisms
 −38CA+371CG+499CG
Forward primerGCCTGTGGGTTGAGACACTATAGACTCATAAATCCAGGTGCACAGAATCACCTGGATACCACCATCTAAGCT
Reverse primerGAAGTGAACAGTTTTGGAACCATGTGATCTCTGTTGTCACATGCAACTACAGATGGGATCTTGGCTATGATTGA
MGB probe allele 1CTACTCCCCGATCCGTTCAAACTGCACGTATGATCAGCACTCCTCA
MGB probe allele 2CTACTCCCCTATCCGTTCAAACTGCAGGTATGATCAGCAGTCCTCA

Outcomes

Phenotypic outcomes were defined as: asthma (allergic and non-allergic asthma), s-ECP levels, total s-IgE levels, and BHR. Asthma was defined as a physician's diagnosis of asthma by the family physician or principal investigator (physician). Allergic asthma was defined as asthma in the presence of allergic sensitization (defined as the presence of at least one positive SPT), while non-allergic asthma was defined as asthma without allergic sensitization. s-ECP levels were categorized as normal or increased using a cutoff level of 16 μg/l according to the recommendations of the manufacturer (29). s-IgE was categorized for analyses as normal (equal to or below) or high (above) with a cut-off level of 119 kU/l (upper reference value for adults given by the manufacturer). BHR was defined as PC20 values ≤8 mg/ml (30).

Statistical analysis

Categorical variables were analyzed with Pearson's chi-squared statistics. Analysis of variance (anova) was used for continuous variables and transformations were performed to achieve the assumption of normality. The statistical analyses were performed in SPSS (Statistical Package for Social Sciences, version 14.0 for Windows).

Pedigree files were checked for incompatibilities using PedCheck (31), and one sibling was excluded in the Norwegian population because of non-Mendelian inheritance patterns. The test implemented in PEDSTATS (32) did not reject the Hardy–Weinberg equilibrium for any of the SNPs. Haplotypes were estimated and analyzed using the program Unphased in the GLUE interphase (http://www.mrc-bsu.cam.ac.uk/personal/frank/software/unphased/). Both individual alleles and haplotypes were subjected to tests for genetic associations in the families (including two siblings but analyzing the first affected the offspring only) performed by the transmission disequilibrium test (TDT) (33) using the UNPHASED software. Furthermore, quantitative TDT was used to analyze log-transformed s-ECP levels, and PC20 values were divided into four categories (PC20 ≤ 2.0, 2.0 < PC20 ≤ 8.0, 8.0 < PC20 ≤ 16.0, and PC20 > 16.0).

Bonferroni correction for multiple testing was not used because SNPs in linkage disequilibrium with each other are not independent, and it is therefore generally considered overly conservative. The uncorrected P-values are reported in the present study and considered statistically significant at the 5% level.

Results

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

Among the probands, 63% had allergic asthma (significantly higher in the Groningen population) while 37% had non-allergic asthma (significantly higher in the Oslo population). In addition, 37% had s-ECP levels above 16 μg/l (i.e. allergic asthma), 47% exhibited BHR (PC20 value ≤8.0 mg/ml), and 58% had increased IgE levels (IgE >119 kU/l, the upper reference level for IgE in adults). As demonstrated in Table 1, proband mean age and gender did not differ significantly between the two sites, but probands in Groningen had higher s-ECP and s-IgE levels. The siblings did not differ significantly from the probands with regard to their clinical traits. Allele frequencies of the three tested SNPs appeared to be similar in the two populations (data not shown).

Haplotype TDT analysis revealed four different (−38)−(+371)−(+499) haplotypes: A-G-G, C-G-G, C-C-G, and C-C-C, and the TDT results are presented in Table 3. The A-G-G haplotype was positively associated with asthma (P = 0.004), while the C-G-G haplotype was negatively associated with asthma (P = 0.003). The same two haplotypes (A-G-G and C-G-G) were positively and negatively associated with high s-ECP, allergic asthma, high s-IgE, and BHR, respectively (Table 3).

Table 3.   Haplotype TDT analysis for asthma and the different traits analyzed
HaplotypeOslo NO (102 fam)Groningen NL (75 fam)Total (177 fam)
Transmitted (%) PTransmitted (%) PTransmitted (%)Ptdt*
  1. The four existing haplotypes in the studied populations based on the three genotyped SNPs in the order −38CA, +371CG, and +499GC.

