SEARCH

SEARCH BY CITATION

Keywords:

  • Cryptic species;
  • Cynoglossidae;
  • flatfish;
  • hydrothermal vents;
  • Pleuronectidae;
  • seamounts;
  • volcanic arcs

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Hydrothermal vents near the summits of seamounts in Western Pacific volcanic arcs foster dense populations of flatfishes, a group otherwise unknown at vents. We examined genetic divergence among populations of a symphurine tonguefish described as Symphurus thermophilus Munroe & Hashimoto from sites up to 6000 km apart in the Western Pacific to explore connectivity patterns among seamounts. Average genetic divergence between individuals from the Mariana Arc and the Tonga-Kermadec Arcs was 14.2% (COI) and 9.0% (16S), whereas within-arc divergences were <0.3%. We found that the Tonga-Kermadec individuals represent a cryptic species, Symphurus sp. A, displaying similar phenotypic features and behaviour to the Mariana Arc S. thermophilus. We also sequenced another distinctive symphurine species; Symphurus sp. B. Collections and image records from three expeditions to the Tonga and Kermadec arcs revealed characteristics of the distribution, dispersion, behaviour and morphology of these flatfish species. These two new Symphurus species inhabit vents where native sulphur occurs in excess and depths are <600 m. Substratum range of Symphurus sp. A was wide, including mussel beds, rock surfaces and sediments in densities that may exceed 100 m−2. Reproductive females were present. The complex and diverse nature of volcanic settings of hydrothermalism introduces a wide variety of habitat conditions that likely augments diversity of faunas on seamounts in distinct biogeographic provinces.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

The strong physico-chemical gradients and reducing fluids that characterise hydrothermal vent habitats provide the conditions for high microbial productivity and high consumer biomass. These same conditions elicit adaptations in the associated fauna, which has evolved to many distinctive lineages in venting and associated habitats. The strong endemism of animals living at hydrothermal vents fosters study of biogeographic relationships, particularly among faunas of mid-ocean ridges. The linear geometry of ridgecrests promotes population clines as deep ocean currents are deflected to move parallel to the ridge. Thus, a region tends to develop a characteristic fauna with many endemic species. Both distance and vicariant events separate biogeographic provinces (Tunnicliffe & Fowler 1996; Van Dover et al. 2002).

A seamount setting for hydrothermal vent communities on volcanic arcs lends another dimension to biogeographic patterning. In general, sea-floor communities on seamounts can be more diverse than surrounding areas (e.g. abyssal plains) and many reports suggest endemism is higher on seamounts (see review and alternative opinions in Stocks & Hart 2007). One explanation for distribution patterns along a seamount chain is the stepping stone model (Hubbs 1959; Rogers et al. 2006), which would allow a species to extend its range. For a vent species on seamounts, distribution will be limited by habitat constraints such as vent character and depth as well as the physical processes that support population connectivity along the volcanic arc. Volcanic arcs, occurring in broken chains from Kamchatka to New Zealand, are characteristic of the complex tectonic setting of the Western Pacific Ocean.

Flatfishes form the order Pleuronectiformes, which is currently divided into 14 families (Munroe 2005). Tonguefishes (Family Cynoglossidae) are left-eyed flatfishes that have a subterminal mouth and dorsal and anal fins continuous with the caudal fin (Chapleau 1988). The genus Symphurus in the subfamily Symphurinae contains 73 described species, many of which occur in the Western Pacific (Munroe 2006). Exploration of hydrothermally active volcanoes located an abundance of symphurine flatfish around vents in the Okinawa Trough and on several volcanoes of the northern Mariana Arc and adjacent Izu-Ogasawara Arc (Embley et al. 2007; Munroe & Hashimoto 2008). Recently, symphurines were also encountered and collected on the Kermadec Arc north of New Zealand. Munroe & Hashimoto (2008) undertook to describe the fish from all these vents and designated a single species, Symphurus thermophilus, with a range extending 9000 km from north of New Zealand to the southern islands of Japan. This species does not differ markedly from its congenerics: it has a deep body, a moderately long and bluntly pointed head, and relatively large, round eyes (Munroe & Hashimoto 2008). The type collections for S. thermophilus include material from the Kermadec Arc: six specimens from Macauley Volcano and a single specimen from Rumble III Volcano.

