Antioxidant Enzyme Activity and mRNA Expression in Reproductive Tract of Adult Male European Bison (Bison bonasus, Linnaeus 1758)

Contents

Antioxidants in the male reproductive tract are the main defence factors against oxidative stress caused by reactive oxygen species production, which compromises sperm function and male fertility. This study was designed to determine the activity of antioxidant enzymes, such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx), in the testicular and epididymidal tissues of adult male European bison (Bison bonasus). The reproductive tract tissues were subjected to real-time reverse transcriptase–polymerase chain reaction (RT-PCR) analysis to quantify mRNA expression levels of five antioxidant enzymes: copper/zinc SOD (Cu/Zn SOD), secretory extracellular SOD (Ec-SOD), CAT, phospholipid hydroperoxide glutathione peroxidase (PHGPx) and GPx5. The corpus and cauda epididymidal tissues displayed greater (p < 0.05) SOD activity compared with the testicular tissue. It was found that CAT activity was lowest (p < 0.05) in the cauda epididymidis, whereas negligible GPx activity was detected in the reproductive tract tissues. There were no detectable differences in the mRNA expression level of Cu/Zn SOD among the different reproductive tract tissues. Small amounts of Ec-SOD mRNA were found in the reproductive tract, particularly in the epididymides. The caput and cauda epididymides exhibited greater (p < 0.05) level of CAT mRNA expression, whereas PHGPx mRNA was more (p < 0.05) expressed in the testis. Furthermore, extremely large amounts of GPx5 mRNA were detected in the caput epididymidal tissue compared with other tissues of the reproductive tract. It can be suggested that the activity of the antioxidant enzymes and the relative gene expression of the enzymes confirm the presence of tissue-specific antioxidant defence systems in the bison reproductive tract, which are required for spermatogenesis, epididymal maturation and storage of spermatozoa.

Introduction

Antioxidants have been shown to protect the male reproductive tract, namely the testis and epididymis, against oxidative stress-induced injury by scavenging reactive oxygen species (ROS). The primary antioxidant enzymes involved in the removal of ROS are superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx), which have been detected in spermatozoa and different regions of the reproductive tract (Nonogaki et al. 1992; Aitken and Vernet 1998; Strzeżek 2002; Gancarczyk et al. 2006; Aitken and Roman 2008; Awda et al. 2009; Chabory et al. 2010; Koziorowska-Gilun et al. 2011a,b). Moreover, SOD is a metalloenzyme that catalyses the dismutation of superoxide anion to produce hydrogen peroxide (H₂O₂) and oxygen (Peeker et al. 1997). The SODs consist of three isoforms: copper/zinc SOD (Cu/Zn SOD, SOD1) occurring in the cell cytoplasm, nucleus and intermembrane space of the mitochondria; manganese SOD (Mn-SOD, SOD2) located in the mitochondrial matrix; and secretory extracellular SOD (Ec-SOD, SOD3), which is present in the testis and epididymis (Peeker et al. 1997; Mruk et al. 2002; reviewed by Aitken and Roman 2008) and is abundant in the seminal plasma (Strzeżek 2002; Kowalowka et al. 2008). Both CAT and GPx have been shown to catalyse the same reaction, which is the conversion of H₂O₂ into water (Zini and Schlegel 1996; Drevet 2006). Even though CAT is a powerful H₂O₂ recycling enzyme, GPxs are known to be the key regulators of H₂O₂-mediated attack and can remove organic peroxidized molecules, such as phospholipid hydroperoxides (Ursini et al. 1985; Noblanc et al. 2011). Among the distinct eight GPx isoforms (Gpx1 to GPx8), phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4), a selenium-dependent enzyme, and an epididymal secretory GPx, known as GPx5, have been shown to be implicated in the fertilizing processes of mammalian spermatozoa (Okamura et al. 1997; Imai et al. 2001; Maiorino et al. 2003; Moreno et al. 2003; Grignard et al. 2005).

The mRNA expression levels of different antioxidants in the reproductive tract of several species have been documented in several studies. The cytoplasmic Cu/Zn SOD and Ec-SOD mRNAs have been detected in the epididymal epithelia (Nonogaki et al. 1992), whereas CAT mRNA has been found in the accessory sex glands (Zini and Schlegel 1996). Moreover, PHGPx mRNA was reported to be highly expressed in the testis (Moreno et al. 2003; Vernet et al. 2004; Chabory et al. 2010), whereas GPx5 mRNA was shown to be highly restricted to the caput epididymidis (Ghyselinck et al. 1993; Beiglböck et al. 1998; Grignard et al. 2005).