  2. *Ptdt: P-value in the TDT analysis comparing the observed transmission rate with the expected 50% under the null hypothesis of no association as a chi-squared test (1 d.f.). Bold values indicate significant transmission rates (P < 0.05).

(a) Asthma
 A-G-G34 (59) 0.1935 (70) 0.00569 (64)0.004
 C-G-G18 (33) 0.0121 (39) 0.1039 (36)0.003
 C-C-G13 (59) 0.404 (50) 117 (57)0.50
 C-C-C24 (56) 0.4519 (41) 0.2443 (48)0.75
(b) Allergic asthma
 A-G-G24 (59) 0.2733 (72) 0.00357 (66)0.004
 C-G-G14 (36) 0.0818 (37) 0.0632 (36)0.01
 C-C-G9 (50) 13 (43) 0.7112 (48)0.84
 C-C-C17 (57) 0.4717 (43) 0.3434 (49)0.81
(c) Non-allergic asthma
 A-G-G21 (54) 0.636 (46) 0.7827 (52)0.78
 C-G-G15 (45) 0.605 (36) 0.2920 (37)0.06
 C-C-G10 (63) 0.322 (100) 0.1612 (67)0.16
 C-C-C14 (56) 0.558 (62) 0.4122 (58)0.33
(d) ECP > 16
 A-G-G11 (50) 122 (81) 0.00133 (67)0.02
 C-G-G9 (41) 0.399 (27) 0.0118 (33)0.01
 C-C-G8 (67) 0.253 (75) 0.3111 (69)0.13
 C-C-C10 (50) 111 (42) 0.4321 (46)0.56
(e) IgE > 119
 A-G-G20 (54) 0.6229 (73) 0.00449 (64)0.02
 C-G-G14 (41) 0.3015 (33) 0.0329 (37)0.02
 C-C-G7 (50) 13 (60) 0.6610 (53)0.82
 C-C-C14 (56) 0.5515 (44) 0.5029 (49)0.90
(f) BHR
 A-G-G18 (62) 0.2023 (77) 0.00341 (69)0.003
 C-G-G14 (44) 0.4811 (31) 0.0325 (37)0.04
 C-C-G3 (33) 0.324 (57) 0.717 (44)0.62
 C-C-C9 (50) 113 (43) 0.4722 (46)0.56

Single-nucleotide polymorphism TDT analyses of −38CA, +371CG, and +499GC presented in Table 4 demonstrate an association between the −38A allele and increased s-ECP levels (P = 0.04) as well as allergic asthma (P = 0.05). In addition, the +371C allele was associated with non-allergic asthma. There were no significant associations between the remaining traits, quantitative s-ECP levels or semi-quantitative PC20 values, and any of the SNP alleles (data not shown).

Table 4.   SNP TDT analysis for asthma and the different traits analyzed
SNP/alleleOslo NO (102 fam)Groningen NL (75 fam)Total (177 fam)
Transmitted (%) PTransmitted (%) PTransmitted (%)Ptdt*
  1. *Ptdt: P-value in the TDT analysis comparing the observed transmission rate with the expected 50% under the null hypothesis of no association as a chi-squared test (1 d.f.). Bold values indicate significant transmission rates (P < 0.05).

(a) Asthma
 −38CA/A41 (53)34 (60)75 (56)0.20
 +371CG/C44 (58)26 (44)70 (52)0.67
 +499GC/G26 (43)27 (53)53 (48)0.64
(b) ECP > 16
 −38CA/A20 (53) 0.7527 (71) 0.0147 (62)0.04
 +371CG/C25 (54) 0.5520 (50) 145 (52)0.67
 +499GC/G19 (54) 0.6117 (50) 136 (52)0.72
(c) BHR
 −38CA/A24 (53) 0.6526 (63) 0.08450 (58)0.13
 +371CG/C19 (48) 0.7523 (51) 0.88543 (51)0.91
 +499GC/G15 (52) 0.8520 (51) 0.87335 (51)0.81
(d) Se-IgE > 119
 −38CA/A26 (49) 0.8928 (62) 0.1054 (55)0.31
 +371CG/C28 (53) 0.6821 (51) 0.8849 (52)0.68
 +499GC/G20 (47) 0.6517 (46) 0.6237 (46)0.50
(e) Allergic asthma
 −38CA/A32 (56) 0.3534 (63) 0.0666 (59)0.05
 +371CG/C28 (50) 123 (44) 0.4051 (47)0.56
 +499GC/G21 (48) 0.8822 (52) 0.7543 (51)0.91
(f) Non-allergic asthma
 −38CA/A27 (47) 0.709 (50) 1.0036 (48)0.73
 +371CG/C33 (61) 0.1012 (63) 0.2545 (62)0.05
 +499GC/G14 (37) 0.107 (41) 0.4721 (38)0.08