The original intent of our work in the Kermadec-Tonga Arc was to compare this apparently allopatric population of Symphurus thermophilus to that of the Mariana Arc, 6500 km apart, and to examine gene divergence within this species on nearby seamounts (hundreds of km apart). As evidence for a cryptic species emerged in the course of the study, we continued the study in the context of understanding large-scale geographic patterns in vent faunas on seamounts. Specifically, this work examines spatial patterns in species distribution on seamounts – a feature that may be a function of dispersal capabilities.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Study areas

The Tonga-Kermadec Arc system (Fig. 1) contains more than 90 volcanoes along a 2500-km linear array between Tonga and New Zealand (de Ronde et al. 2001; Smith & Price 2006). Fish were collected from Monowai and Macauley Volcanoes on the Kermadec arc (∼500 km apart); both sites have hydrothermalism in the summit calderas (Wright et al. 2008). On the Tonga Arc, flatfish occur on Volcano-1 and Volcano-19 (∼500 km apart). The latter, at the southern terminus of the Arc (and <100 km from Monowai Volcano), has two hydrothermal fields: one in a central shallow cone and the other deeper in the western caldera. Lavas on both volcanoes are basaltic andesite (Stoffers et al. 2006.) and thick beds form from sulphur-cemented ash. In several places, liquid sulphur has solidified to large expanses of yellow flows.

image

Figure 1.  Locations of Symphurus species on Western Pacific Ocean volcanic arcs. Upper left shows known distribution of Symphurus thermophilus (sensu this study). From north to south: Minami-Ensei Knoll, Kaikata Seamount, Nikko, Kasuga-2 and Daikoku Volcanoes. On the Kermadec-Tonga Arc between New Zealand and Samoa, the distribution of Symphurus species A spanned the named volcanoes (black triangles), whereas Symphurus species B currently is known from Volcanoes-1 and -19.

Download figure to PowerPoint

Our fish collection in the Mariana Volcanic Arc occurred within the Northern Seamount Province: Daikoku, Kasuga-2 and Nikko Volcanoes spanning about 300 km distance (Fig. 1). Focussed and diffuse flow from sea-floor fractures support thriving biological communities (Embley et al. 2007). Daikoku and Kasuga-2 have extensive sediment cover where flatfish are most dense but on all three seamounts, Symphurus thermophilus is also abundant on rock outcrops and around liquid sulphur pools.

Collection

During the 2005 Ring of Fire Expedition to the Kermadec and Tonga Arcs between New Zealand and Samoa, and the SITKAP (Germany) cruise the same year, symphurine tonguefish were photographed by manned submersibles on three volcanoes and collected on the southernmost: Macauley Volcano. Specimens from the Macauley collection formed part of the description of Symphurus thermophilus (Munroe & Hashimoto 2008). In 2007, the remotely operated vehicle ROPOS collected and photographed fish on three other volcanoes: Monowai (photographed only), Volcano-1 and Volcano-19. Fish were collected using a suction sampler but minnow traps baited with catfood returned most specimens. On board, fish were preserved in 95% ethanol. In the Northern Mariana Arc, we collected fish in three consecutive years using suction samplers on three ROVs: ROPOS in 2004, Hyperdolphin in 2005, and Jason-2 in 2006.

Genomic DNA extraction, amplification, and sequencing

Total genomic DNA was extracted from specimens (stored in 95% ethanol) using a chelex extraction method. A portion of the sample was placed in 5% Chelex-100 resin (Sigma) solution [5% Chelex-100 resin, 0.2% SDS in Tris-EDTA, proteinase K (100 μg·ml−1)] and incubated at 55 °C for 30 min, 95 °C for 10 min, cooled to 4 °C, vortexed gently, and then stored at −20 °C.

PCRs of partial 16S and COI genes were carried out using a mitochondrial DNA primer set (Table 1). Extraction tubes were spun down to pellet the chelex and cell debris and the supernatant was diluted 1/10 with Gibco Ultrapure water. Amplification of the COI subunit-I region required a primer cocktail. The 25-μl reaction contained 1× Green Gotaq Flexi buffer, 2.5 mm Mg2+, 0.2 mm dNTPs, 0.025 units GoTaq Hotstart, 0.4 mm Forward primer cocktail, 0.4 mm Reverse primer cocktail, 1 μl 1/10 template, and Gibco Ultrapure water to complete the reaction. The thermocycler condition for 16S and COI-3 primer sets was 94 °C for 2 min (Hot start), 37 cycles of 94 °C for 30 s, 52 °C for 40 s, 72 °C for 1 min, and a final extension of 72 °C for 10 min.