Bison is the largest European mammal and belongs to the group of endangered animal species. The world’s largest population of the European bison is found in the regions of the Bialowieza Forest in Poland and Belarus, with a population of approximately 900 animals. The male European bison, aged 4–6 years, have been shown to be characterized by fully developed spermatogenesis and are able to produce mature spermatozoa (Czykier et al. 1999; Czykier and Krasiñska 2004). According to Czykier et al. (1999), the breeding period of the male bison in a free-ranging population is short, lasting from the 6–12 years of age. The bison are extremely vulnerable to diseases, which can pose serious threats to the whole species existence (Pucek et al. 2004). Pathological disorders in the bison reproductive tract, such as epididymal cysts and cryptorchidism (Matuszewska and Sysa 2002; Krasińska et al. 2009), are associated with increased oxidative stress, which could contribute to impaired sperm function and male infertility (reviewed by Aitken and Roman 2008; Hejmej et al. 2005; Kopera et al. 2010). To our knowledge, no study has yet been devoted to characterize the antioxidant enzyme systems of the male bison reproductive tract. Therefore, the aim of this study was to analyse quantitatively the activity of antioxidant enzymes and the mRNA expression levels of the enzymes in the testis and epididymidis of the adult male European bison. In addition, the mRNA expression levels of the antioxidant enzymes in bison reproductive tract were quantified, for the first time, using real-time reverse transcriptase–polymerase chain reaction (RT-PCR) analysis, which has been one of the most promising gene expression tools that provide insight into normal biological and pathological cellular processes (Lockhart and Winzeler 2000).

Materials and Methods

Animals and reproductive organ collections

In this study, three male adult European bison (Bison bonasus, Linnaeus 1758), which originated from the free-ranging population in Bialowieza Forest (Eastern Poland), were used in the experiments. The reproductive status of the bison (aged 2–4.5 years), used in this study, was unknown. The animals were culled at the Bialowieza Forest from November to December, mainly owing to several reasons, including injuries, poaching and reproductive disorders (Pucek et al. 2004; Wolk and Krasińska 2004; Krasińska et al. 2009). Testes and epididymides of each individual animal were collected by workers of the Bialowieza National Park and Department of Animal Physiology and Reproduction, University of Rzeszow (Poland), according to the approved guidelines for the ethical treatment of animals in accordance with the Polish legal requirements. Dissected tissues of the testes (n = 6) and the epididymides, which were divided into the caput, corpus and cauda epididymides (n = 6, respectively), were wrapped in aluminium foil, shocked-frozen in liquid nitrogen (−196°C) and stored at −80°C, until required for analysis.

Preparation of reproductive tract tissues for antioxidant assays and total RNA isolation

All chemicals were purchased from Sigma-Aldrich Chemicals Company (St Louis, MO, USA), unless stated otherwise.

The dissected tissues of the testes and epididymides (caput, corpus and cauda) did not contain spermatozoa and were ground in liquid nitrogen using pre-chilled pestle and mortar. Aliquots of the tissue samples were homogenized in extraction buffer [50 mm Tris, 5 mm ethylenediaminetetraacetic acid (EDTA), 1 mm dithiothreitol (DTT), 1 μg/ml Aprotinin, pH 7.5] for antioxidant assay or transferred to Lysing Matrix Tubes (MP Biomedicals LLC, Solon, OH, USA) containing 1 ml of TRI-Reagent solution for total RNA isolation. Following homogenization, the tissue samples were centrifuged at 15 000 × g for 15 min at room temperature, and the resultant supernatants were stored at −80°C, until required for antioxidant assays.

Measurements of total protein content

Total protein content in the tissue extracts was measured according to the method of Lowry et al. (1951), using bovine serum albumin (BSA) (Serum and Vaccine Production, Cracow, Poland) as a standard. The electrophoretic homogeneity of the BSA fraction used in this study was approximately 95%.