Discussion

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

The present study demonstrates associations between the A-G-G haplotype and asthma, s-ECP levels, allergic asthma, increased IgE levels, and BHR, while the haplotype that differs only in the −38CA site (C-G-G) is significantly associated with reduced occurrence of the same phenotypes. In addition, the −38A allele in the RNASE3 gene is associated with s-ECP levels above 16 μg/l and allergic asthma, while the +371C allele is associated with non-allergic asthma.

The observed associations between RNASE3 genetics, asthmatic traits, and s-ECP levels are supported by previous studies demonstrating associations between RNASE3 polymorphisms, s-ECP levels, cellular levels of ECP, or allergy (11, 17, 18). A recent study demonstrated an association between the + 499G allele and high cellular ECP content (18). This allele, however, is present on both the asthma/allergy-associated A-G-G haplotype and the protective C-G-G haplotype detected in the present study, raising the question of a possible haplotype effect rather than an SNP effect. The Japanese study (11) demonstrated an association between s-ECP levels and the −393CT SNP and no association with the −38CA SNP. However, in our study population, the −393CT SNP was not detected. Despite similar allele frequencies, the present study could not reproduce the results of the Swedish association study detecting an association between the +371G allele and allergy but not asthma (17), although the +371G allele was associated with protection against the phenotype non-allergic asthma in the present study. The genetic association studies were not directly comparable, as the Swedish genetic association study was a case–control study of 76 asthmatic subjects (students) and 209 controls, the Japanese study a family association study including 137 families with asthmatic probands (mean age 11 years), while the present association study included 177 families with at least two children with asthma. The present study thus represents the largest study performed to explore RNASE3 polymorphisms and asthma, and being a TDT analysis, it is also robust with respect to population stratification.

The present TDT analysis demonstrated consistently stronger associations between the ECP haplotypes and asthma traits in Groningen than in Oslo, despite similar allele frequencies. However, the transmission rates in Oslo show the same direction as in Groningen (54–62% transmission of the A-G-G haplotype to all traits except s-ECP > 16), although not reaching statistical significance. It is also noted that the Groningen proband/sibling population had a higher rate of allergic sensitization, more frequent BHR, higher frequencies of increased s-IgE and s-ECP levels, and higher frequencies of ICS use than the Oslo population. Together, these observations may indicate that the Groningen population represents a more allergic and/or severe asthma phenotype where the genetic contribution is stronger than in the Oslo population. The Swedish studies detecting association between the +371G allele and the linked +499G allele with allergy (17) and cellular content of ECP (18) may suggest that the extended A-G-G haplotype (including the two alleles) is involved in the asthmatic/allergic inflammation.

Whether the association found between A-G-G haplotype of the RNASE3 gene and asthma works through a regulation of s-ECP levels cannot fully be ascertained in the present study. Significant associations were found by TDT analysis demonstrating a link between high s-ECP and the A-G-G haplotype (also associated with asthma) as well as the −38A allele, yet as all subjects with s-ECP > 16 also had asthma, a final interpretation must thus be made with caution. However, previous studies further lend support to the hypothesis. Functional studies have shown that the −38CA SNP is located in close vicinity of a known enhancer element within the intron [the NFAT-1 consensus sequence involved in regulation of gene expression for several other cytokine genes (22)] (Fig. 1). In addition, the −38CA SNP disrupts a possible GATA-1-binding site (21) (Fig. 1), where GATA-1 is a transcription factor that plays a crucial role in the development of eosinophilic cells (20) and has been shown to regulate transcription of another eosinophil granulocyte gene major basic protein (MBP) (34). Thus, one might speculate whether the A-G-G haplotype (including the −38A allele) influences RNASE3 transcription through one of these two mechanisms.