Table 1.   Primer list for PCR amplifications (see Ivanova et al. 2007).
primer No.nameratioprimer sequence 5′–3′product/primer position
 16S  2974–3546
116Sar-5′1CGCCTGTTTATCAAAAACAT2954–2973
216Sbr-3′1CCGGTCTGAACTCAGATCACGT3568–3547
 COI-3 C_FishF1t1–C_FishR1t16475–7126
17FishF11TCAACCAACCACAAAGACATTGGCAC 
18FishF21TCGACTAATCATAAAGATATCGGCAC 
19FishR11TAGACTTCTGGGTGGCCAAAGAATCA 
20Fish R21ACTTCAGGGTGACCGAAGAATCAGAA 

PCR products were purified using the QIAquick PCR purification kit (Qiagen), quantified and diluted to 30–40 ng·μl−1 using Gibco Ultrapure water, and then sequenced using the 16S PCR primers or the COI-3 primer cocktail. The 5-μl sequencing reaction included 1.0 μl 5× BigDye Terminator Buffer v3.1 (Applied Biosystems), 1.0 μl Big Dye Terminator, 1.0 μl primer cocktail (3.2 μm), and 60–80 ng purified PCR product. Sequences were deposited in GenBank. Species identification, GenBank accession numbers, BOLD identification numbers (Ratnasingham & Hebert 2007), collection sites, identification data and reference information are provided in Appendix 1.

Phylogenetic analysis

To provide a general overview of sequence relationships, we used the PHYLIP package because it offers many different analysis methods, is freely available and is commonly used (Felsenstein 2004). Sequences were aligned using Clustal X (2.0) (Larkin et al. 2007). Distance matrices were also computed for 1000 bootstrapped datasets using the F84 model of nucleotide substitution. Neighbour-joining trees were computed from each set of distance matrices and the set of resulting bootstrapped trees was used to derive a 70%-majority consensus tree (Felsenstein 2004). A single, optimal neighbour-joining tree was generated from the complete datasets with branch lengths reflecting phylogenetic distances and bootstrap percentages indicated on relevant branches.

For the COI dataset, in addition to all GenBank COI sequences from Cynoglossidae plus two outgroup sequences (EF607480, EF607484), we included 16 Symphurus COI sequences (with permission from the authors) from the BOLD database (http://www.barcodinglife.org). For the 16S dataset, all GenBank 16S sequences from Cynoglossidae plus one outgroup sequence (AY998030) were included. As species designations for many of these sequences is either not known or not linked to morphological descriptions, and as there is no comprehensive survey linking morphological observations to molecular data, it is premature to link many of the sequences with species designations. Thus, we indicate sequences by their BOLD barcode designation or GenBank Accession number.

During this study, uncertainty about species designations and corresponding molecular data in gene databases became apparent. In several cases, species designations from different laboratories appeared paraphyletic. In addition, few samples were represented by both of the gene sequences we used, so phylogenetic relationships were difficult to compare between datasets. Because unravelling taxonomic uncertainties within the Cynoglossidae is beyond the scope of this paper, we restrict commentary to the common themes apparent from both 16S and COI datasets to support the purpose of this study: to investigate vent symphurine populations from two distinct regions of the West Pacific Ocean region.

Other biological characteristics

Photographs from high-resolution still cameras and video from standard-definition recording formed the basis of field descriptions. Using navigated submersible tracks, we plotted locations of all observed fish to determine their distance from point source venting. In preserved specimens of Symphurus species A, standard morphological metrics were measured following Munroe & Hashimoto (2008); we tested for differences in these metrics between volcanic arcs using t-tests. Preserved weight was converted as suggested for juvenile Atlantic salmon (Thornstad et al. 2007): W = 0.08 + 1.25 Wp, where W = live weight and Wp = preserved weight. We dissected 25 fish from Volcano-1 to examine gut contents.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Genetic identifications

A phylogenetic analysis of COI and 16S trees indicates that the genus Symphurus forms a natural group distinct from specimens represented mostly by Cynoglossus species (Fig. 2). One COI sequence (DQ 116754) and three 16S sequences (AM181779, AM181780, DQ112685) within the Cynoglossus group were labelled as Paraplagusia species. More extensive comparisons are needed to confirm relationships among genera.

image

Figure 2.  Phylogenetic relationships of Cynoglossidae as determined by neighbour-joining tree analysis of genetic distances. GenBank Accession or BoLD identification numbers are used to identify sequences. Numbers on branches indicate bootstrap values out of 1000 replicates that support that link. In both trees, the asterisked branch is Symphurus species B from Volcano-19. (A) COI data. (B) 16S data.