Measurements of antioxidant enzyme activity

SOD assay

Superoxide dismutase activity was assayed using a commercial reagent kit (Randox Laboratories, Crumlin, UK), according to the manufacturer’s instructions. The role of SOD is to accelerate the dismutation of the superoxide anion. This assay employs xanthine–xanthine oxidase (XOD) to generate the superoxide anion radicals, which react with 2-(4-iodophenyl)-3-(4-nitrophenol)-5-phenyltetrazolium chloride (INT) to form a red formazan. The activity of SOD was monitored at 505 nm, using a Beckman Coulter DU 800 spectrophotometer (Beckman Coulter Inc., Fullerton, CA, USA). One unit of SOD is that which causes 50% inhibition of the rate of reduction of INT under the conditions of the assay (37°C, pH 7.0). The assay was performed in duplicate, and the results were expressed as U/mg protein.

CAT assay

A commercial kit was used to determine CAT activity, according to the manufacturer’s instructions. The activity of CAT was based on the measurements of H₂O₂, remaining after the action of enzyme. The quinoneimine dye coupling product, which correlated with the amount of remaining H₂O₂ in the reaction mixture, was measured spectrophotometrically at 520 nm (Beckman Coulter DU 800 spectrophotometer). One unit of CAT represents the amount of the enzyme that decomposes 1 μm H₂O₂ per minute at a substrate concentration of 50 mm H₂O₂ at 25°C (pH 7.0). The assay was run in duplicate, and the results were expressed as U/mg protein.

GPx assay

Glutathione peroxidase activity was measured using a Ransel kit (Randox Laboratories Ltd., London, UK), according to the manufacturer’s instructions. In this assay, GPx catalyses the oxidation of glutathione (GSH) by cumene hydroperoxide. In the presence of glutathione reductase (GR) and NADPH, oxidized glutathione (GSSG) is converted to GSH with a concomitant oxidation of NADPH to NADP⁺. This reaction was measured spectrophotometrically at 340 nm. One unit of GPx was defined as the amount of the enzyme that catalyses the oxidation of 1 μm NADPH per minute at 37°C (pH 7.2). The assay was run in duplicate, and the results were expressed as mU/mg protein.

Total RNA isolation and reverse transcription (RT)

Ice-cold tissue samples, suspended in 1 ml of TRI-Reagent solution, were homogenized in a FastPrep-24 apparatus (MP Biomedicals LLC) for 45 s. Following homogenization, RNA was isolated in the homogenates, using a total RNA Kit (A&A Biotechology, Gdynia, Poland) according to a previously described method (Chomczynski and Sacchi 1987). Aliquots of the RNA samples were subjected to electrophoresis on 2% agarose gel to confirm the integrity of the RNA bands, and the RNA quality was measured as the 260 : 280 absorbance ratio.

The RevertAid™ Premium First Strand complementary DNA (cDNA) Synthesis kit (Fermentas, Vilnius, Lithuania) was used to perform RT, according to the manufacturer’s instruction. Briefly, aliquots of the RNA samples (1 μg) were treated with RNase-free DNase for 10 min at room temperature. The treated RNA samples were denaturated for 10 min at 70°C prior to synthesis of cDNA. First-strand cDNA was synthesized after dissolving each RNA sample in a reaction mixture containing 50 pmol oligo (dT)₁₈ and random hexamers, 10 mm dNTP Mix, 200 U Reverse Transcriptase M-MuLV RNase H Minus in a 5 × RT buffer (250 mm Tris–HCl, 250 mm KCl, 20 mm MgCl₂, 50 mm DTT, pH 8.3 at 25°C) and 20 U RiboLock RNase inhibitor. The cDNA synthesis was performed in a PCR Thermal Cycler (MJ Mini Thermal Cycler; Bio-Rad Laboratories Inc., Hercules, CA, USA). The thermal cycle used for cDNA synthesis was at 25°C for 15 min, 50°C for 25 min, 85°C for 5 min and then held at 4°C. Each sample used for RT was performed in duplicate. Following analysis, aliquots of the RT products (single-stranded DNA, ssDNA) were fourfold diluted with nuclease-free water and used for real-time PCR analysis, as described below.

