SEARCH

SEARCH BY CITATION

Keywords:

  • cleavage divisions;
  • RhoGTPase;
  • Strongylocentrotus purpuratus

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

The activation of sea urchin eggs at fertilization provides an ideal system for studying the molecular events involved in cellular activation. Rho GTPases, which are key signaling enzymes in eukaryotes, are involved in sustaining the activation of sea urchin eggs; however, their downstream effectors have not yet been characterized. In somatic cells, RhoA regulates a serine/threonine kinase known as Rho-kinase (ROCK). The activity of ROCK in early sea urchin development has been inferred, but not tested directly. A ROCK gene was identified in the sea urchin (Strongylocentrotus purpuratus) genome and the sequence of its cDNA determined. The sea urchin ROCK (SpROCK) sequence predicts a protein of 158 kDa with >72% and 45% identities with different protein orthologues of the kinase catalytic domain and the complete protein sequence, respectively. SpROCK mRNA levels are high in unfertilized eggs and decrease to 35% after 15 min postfertilization and remain low up to the 4 cell stage. Antibodies to the human ROCK-I kinase domain revealed SpROCK to be concentrated in the cortex of eggs and early embryos. Co-immunoprecipitation assays indicate that RhoA and SpROCK are physically associated. This association is destroyed by treatment with the C3 exoenzyme and with the ROCK antagonist H-1152. H-1152 also inhibited DNA synthesis in embryos. We conclude that the Rho-dependent signaling pathway, via SpROCK, is essential for early embryonic development.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

The unfertilized sea urchin egg is metabolically dormant and arrested in the G1-phase of the first mitosis. Fertilization activates the egg, releasing it from arrest and initiating the rapid mitotic divisions of the early cleavage period (Runft et al. 2002; Leguia & Wessel 2007). One of the hallmarks of egg activation is a transient increase in the cytosolic Ca2+ concentration of approximately 10–30-fold above basal levels (Townley et al. 2006; Whitaker 2006). The elevation of the Ca2+ level triggers the exocytosis of cortical granules and the establishment of the fertilization envelope (Wong & Wessel 2009). The Ca2+ increase is followed by the remodeling of the cortical actomyosin cytoskeleton, including myosin II activation and an increase in cortical F-actin (Schroeder 1979; Tilney & Jaffe 1980; Yonemura & Mabuchi 1987; Stack et al. 2006). Activation of a Na+-H+ exchanger also occurs, raising the egg pH by approximately 0.4 pH units, which initiates translation (Grainger et al. 1979; Winkler et al. 1980; Swann & Whitaker 1985; Whitaker & Steinhardt 1985; Manzo et al. 2003) and DNA synthesis (Zhang & Ruderman 1993; De Nadai et al. 1998).

Protein phosphorylation, mediated by various kinases, plays a key role in the activation of most cells. There are many phosphoproteins in the unfertilized sea urchin egg; within minutes after fertilization, their number markedly increases (Roux et al. 2008). Analysis of the sea urchin kinome indicates more than 350 kinases (Bradham et al. 2006), most of which are involved in signal transduction. In addition to kinases, G-proteins are also involved in signal transduction and egg activation (Voronina & Wessel 2004; Beane et al. 2006).

Rho GTPases are small G-proteins of the Ras superfamily that act as critical signaling proteins regulating the actin cytoskeleton, cell adhesion, intracellular membrane trafficking, transcription, motility, and cell cycle progression (Jaffe & Hall 2005; Narumiya & Yasuda 2006). They exist in an inactive, Guanosine-5′-diphosphate (GDP)-bound state and in an active, Guanosine-5’-triphosphate (GTP)-bound state. In their active form, Rho proteins bind various protein effectors, resulting in their enzymatic activation. Two of these effectors are mDia and the Rho kinase termed “ROCK” (Narumiya & Yasuda 2006). Mammalian ROCK is a serine/threonine protein kinase with a molecular mass of 155–160 kDa consisting of three domains: an N-terminal kinase domain, a coiled-coil domain and a pleckstrin homology (PH) motif, which is divided into two domains by a cysteine-rich region at its C-terminal end (Riento & Ridley 2003), and a C-terminal auto-inhibitory domain that binds to the kinase domain and reduces its activity (Amano et al. 1999, 2000). The phosphotransferase activity of ROCK is stimulated when Rho binds to the C-terminal portion of the coiled-coil domain (Rho-binding domain, RBD), leading to an active “open” kinase conformation. Two isoforms of ROCK have been identified in humans, hsROCKI and hsROCKII, which share an amino acid identity of 65% (Nakagawa et al. 1996). ROCKs are important regulators of cellular apoptosis, growth, metabolism and migration via control of the actin cytoskeletal assembly and cell contraction (Riento & Ridley 2003). A number of proteins are substrates of ROCK, including myosin light chain (MLC), myosin phosphatase (MYPT; Kimura et al. 1996), and, ion channels (Iftinca et al. 2007).