Download figure to PowerPoint

Within the Symphurus group, the nature of the current COI and 16S datasets makes it premature to identify common species relationships; many sequences lack species identification and there is poor species overlap between the datasets. However, it is clear that individuals identified as Symphurus thermophilus (sensu Munroe and Hashimoto) form two distinct molecular groups that correspond to the two volcanic arcs. The Northern Mariana Arc is represented by specimens from Daikoku, Kasuga-2 and Nikko sites and the southern Tonga and Kermadec Arcs are represented by Volcano-1, Volcano-19 and Macauley specimens. These groupings are distinct branches in both datasets (Fig. 2) and are very strongly supported by 1000/1000 bootstrap analysis. We subsequently refer to the Mariana Arc specimens as S. thermophilus and the Tonga-Kermadec Arc specimens as Symphurus species A. The specimen represented as Symph160 (COI) and FJ858979 (16S) collected from Volcano-19 appears, from a preliminary morphological and molecular analysis, to represent a novel species and is referred to here as Symphurus species B. Both these species are currently under description (T. Munroe, pers. comm.).

The closest COI sequence to the Symphurus thermophilus/ Symphurus species A group is FOAF69907 (unknown cynoglossid from Western Australia) and more distantly SCAFB35307 (unknown species from Nova Scotia Canada). The closest 16S sequences are AM182037 (provisional identification is Symphurus‘rafinesque’ in GenBank entry, from the North Western Pacific; note that this species name is not valid), AM182038 (Symphurus strictus with an Indo-Pacific distribution) and FJ858979 (our Symphurus species B from Volcano-19).

Genetic variation among individuals of Symphurus thermophilus within the Mariana Arc was <0.02% (COI, n = 32) and 0.00% (16S, n = 22). There is a high level of genetic similarity among individuals from Daikoku (n = 9), Kasuga-2 (n = 11) and Nikko (n = 11). Within the Tonga-Kermadec Arcs, divergence between individuals of Symphurus species A was 0.24% (COI, n = 13) and 0.00% (16S, n = 11). A very high level of genetic similarity exists among individuals from Volcano-1 (n = 10), Volcano-19 (n = 1) and Macauley (n = 3) even though locations span 1000 km. On the other hand, the average genetic divergence between individuals from the Mariana Arc and the Tonga-Kermadec Arcs was 14.2% (COI) and 9.0% (16S).

Vent association

Field observers located Symphurus species A on four volcanoes of the Tonga-Kermadec Arc (Table 2). This species was closely associated with hydrothermal vents. On Volcano-19, our plots of flatfish occurrences located Symphurus species A (n = 10 images) within 25 m of point-source venting (i.e. shimmering water or a venting chimney). In over 90% of images (total over 700) of fish on all volcanoes, there was evidence of hydrothermal influence such as vent-obligate species, bacterial mat or sulphur-related deposits.

Table 2.   Locations of Symphurus species on the Tonga and Kermadec Volcanic Arcs. The Rumble III record is a single dredged specimen (Munroe & Hashimoto 2008).
sitelocationsummit depthspecies A depth rangespecies B depth range
Volcano-1 Tonga Arc24º48.00’ S 175º45.00’ W65 m83–288 m195–381 m
Volcano-19 Tonga Arc24º48.00’ S 177º01.00’ W385 m419–562 m433–560 m
Monowai Volcano Kermadec Arc25°48.30’ S 177°10.11’ W100 m275 mnot seen
Macauley Volcano Kermadec Arc30º12.00’ S 178º28.00’ W138 m260–360 mnot seen
Rumble III Volcano Kermadec Arc35º44.22’ S 178º29.70’ E200 m∼250 mnot seen

Symphurus species B was seen only at Volcano-19 on the Tonga Arc. It is quite distinct in images: the body shape is oval and it is distinguished by two large ‘eyespots’ flanking the posterior (Fig. 3E,G). On Volcano-19, it was abundant in an area near a high temperature vent that supported abundant clams (thyasirids). A probe inserted ∼10 cm into the sediments registered 11 °C (bottom water 5 °C), indicating a low flux of hydrothermal fluid. This species also has a strong affiliation with venting: 90% of Symphurus species B observations (n = 57) were within 30 m of obvious venting.