Real-time PCR analysis

The ssDNA products were subjected to quantitative PCR analysis, using a real-time PCR system (ABI 7900HT; Applied Biosystems, Carlsbad, CA, USA). The reaction mixture for each real-time PCR analysis contained 1 μl template, 5 μl primer (Forward and Reverse), 15 μl Maxima SYBR/ROX PCR Mix (Fermentas) and 4 μl nuclease-free water. Thermal cycling was initiated at 95°C for 10 min for DNA polymerase activation. Forty steps of PCR were performed, each one consisting of heating at 95°C for 15 s and 60°C for 60 s. Each ssDNA sample was assayed in duplicate. The Primer Express Software v3.0 (Applied Biosystems) was used to design the primer sets. The primers sets were designed on Bos taurus and Bison bison genome to obtain mRNA sequences for genes of C2orf29 (as the reference gene), Cu/Zn SOD, Ec-SOD, CAT, PHGPx and GPx5 (Table 1). Sequence data were examined with the Basic Local Alignment Search Tool (BLAST) software for bovine sequences, according to the accession numbers in the European Molecular Biology Laboratory databases. The homology of each examined genes was at approximately 99%. Relative mRNA quantifications were carried out by comparing the genes of interest with the reference gene (C2orf29) and were expressed as arbitrary units, using the Real Time PCR Miner algorithm (Zhao and Fernald 2005).

Table 1.   Sequences of synthetic primers used to assay gene expression by real-time reverse transcriptase polymerase chain reaction (RT-PCR). Each primer set was designed according to the accession number provided by the European Molecular Biology Laboratory database

Gene	Forward primer	Reverse primer	Amplicon length (bp)
C2orf29, reference gene; Cu/Zn SOD, cytoplasmic copper/zinc superoxide dismutase; Ec-SOD, extracellular superoxide dismutase; CAT, catalase; PHGPx, phospholipid hydroperoxide glutathione peroxidase; GPx5, glutathione peroxidase 5.
C2orf29	TCAGTGGACCAAAGCCACCTA	CTCCACACCGGTGCTGTTCT	169
Cu/Zn SOD	GCCGTCTGCGTGCTGA	ATGGATCCAGTTACCACGACTGT	88
Ec-SOD	TGGAGGCCTTCTTCCACCTT	TGGCTCAGGTCCCCAAACT	90
CAT	GAACACAGGCCCCACTTCTC	AAAGTCCGCACCTGAGTGACA	70
PHGPx	CGATACGCCGAGTGTGGTTTA	GGCTCCTGCCTCCCAAA	60
GPx5	ACATCCGCTGGAATTTTGAAA	GACTGGAGTCCGATGAAACCA	79

Statistical analysis

The antioxidant enzyme activities (U/mg protein for SOD and CAT, respectively, and mU/mg protein for GPx) and the enzyme mRNA expression levels (arbitrary units) are expressed as the mean ± standard error of mean (SEM) of three bison. Data were analysed by one-way anova followed by the Duncan multiple comparison test using the Statistica software package (StatSoft Incorporation, Tulsa, OK, USA). Values were considered statistically significant at p < 0.05.

Results

Antioxidant enzyme activity

The activity of SOD, CAT and GPx in the tissues of the reproductive tract of the adult male bison is shown in Fig. 1. It was found that SOD activity was greater (p < 0.05) in the cauda epididymidal tissue than either in the testicular tissue or the caput epididymidal tissue (Fig. 1a). Similar levels of SOD activity were shown by the corpus and caudal epididymidal tissues (Fig. 1a). The caudal epididymidal tissue exhibited the lowest (p < 0.05) activity of CAT compared with the other tissues of the reproductive tract (Fig. 1b). However, CAT activity was not markedly differed among the testicular, caput and corpus epididymidal tissues (Fig. 1b). Compared with SOD and CAT activity, considerable low amounts of GPx activity was detected in the reproductive tract tissues. However, the level of GPx activity was highest (p < 0.05) in the testis compared with that either in the caput, in the corpus or in the cauda epididymidis (Fig. 1c). In addition, the level of GPx activity in the corpus epididymidis was approximately threefold higher than that either in the caput epididymidis or in the cauda epididymidis (Fig. 1c).