In conclusion, the present study demonstrated a significant association between the A-G-G haplotype in the RNASE3 gene and asthma. The −38A allele of the A-G-G haplotype is additionally associated with high s-ECP levels and allergic asthma, and is located in vicinity of an enhancer element and also interrupts a possible GATA-1-binding site. Further functional studies of RNASE3 genetics in light of the associations with allergic asthma inflammation would help elucidate the role of RNASE3 genetics in clinical evaluations.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

We are very grateful to all the children and their parents for participating in the study. We thank Marlies Feijen for collecting clinical samples in Groningen and data handling, and Kristina Gervin for genotyping assistance. The Genetics of Asthma International Network (GAIN), conducted by GlaxoSmithKline, made this study possible. Beyond this, GlaxoSmithKline did not participate in the present study.

Funding

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

The GAIN study was financed by GlaxoSmithKline. The genetic analysis was financially supported by the University of Oslo, Norway, The National Programme for Research in Functional Genomics in Norway (FUGE), and the Eastern Norway Regional Health Authority.

Conflict of interest

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References

The GAIN study was funded by GlaxoSmithKline. The ECP investigation within the GAIN study was initiated and carried out by the researchers independently of the funding body. No conflict of interest exists.

References

  1. Top of page
  2. Abstract
  3. Subjects and methods
  4. Genotyping
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Funding
  9. Conflict of interest
  10. References
  • 1
    Carlsen KC, Haland G, Devulapalli CS, Munthe-Kaas M, Pettersen M, Granum B et al. Asthma in every fifth child in Oslo, Norway: a 10-year follow up of a birth cohort study. Allergy 2006;61:454460.
  • 2
    Woolcock AJ, Peat JK. Evidence for the increase in asthma worldwide. Ciba Found Symp 1997;206:122134.
  • 3
    Koppelman GH, Los H, Postma DS. Genetic and environment in asthma: the answer of twin studies. Eur Respir J 1999;13:24.
  • 4
    NIH/WHO. Global strategy for asthma management and prevention: updated workshop report. Bethesda: NIH, 2005.
  • 5
    Venge P, Bystrom J, Carlson M, Hakansson L, Karawacjzyk M, Peterson C et al. Eosinophil cationic protein (ECP): molecular and biological properties and the use of ECP as a marker of eosinophil activation in disease. Clin Exp Allergy 1999;29:11721186.
  • 6
    Wolthers OD. Eosinophil granule proteins in the assessment of airway inflammation in pediatric bronchial asthma. Pediatr Allergy Immunol 2003;14:248254.
  • 7
    Matsumoto H, Niimi A, Minakuchi M, Izumi T. Serum eosinophil cationic protein levels measured during exacerbation of asthma: characteristics of patients with low titres. Clin Exp Allergy 2001;31:637643.
  • 8
    Wolthers OD, Heuck C. Circadian variations in serum eosinophil cationic protein, and serum and urine eosinophil protein X. Pediatr Allergy Immunol 2003;14:130133.
  • 9
    Hoekstra MO. Can eosinophil-derived proteins be used to diagnose or to monitor childhood asthma? Clin Exp Allergy 1999;29:873874.
  • 10
    Venge P. Monitoring the allergic inflammation. Allergy 2004;59:2632.
  • 11
    Noguchi E, Iwama A, Takeda K, Takeda T, Kamioka M, Ichikawa K et al. The promoter polymorphism in the eosinophil cationic protein gene and its influence on the serum eosinophil cationic protein level. Am J Respir Crit Care Med 2003;167:180184.
  • 12
    Zhang J, Rosenberg HF. Sequence variation at two eosinophil-associated ribonuclease loci in humans. Genetics 2000;156:19491958.
  • 13
    Young JD, Peterson CG, Venge P, Cohn ZA. Mechanism of membrane damage mediated by human eosinophil cationic protein. Nature 1986;321:613616.
  • 14