image

Figure 3. Symphurus species on Western Pacific volcanic arcs. (A) Symphurus species A: Volcano-1, Tonga Arc, 195 m. There are 25 individuals in this image (about 40 cm across); the white arrow indicates a single individual of Symphurus species B. (B) Mussel field on Volcano-1 where Symphurus species A is abundant (arrow). Image is distorted by rising bubbles of carbon dioxide. Temperature measured to 34 °C among mussels. (C) Two Symphurus species A collected from Macauley Volcano; scale is 5 cm long. Courtesy M. Clark (NIWA). (D) A vertical wall of sheeted sulphur flows on Macauley Volcano at 330 m with many Symphurus species A. Courtesy SRoF Expedition. (E,F) Symphurus species B on Volcano-19, Tonga Arc at 560 m depth. Note the large ‘eyespots’ on the posterior. Green laser dots in (F) are 10 cm apart. (G) Symphurus thermophilus on consolidated substratum on Daikoku Volcano, Mariana Arc at 410 m depth. Red lasers are 10 cm apart.

Download figure to PowerPoint

Habitat

The best observations of Symphurus species A occurred on Volcano-1 and Volcano-19 where the occurrences ranged from 83 to 562 m depth. We could not locate fish in the deep vent field on Volcano-19 (900–1000 m). Visibility on Monowai was hindered by cloudy water from a chronic eruption; however, fish were seen at 275 m among mussels (Bathymodiolus sp. – not Bathymodiolus brevior). In contrast, clear viewing and images of mussel beds (B.  brevior) at 1100 m depth showed no flatfish. Symphurus species A was also abundant among mussels (Bathymodiolus sp.) on Volcano-1 (Fig. 3B) and Macauley, where they were highly cryptic with strong white stripes across a black background that blended with the white tissue (mantle) of gaping black mussels. Fish moved frequently, swimming over and diving between mussels before alighting in adjacent fine sediment areas. The substratum range for Symphurus species A is broad, including vertical walls and chimneys (Fig. 3D) where the main constituent was sulphur (identifiable by yellow coloration).

Abundance and behaviour

Fish displayed no evasive manoeuvres during submersible transits or stationary observation. We estimated abundances in three images of highest fish densities using the average size of Symphurus species A to create an artificial scale. These fish reached maximum abundances between 90 and 160 fish·m−2 (Fig. 3A). Areas of high abundance were limited but scattered fish extended broadly around the vents. Symphurus species A occurred in low abundances on consolidated surfaces that had white bacterial films. We encountered it occasionally about a metre off the sea floor but mostly it swam in small ‘jumps’ over the bottom. On Volcano-19 and Macauley Volcano, highest abundances occurred on coarse sediments where activity was constant as the fish shifted through the sediments while adjusting body position in small increments.

Individuals of Symphurus species B were more quiescent than Symphurus species A and flipped sediment over the body as camouflage. During a period of 20 min, three fish were examined without the ROV moving: two fish were 11 cm in length and the third about 9 cm. Movements were infrequent and executed equally in a forward or backward direction as fin undulation apparently pushed against the bottom. When approached by another fish, one individual raised its tail, thus elevating the eyespots that were also visible from the underside.

Morphology

The Symphurus species A collected on Volcano-1 had a maximum size at 66.5 mm. All individuals over 50 mm standard length were female (Fig. 4). There was a close relationship between fish length and preserved weight (Fig. 4) which would allow biomass estimates from photographic surveys in the future. Of 11 dissected females, five were gravid (44 mm was the smallest gravid). Of 25 specimens examined, five had a polychaete(s) and two had small crustaceans in the gut; all these fish were from sedimented substrata.

image

Figure 4.  Length–weight relationship for Symphurus species A on Volcano-1, Tonga Arc. n = 31, the power curve fit r2 = 0.97. Of the 11 dissected females, five were gravid.

Download figure to PowerPoint

Symphurus thermophilus and Symphurus species A from the Mariana Arc and the Tonga-Kermadec Arcs are very similar in pigmentation, size and shape (Fig. 3F). Although Mariana fish reached a larger maximum size (126 cm), we observed that mean and maximum fish sizes varied substantially among seamounts (unpubl. data), thus the southern species may also be able to attain larger sizes. Of the standard meristics (see Munroe & Hashimoto 2008 for a complete list), several were significantly smaller for S. thermophilus on Daikoku and Kasuga-2 (Mariana; n = 83) compared to Symphurus species A on Volcano-1 (Tonga; n = 30) in postorbital length, upper jaw length, eye diameter, opercular lower lobe (t-tests; P < 0.05). We examined several relative proportions to remove the size effect using all Mariana specimens (n = 118). The ratio of eye diameter to standard length on the Kermadec specimens was significantly larger (t = 2.86; P < 0.01) as was the ratio of caudal fin length to standard length (t = 5.83; P < 0.01).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