Figure 1.  Activity of (a) superoxide dismutase (SOD), (b) catalase (CAT) and (c) glutathione peroxidase (GPx) in testicular and epididymidal tissues of adult male bison (n = 3). Values are expressed as the means (±SEM). Values with different letters (a,b,c) are significant at p < 0.05

Antioxidant enzyme mRNA expression

There were no detectable differences (p > 0.05) in the mRNA expression level of Cu/Zn SOD among the different reproductive tract tissues (Fig. 2a). Negligible amounts of Ec-SOD mRNA were detected in the reproductive tract tissues, being significantly higher (p < 0.05) in the testis (Fig. 2b). The level of testicular mRNA Ec-SOD was approximately threefold and sixfold higher than in the cauda and caput epididymides, respectively (Fig. 2b).

Figure 2.  Relative expression levels of (a) cytoplasmic copper/zinc superoxide dismutase (Cu/Zn SOD) and (b) extracellular SOD (Ec-SOD) in testicular and epididymidal tissues of adult male bison (n = 3). Values are expressed as the means (±SEM). Values with different letters (a,b,c) are significant at p < 0.05

A significantly higher (p < 0.05) level of CAT mRNA expression was detected in the caput and cauda epididymides (Fig. 3). In addition, CAT mRNA expression levels in the caput and cauda epididymides were approximately two- to threefold higher in the testis and corpus epididymidis (Fig. 3).

Figure 3.  Relative expression levels of catalase (CAT) in testicular and epididymidal tissues of adult male bison (n = 3). Values are expressed as the means (±SEM). Values with different letters (a,b) are significant at p < 0.05

It was found that that PHGPx mRNA was expressed in the different epididymidal regions (caput, corpus and cauda), but greater (p < 0.05) expression was shown in the testis (Fig. 4a). Throughout this study, there were no detectable differences (p > 0.05) in PHGPx mRNA expression levels among the tissues from the different epididymidal regions (Fig. 4a). The caput epididymidal tissue exhibited considerable greater (p < 0.05) expression level of GPx5 mRNA compared with the other reproductive tract tissues (Fig. 4b). It was observed that GPx5 mRNA expression level in the caput epididymidis was approximately 30-fold higher than in the cauda epididymidis (Fig. 4b). Also, low (p < 0.05) level of GPx5 mRNA expression was found in the testis and corpus epididymidis compared with the cauda epididymidis (Fig. 4b).

Figure 4.  Relative expression levels of (a) phospholipid hydroperoxide glutathione peroxidase (PHGPx) and (b) glutathione peroxidase 5 (GPx5) in testicular and epididymidal tissues of adult male bison (n = 3). Values are expressed as the means (±SEM). Values with different letters (a,b,c) are significant p < 0.05

Discussion

To our knowledge, this study examined, for the first time, the tissue-specific gene expression of various antioxidant enzymes in the reproductive tract of the adult male European bison, using real-time RT-PCR analysis. It should be emphasized that the exact mechanism by which ROS, such as superoxide anion and hydroxyl radicals, are created is not entirely understood. Mounting evidence has been demonstrated that they are the by-products of cellular processes occurring during steroidogenesis and spermatogenesis in the testis, and during sperm maturation and storage in the epididymis (Fisher and Aitken 1997; Aitken and Vernet 1998; Cadenas and Davies 2000; Gancarczyk et al. 2006). The findings of this study show that there were wide tissue distribution of SOD activity, and Cu/Zn SOD and Ec-SOD mRNA expression patterns in the testis and epididymis of the bison reproductive tract. The mRNA encoding Cu/Zn SOD was more expressed than the Ec-SOD mRNA in the analysed reproductive tissues, suggesting that Cu/Zn SOD has a major role in scavenging the superoxide anion radical in these tissues. In human, Cu/Zn SOD has been detected in different reproductive organs, and the prostate gland appears to be the main source of the enzyme (Nonogaki et al. 1992; Peeker et al. 1997; Mruk et al. 2002). Furthermore, it has been reported that Cu/Zn SOD accounts for 75% of the enzyme activity in the human seminal plasma, whereas Ec-SOD accounts for 25% (Peeker et al. 1997). The reason for the occurrence of different contributions of Cu/Zn SOD and Ec-SOD to the seminal plasma has not been fully elucidated as yet. According to Nonogaki et al. (1992), Cu/Zn SOD might be implicated in the local defence mechanism against ROS-mediated damage in the reproductive tract tissues, as well as in providing SOD to the seminal plasma. The presence of large SOD activity in seminal plasma may be needed to suppress hyperactivation and capacitation of spermatozoa, which can be induced by the presence of superoxide anion radical (de Lamirande and Gagnon 1993). In support of these findings, Cu/Zn SOD seems to play a major role in the antioxidant defence systems of the bison reproductive tract tissues, providing protection against the detrimental effects of the superoxide anion radical. In the rat, large amounts of mRNA encoding Ec-SOD were found mainly in the distal segment of the epididymis (Perry et al. 1993). However, in the current study, greater expression of testicular Ec-SOD mRNA was detected, suggesting that the enzyme may have more important role in the testis. This is particularly important because, besides Cu/Zn SOD, Ec-SOD is also needed to provide antioxidant protection to the testicular tissue and sperm cells against ROS-mediated lipid peroxidation attack, presumably due to the abundance of highly polyunsaturated fatty acids (reviewed by Aitken and Roman 2008; Awda et al. 2009).