    Carreras E, Boix E, Rosenberg HF, Cuchillo CM, Nogues MV. Both aromatic and cationic residues contribute to the membrane-lytic and bactericidal activity of eosinophil cationic protein. Biochemistry 2003;42:66366644.
  • 15
    Zagai U, Skold CM, Trulson A, Venge P, Lundahl J. The effect of eosinophils on collagen gel contraction and implications for tissue remodelling. Clin Exp Immunol 2004;135:427433.
  • 16
    Hohlfeld JM, Schmiedl A, Erpenbeck VJ, Venge P, Krug N. Eosinophil cationic protein alters pulmonary surfactant structure and function in asthma. J Allergy Clin Immunol 2004;113:496502.
  • 17
    Jonsson UB, Bystrom J, Stalenheim G, Venge P. Polymorphism of the eosinophil cationic protein-gene is related to the expression of allergic symptoms. Clin Exp Allergy 2002;32:10921095.
  • 18
    Jonsson UB, Bystrom J, Stalenheim G, Venge P. A (G->C) transversion in the 3′ UTR of the human ECP (eosinophil cationic protein) gene correlates to the cellular content of ECP. J Leukoc Biol 2006;79:846851.
  • 19
    Hakonarson H, Bjornsdottir US, Halapi E, Palsson S, Adalsteinsdottir E, Gislason D et al. A major susceptibility gene for asthma maps to chromosome 14q24. Am J Hum Genet 2002;71:483491.
  • 20
    Hirasawa R, Shimizu R, Takahashi S, Osawa M, Takayanagi S, Kato Y et al. Essential and instructive roles of GATA factors in eosinophil development. J Exp Med 2002;195:13791386.
  • 21
    Merika M, Orkin SH. DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 1993;13:39994010.
  • 22
    Handen JS, Rosenberg HF. Intronic enhancer activity of the eosinophil-derived neurotoxin (RNS2) and eosinophil cationic protein (RNS3) genes is mediated by an NFAT-1 consensus binding sequence. J Biol Chem 1997;272:16651669.
  • 23
    Munthe-Kaas MC, Carlsen KH, Helms PJ, Gerritsen J, Whyte M, Feijen M et al. CTLA-4 polymorphisms in allergy and asthma and the TH1/ TH2 paradigm. J Allergy Clin Immunol 2004;114:280287.
  • 24
    American Thoracic Society. Lung function testing: selection of reference values and interpretative strategies. Am Rev Respir Dis 1991;144:12021218.
  • 25
    Crapo RO, Morris AH, Gardner RM. Reference spirometric values using techniques and equipment that meet ATS recommendations. Am Rev Respir Dis 1981;123:659664.
  • 26
    Wang X, Dockery DW, Wypij D, Gold DR, Speizer FE, Ware JH et al. Pulmonary function growth velocity in children 6 to 18 years of age. Am Rev Respir Dis 1993;148(6 Pt 1):15021508.
  • 27
    Dreborg S, Frew A. Allergen standardization and skin tests. Allergy 1993;48 (Suppl. 14):48S82S.
  • 28
    Lodrup Carlsen KC, Halvorsen R, Ahlstedt S, Carlsen KH. Eosinophil cationic protein and tidal flow volume loops in children 0–2 years of age. Eur Respir J 1995;8:11481154.
  • 29
    Peterson CG, Enander I, Nystrand J, Anderson AS, Nilsson L, Venge P. Radioimmunoassay of human eosinophil cationic protein (ECP) by an improved method. Establishment of normal levels in serum and turnover in vivo. Clin Exp Allergy 1991;21:561567.
  • 30
    Hargreave FE, Ryan G, Thomson NC, O'Byrne PM, Latimer K, Juniper EF et al. Bronchial responsiveness to histamine or methacholine in asthma: measurement and clinical significance. J Allergy Clin Immunol 1981;68:347355.
  • 31
    O'Connell JR, Weeks DE. PedCheck: a program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet 1998;63:259266.
  • 32
    Wigginton JE, Abecasis GR. PEDSTATS: descriptive statistics, graphics and quality assessment for gene mapping data. Bioinformatics 2005;21:34453447.
  • 33
    Ewens WJ, Spielman RS. The transmission/disequilibrium test: history, subdivision, and admixture. Am J Hum Genet 1995;57:455464.
  • 34
    Du J, Stankiewicz MJ, Liu Y, Xi Q, Schmitz JE, Lekstrom-Himes JA et al. Novel combinatorial interactions of GATA-1, PU.1, and C/EBPepsilon isoforms regulate transcription of the gene encoding eosinophil granule major basic protein. J Biol Chem 2002;277:4348143494.