The high level of genetic divergence between tonguefish individuals from the Mariana Arc and from the Tonga-Kermadec Arc, as shown by both genes examined, strongly supports the interpretation of little or no migration of individuals between the Arcs. The 9.0% divergence between the COI genes of the Mariana and Tonga-Kermadec Arc Symphurus exceeds the difference of less than 3% observed between thousands of conspecific lepidopteran and vertebrate species in the Barcoding programs (Hebert et al. 2003). Among Australian fish, congeneric separation averaged 9.93% (Ward et al. 2005) with intra-specific variation averaging 0.39%. Thus, we propose that both the symphurines from the Tonga-Kermadec arcs are novel species. There are over 60 species of cynoglossid flatfishes in the Western Pacific and the genus Symphurus is well represented (Minami & Tanaka 1992). Even though the molecular databases are quite limited, it appears that this genus has penetrated the hydrothermal vent habitat at least twice in this region.

Sequence data revealed little divergence among tonguefish individuals within the Mariana Arc or within the Tonga-Kermadec Arcs. Little genetic isolation exists within either the northern or the southern populations, indicating that extensive mixing occurs within these arcs, at least between seamounts up to 1000 km apart. It is likely that the gene pool is mixed with pelagic juvenile stages. It is also possible that there are unknown source populations that are recruiting to vents in both the volcanic arcs. Overall, the distance data indicate two very distinct groups and very little divergence within each group. This is consistent with two genetically isolated populations.

The holotype location for Symphurus thermophilus was designated as Kaikata Seamount, in the Izu-Ogasawara Arc (but not in the Okinawa Trough as indicated in the holotype figures of Munroe & Hashimoto 2008). Thus, the Tonga-Kermadec Symphurus species A requires a formal redescription (T. Munroe, in progress). We are not surprised that Munroe & Hashimoto (2008) combined this species with S. thermophilus as there is little to distinguish it morphologically or behaviourally. Selection to maintain the phenotype may be operating in the similar geologic conditions on the two arc complexes. The use of molecular approaches is likely to identify many such cryptic species in the ocean. There may be substantial undiscovered diversity in fishes that we currently know as single species with broad ranges. For example, of 35 species ranging from Australia to South Africa, Zemlak et al. (2009) find that one-third have ‘within-species’ COI sequence divergences of over 2% (averaging over 5%).

The two Tonga-Kermadec species occur in close proximity to point source venting and extend to the periphery of venting influences; they appear to be true vent inhabitants with reproductive females present in the population. As there are few fish endemic to hydrothermal vents, many of which are zoarcids (Biscoito 2006), the discovery of three symphurine tonguefishes in the Western Pacific represents an important addition. The role of these species appears to be as an upper-level consumer preying on polychaetes and crustaceans among the mussels and in sediments. One area of further work will be to determine how the two species on the Tonga Arc co-exist. Symphurus species B may have a more restricted niche in sediments where it can bury. The range of substrata that Symphurus species A occupies is large, suggesting that it also has an opportunistic diet. Most unusual were the aggregations of Symphurus species A on vertical walls and chimneys in which sulphur or pyrite/sphaelerite were major constituents (Stoffers et al. 2006). One hypothesis is that fish feed on filamentous bacteria that grow on these surfaces. Elemental sulphur and iron sulphides are a source of available energy for chemosynthesis (McCollom 2000).

There may be a bathymetric constraint on the distribution of the new species: neither was seen deeper than 600 m, nor have they been observed at vents on Brothers Volcano, Clark Volcano (Kermadec Arc) or Hine Hina (nearby Lau Basin) where venting exceeds this depth. Similarly, on Volcano-19, Symphurus spp. were absent on the deep venting field at 900–1000 m depth. The depth range is consistent with other deep-sea Symphurus species (Munroe & Hashimoto 2008).