In the current study, CAT activity showed wide variations among the different tissues of the reproductive tract and was lowest in the cauda epididymidis. Our results show that there were not any consistent associations between the level of the activity of CAT and its mRNA expression levels, which were detected in large amounts in the caput and cauda epididymides. In other studies, CAT expression was detected in the human and rat epididymal epithelia (Zini et al. 1993; Zini and Schlegel 1996). The low level of CAT mRNA expression detected in the bison testicular tissue corroborates the finding of previous studies indicating that the testis is ill-equipped to adequately scavenge H₂O₂ (Zini et al. 1993; Zini and Schlegel 1996). According to Zini and Schlegel (1996), low expression of CAT and cellular GPx mRNAs in the testis renders the sperm cells more susceptible to oxidative challenges. Even though both CAT and GPx catalyse the same reactions in the cytoplasm, the enzymes have specific domains and characteristics of action (Vernet et al. 2004; Drevet 2006; Noblanc et al. 2011). These authors have postulated that CAT is activated when cellular H₂O₂ concentrations are more far above physiological levels, presumably due to oxidative bursts characteristics of stress responses. Evidence has been shown that antioxidant enzyme genes are stimulated by oxidative bursts (Zini and Schlegel 1996; Guérin et al. 2001; Vernet et al. 2004; Chabory et al. 2010). It is possible that such oxidative bursts could affect the level of the activity of CAT and its mRNA expression, which might vary among the different tissues of the bison reproductive tract. This is corroborated by the observations that the response of antioxidant enzyme activities in tissues exposed to oxidative stress can be less pronounced than the increases in their mRNA levels, probably due to a decrease in intracellular translational efficiency (Lambertucci et al. 2007). It has been demonstrated that the intracellular redox status can modulate the activity of transcriptional factors, which can affect the level of gene expression of the antioxidants (Guérin et al. 2001). According to Quan et al. (2011), ROS can regulate CAT gene expression not only through a direct mechanism, but also through an indirect pathway at the transcriptional level. It is possible that, in the bison reproductive tract, such regulatory mechanisms can also affect CAT mRNA expression levels in the testis and different regions of the epididymis. The findings of this study support the concept that the strong mRNA expression of CAT in the caput and cauda epididymides may indicate its key role in providing antioxidant protection to spermatozoa during maturation and storage in the bison reproductive tract.

Accumulating evidence has been shown that the PHGPx gene exhibits different expression patterns, giving rise to three transcripts encoding proteins that have distinct function, as well as cellular and subcellular locations in the male reproductive tract (Ursini et al. 1999; Pfeifer et al. 2001; Maiorino et al. 2003; Moreno et al. 2003; Chabory et al. 2010). In the present study, mRNA expression level of PHGPx was found in all regions of the epididymidis, but large amounts were detected in the testis. Similar results were reported in other studies (Foresta et al. 2002; Maiorino et al. 2003; Moreno et al. 2003), indicating that PHGPx is highly expressed in the testis. There is evidence in the literature for the multifunctional nature of PHGPx in the male reproductive tract. Even though it has been confirmed that PHGPx constitutes the formation of the sperm mitochondrial capsule and chromatin condensation (Ursini et al. 1999; Imai et al. 2001; Pfeifer et al. 2001; Chabory et al. 2010) and may act as an active peroxidase in spermatogenic cells (Foresta et al. 2002), the physiological importance of the enzyme in mammalian reproductive function has not been fully understood. Moreover, besides the removal of H₂O₂, PHGPx metabolizes phospholipid hydroperoxides and plays a key role in controlling lipid peroxidation (Ursini et al. 1985; Drevet 2006). We suggest that PHGPx may play a specific role in spermatogenesis in the bison by protecting the testicular tissues and sperm cells against lipid peroxidation injury. This is sustained by the observation that large amounts of PHGPx mRNA were found in the testis, whereas relatively low levels of testicular CAT and GPx5 mRNAs were detected.