Our study identifies two novel tonguefishes on Southwest Pacific volcanic arcs, one of which appears to have derived from a common ancestor with Symphurus thermophilus in the Northwest Pacific. Most vent species occupy ranges restricted to a single biogeographic region (Tunnicliffe & Fowler 1996), although broad ranges can occur (e.g. the mussel Bathymodiolus brevior in both Mariana and Tonga-Kermadec Arcs). Thus, the clarification of two distinct lineages of Symphurus at vents in the Northwest and Southwest Pacific is not an unusual observation. It does, however, support regionialisation of vent faunas on these Arcs. The boundary between these regions is unclear and is likely determined by available habitat (venting seamounts) and dispersal vectors. The most likely ‘intermediate zone’ is on the Feni-Tabar Arc east of New Guinea where hydrothermalism is known on seamounts (Petersen et al. 2002). Between New Guinea and the Mariana Volcanic Arc lies the quiescent Caroline Plate, where suitable habitat may be absent and the ocean current heads eastward along the equator.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

The results of our work contribute to a larger understanding of the role of vents in diversification of seamount faunas. While disagreement exists about whether seamounts harbour greater endemism among deep-sea faunas (Stocks & Hart 2007), there is some rationale to explore the role of active volcanism and hydrothermalism in promoting higher regional diversity among faunas on seamounts. On a volcanic arc, we see great variability in the nature of hydrothermalism due to differences in magmatic behaviour. Volatile and source rock chemistry controls the nature of reducing compounds, while magma dynamics influence the extent, intensity and sustainability of the fluid flows that define the vent habitat. The result is highly diverse volcanic behaviour within an arc (e.g.de Ronde et al. 2001; Smith & Price 2006) and variability in the associated vent communities (Embley et al. 2007). Symphurus spp. do not occur on all venting volcanoes in either arc investigated; we note a particular affinity for volcanoes with excess sulphur. On an adjacent volcano, the role of this upper-level consumer may be filled by a different species, thus enhancing regional diversity of the seamount fauna.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