In the present study, the mRNA encoding GPx5 was detected in different tissues of the bison reproductive tract, but extremely large amounts of GPx5 mRNA were found in the caput epididymidal tissue. Previous studies showed that there were different mRNA expression patterns of GPx5 in the reproductive tract of several animal species. In the boar and bull, GPx5 mRNA was found mainly in the caput epididymidal tissue (Okamura et al. 1997; Grignard et al. 2005). It has been reported that in the stallion, even though GPx5 mRNA was detected in the proximal part of the caput epididymidis, the efferent ducts are the major site of the enzyme secretion (Grignard et al. 2005). Moreover, in the dog epididymis, the GPx5 gene was restricted to the epididymis and transcribed by the epithelial cells in the proximal parts of the organ (Beiglböck et al. 1998). Other results have shown that, in the mouse epididymis, GPx5 mRNA was highly expressed by the principal cells of the caput epididymidis epithelium, accounting for 2–3% of the total mRNA pool (Ghyselinck et al. 1993; Grignard et al. 2005). It has been demonstrated that GPx5 is secreted to the epididymal lumen, where it binds to the head region of transiting spermatozoa and can protect spermatozoa against premature acrosome reaction (Okamura et al. 1997; Vernet et al. 1997). Interestingly, GPx5 mRNA was found in the testis and cauda epididymidis at detectable levels in this study, suggesting that the enzyme expression is not restricted only to the caput epididymidis in the bison. However, our findings and those of other studies have confirmed the species-specific expression patterns of GPx5 mRNA in the male reproductive tract and demonstrated that GPx5 is an important enzymatic scavenger, which can protect the epididymidal epithelium and spermatozoa from ROS-mediated damage. In the current study, high mRNA expression levels of GPx5 in the caput and cauda epididymidal tissues were parallel with greater CAT mRNA expression in these tissues, suggesting the synergistic contributions of GPx5 and CAT to the antioxidant defence systems, which are required to regulate the redox potential of the microenvironment in the epididymis for sperm maturation and storage. Moreover, it must be emphasized that GPx and CAT, which are implicated in the removal of H₂O₂, the product of the dismutation of superoxide anion, are strongly associated with the activity of SOD, namely the Cu/Zn SOD isoform, reaffirming that these enzymes have complementary roles in the antioxidant defence systems of the male reproductive tract. There is evidence to suggest that, besides the tissue-specific scavenging enzymes in the male reproductive tract, the antioxidant defence systems may also be attributable to the presence of low-molecular-weight antioxidants, such as glutathione and L-ascorbate (reviewed by Aitken and Roman 2008; Koziorowska-Gilun et al. 2011a,b).

Taken together, the findings of this study confirm the physiological significance of the antioxidant enzymes in the reproductive tract tissues of the male European bison. Furthermore, the mRNA distributions of the various antioxidant enzymes in the epididymis are required to maintain a specific microenvironment during sperm maturation and storage by keeping ROS at low and defensible levels. However, more research studies are needed to unravel the significance of the tissue-specific gene expression of the antioxidant enzymes to gain more insight on the antioxidant contributions by the different reproductive organs to the semen. Such approaches will also shed more light on the potential role of the antioxidant defence system in the bison reproductive tract and may help to develop appropriate reproductive technologies for the genetic conservation and management of the threatened species.

Acknowledgements

This study was supported by funds from the University of Warmia and Mazury in Olsztyn (No. 0103.0803) and the Ministry of Science and Higher Education. The authors are grateful to the Management and Personnel of the Bialowieza National Park for their assistance in collecting the materials.

Conflict of interest

None of the authors have any conflict of interest to declare.

Author contributions

All authors have been involved in designing the study, analysing the data and drafting of the manuscript.