We acknowledge the following expeditions to collect material: the New Zealand American Submarine Ring of Fire 2005 Expedition (Embley/Massoth/Malahoff Co-chiefs) with R/V Ka’imikai-O-Kanaloa and submersible Pisces V; the SITKAP 2005 Expedition (Stoeffers/Schwarz-Schampera Co-chiefs) with R/V Ka’imikai-O-Kanaloa and submersible Pisces IV; the MANGO 2007 Expedition (Herzig/Hannigton Co-chiefs) with R/V Sonne and ROV ROPOS. Our thanks for field collections to M. Clark, K. Juniper and C. Stevens. Dirk Steinke of the Barcode of Life Project was instrumental in identifying sequences of interest and creating many of the comparison COI sequences we used. We thank P. Bentzen, R. Ward and P. Smith for permission to use sequences not in public databases. Other help and advice came from J. Dower and J. Rose. We acknowledge funding from NSERC Canada and from the Census of Marine Life programme, CenSeam (a global census of marine life on seamounts).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information
  • Biscoito M. (2006) Chordata, Chondrichthyes and Osteichthyes. In: DesbruyèresD., SegonzacM., BrightM. (Eds), Handbook of Deep-Sea Hydrothermal Vent Fauna. Denisia 18, Linz, Austria: 489511.
  • Chapleau F. (1988) Comparative osteology and intergeneric relationships of the tongue soles (Pisces; Pleuronectiformes; Cynoglossidae). Canadian Journal of Zoology, 66, 12141232.
  • Embley R.W., Baker E.T., Butterfield D.A., Chadwick W.W. Jr, Lupton J.E., Resing J., De Ronde C., Nakamura K., Tunnicliffe V., Dower J., Merle S.G. (2007) Exploring the Submarine Ring of Fire: Mariana Arc – Western Pacific. Oceanography, 20, 6879.
  • Felsenstein J. (2004) PHYLIP (Phylogeny Inference Package) version 3.6. Distributed by the Author. Department of Genome Sciences, University of Washington, Seattle, WA.
  • Hebert P.D., Cywinska A., Ball S.L., DeWaard J.R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270, 313321.
  • Hubbs C.L. (1959) Initial discoveries of fish faunas on seamounts and offshore banks in the eastern Pacific. Pacific Science, 13, 311316.
  • Ivanova N.V., Zemlak T.S., Hanner R.H., Hebert P.D. (2007) Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes, doi: 10.1111/j.1471-8286.2007.01748.x.
  • Larkin M.A., Blackshields G., Brown N.P., Chenna R., McGettigan P.A., McWilliam H., Valentine F., Wallace I.M., Wilm A., Lopez R., Thompson J.D., Gibson T.J., Higgins D.G. (2007) Clustal W and Clustal X version 2.0. Bioinformatics, 23, 29472948.
  • McCollom T.M. (2000) Geochemical constraints on primary productivity in submarine hydrothermal vent plumes. Deep-Sea Research I, 47, 85101.
  • Minami T., Tanaka M. (1992) Life history cycles in flatfish from the northwestern Pacific, with particular reference to their life histories. Netherlands Journal of Sea Research, 29, 3548.
  • Munroe T.A. (2005) Systematic diversity of the Pleuronectiformes. In: GibsonR.N. (Ed.), Flatfishes: Biology and Exploitation. Blackwell Science Ltd, Oxford: 1041.
  • Munroe T.A. (2006) New western Indian Ocean tonguefish (Pleuronectiformes: Cynoglossidae, Symphurus). Copeia, 2, 230234.
  • Munroe T.A., Hashimoto J. (2008) A new Western Pacific tonguefish (Pleuronectiformes: Cynoglossidae): the first pleuronectiform discovered at active hydrothermal vents. Zootaxa, 1839, 4359.
  • Petersen S., Herzig P.M., Hannington M.D., Jonasson I.R., Arribas A. (2002) Submarine gold mineralization near Lihir Island, New Ireland Fore-arc, Papua New Guinea. Economic Geology, 97, 17951813.
  • Ratnasingham S., Hebert P.D. (2007) BOLD: the barcode of life data system (http://www.barcodinglife.org). Molecular Ecology Notes, 7, 355364.
  • Rogers A.D., Morley S., Fitzcharles E., Jarvis K., Belchier M. (2006) Genetic structure of Patagonian toothfish (Dissostichus eleginoides) populations on the Patagonian Shelf and Atlantic and western Indian Ocean Sectors of the Southern Ocean. Marine Biology, 149, 915924.
  • De Ronde C., Baker E., Massoth G., Lupton J., Wright I., Feely R., Greene R. (2001) Intra-oceanic subduction-related hydrothermal venting, Kermadec volcanic arc, New Zealand. Earth and Planetary Science Letters, 193, 359369.
  • Smith I., Price R. (2006) The Tonga-Kermadec arc and Havre-Lau back-arc system. Their role in the development of tectonic and magmatic models for the western Pacific. Journal of Volcanology and Geothermal Research, 156, 315331.
  • Stocks K.I., Hart P.J.B. (2007) Biogeography and biodiversity of seamounts. In: PitcherT.J., MoratoT., HartP.J.B., ClarkM.R., HagganN., SantosR.S. (Eds), Seamounts: Ecology, Conservation and Management. Fish and Aquatic Resources Series 12, Blackwell Press, Oxford: 255281.
  • Stoffers P., Worthington T., Schwarz-Schampera U., Hannington M., Massoth G., Hekinian R., Schidt M., Lundsten L., Evans L., Vaiomo’unga R., Kirby T. (2006) Submarine volcanoes and high-temperature hydrothermal venting on the Tonga arc, southwest Pacific. Geology, 34, 453456.
  • Thornstad E.B., Finstad A.G., Jensen A.J., Museth J., Naesje T.F., Sakgard L.M. (2007) To what extent does ethanol and freezing preservation cause shrinkage of juvenile Atlantic salmon and European minnow? Fisheries Management and Ecology, 14, 295298.
  • Tunnicliffe V., Fowler C.M.R. (1996) Influence of sea-floor spreading on the global hydrothermal vent fauna. Nature, 379, 531533.
  • Van Dover C.L., German C.R., Speer K.G., Parson L.M., Vrijenhoek R.C. (2002) Evolution and biogeography of deep-sea vent and seep invertebrates. Science, 295, 12531257.
  • Ward R.D., Zemlak T.S., Innes B.H., Last P.R., Hebert P.D.N. (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360, 18471857.
  • Wright I.C., Chadwick W.W. Jr, De Ronde C.E.J., Reymond D., Hyvernaud O., Gennerich H.-H., Stoffers P., Mackay K., Dunkin M.A., Bannister S.C. (2008) Collapse and reconstruction of Monowai submarine volcano, Kermadec Arc, 1998–2004. Journal of Geophysical Research, 113, B08S03, doi:10.1029/2007JB005138.
  • Zemlak T.S., Ward R.D., Connell A.D., Holmes B.H., Hebert P.D.N. (2009) DNA barcoding reveals overlooked marine fishes. Molecular Ecology Resources, 9(Suppl. 1), 237242.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Appendix S1 Table 2. Species identification, GenBank Accession numbers or BOLD identification numbers, collection data, specimen identification and reference information.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
MAEC_370_sm_Appendix1.docx27KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.