RhoA localizes to the cell periphery of unfertilized sea urchin eggs and is associated with cortical granules. It also localizes to the cortex and cleavage furrow of dividing embryos (Nishimura et al. 1998; Cuéllar-Mata et al. 2000; Bement et al. 2005). Unfertilized eggs pretreated with C3 exotoxin, which inactivates Rho, undergo sperm-induced Ca2+-mediated cortical granule exocytosis but do not alkalinize and, consequently, do not activate protein synthesis, resulting in blocking of the first division of the zygote (Manzo et al. 2003; Rangel-Mata et al. 2007). These data suggested that in addition to its well-known role in cell division, Rho is also vital to the transition from G1 to S phase of the first cell cycle. Furthermore, treatment of unfertilized eggs with the ROCK inhibitor Y-27632 also blocks alkalinization of the egg cytosol, suggesting that the Na+-H+ exchanger is regulated by Rho/ROCK activation (Rangel-Mata et al. 2007). Additionally, microinjection of H-1152, a Rho-kinase inhibitor, into zygotes that have completed the first S period results in failure to phosphorylate the myosin light chain, leading to failure to form a contractile ring (Lucero et al. 2006).

Here, we report the molecular cloning and characterization of sea urchin SpROCK cDNA. We analyzed the spatiotemporal expression of SpROCK, complexed with its regulator RhoA, in unfertilized eggs and early embryos. The effect of H-1152 on DNA synthesis was also studied.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Materials

H-1152 (Calbiochem, Merck KGaA, Darmstadt, Germany), C3 (Upstate Biotechnology Inc, MA, USA), Protein A-agarose beads (Sigma-Aldrich Quimica SA, Mexico), anti-human RhoA IgG (Santa Cruz Biotechnology Inc, CA, USA), anti-human ROCKI IgG (Chemicon International, Inc, MA, USA), anti-β-tubulin IgG (Sigma-Aldrich Quimica SA), Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular Probes, CA, USA), goat anti-rabbit IgG-horse radish peroxidase (HRP) (Amersham Biosciences, Uppsala, Sweden), and Alexa Fluor 594-conjugated anti-goat IgG (Molecular Probes), were all purchased from the specified sources.

Gametes

Adult sea urchins (Strongylocentrotus purpuratus) were obtained from Pamanes (Ensenada, Baja California, Mexico). Spawning was induced by intracoelomic injection of adults with 0.5 mol/L KCl. Undiluted sperm was collected and stored on ice. The artificial sea water (ASW) used contained: 486 mmol/L NaCl, 10 mmol/L KCl, 10 mmol/L CaCl2, 29 mmol/L MgSO4, 27 mmol/L MgCl2, 2.5 mmol/L NaHCO3 and 10 mmol/L HEPES, pH 8.0 (Kinukawa et al. 2007).

Cell fractionation

For fractionation, 0.2 mL of eggs in 1.8 mL of ASW were pelleted by centrifugation (1000 g, 10 min) and then resuspended in lysis buffer (50 mmol/L Tris–HCl, pH 7.4, 1% NP-40, 150 mmol/L NaCl, 1 mmol/L ethylenediaminetetraacetic acid [EDTA], 1 mmol/L phenylmethylsulfonyl fluoride (PMSF), 1 mmol/L NaF, 1 mmol/L Na3VO4, 0.25% sodium deoxycholate, 1 μg/mL pepstatin) followed by homogenization with a tight fitting Teflon pestle. The homogenate was ultracentrifuged at 150 000 g for 1 h at 4°C, and the pellet (resuspended in lysis buffer) and supernatant were recovered. All cellular fractions were stored at −70°C, except those to be used for immunoprecipitation, which were used immediately. For embryo fractionation, 1 mL of eggs (10% v/v suspension in ASW) were fertilized with 50 μL of sperm (1:10 000 dilution), incubated at 16°C, and at the indicated times, eggs were settled by centrifugation (1000 g, 5 min) to eliminate suspended sperm. The eggs were washed with ASW and homogenized as described above for unfertilized eggs. Egg preparations showing >90% fertilization envelopes were used in this study. Protein was determined according to Lowry et al. (1951).

Quantitative PCR

Total RNA was isolated from S. purpuratus eggs and fertilization envelope-free embryos using TRIzol (Invitrogen Inc., Carlsbad, CA, USA). Poly(A+) RNA was selected using the Micro Poly(A) Pure Kit (Ambion Inc., TX, USA), and 25 ng was used for first strand cDNA synthesis (SuperScript First-strand synthesis kit, Invitrogen). Quantitative real-time polymerase chain reaction (qPCR) was carried out using primers for SpROCK (forward, 5′CACCACCCATCGGCTATCATC, and reverse, 5′GCATACACCTTCTTACTCGTCCTC) to amplify a 111-bp fragment. Primers for SpUbiquitin (accession no. M61772.1; forward, 5′CACAGGCAAGACCATCACAC and reverse, 5′GAGGATGGTCGCACTCTCTC) were used to amplify a 150 bp fragment for normalization. Primers were designed using Primer quest (http://www.idtdna.com/Scitools/Applications/Primerquest/). qPCR was carried out in triplicate with 1 μL of cDNA as a template in a 20 μL reaction volume using iQ SYBR green chemistry (Bio-Rad, CA, USA) in an iCycler (Bio-Rad). Samples from each embryo culture (n = 3) were run in a separate 96 well plate. One experimental sample for each plate was diluted 10-fold over four serial dilutions to generate a standard curve for the calculation of PCR efficiency. Baseline cycle threshold (CT) levels were set to maximize PCR efficiency, and only plates with 90–110% efficiency were used in data analysis. An analysis of the temperature melt curve for each primer set was carried out to ensure amplification of a single substrate. Cycle threshold differences (ΔCT) were calculated as the normalized CT of the control sample minus the CT of the experimental treatment, therefore SpROCK CT values were normalized to ubiquitin, generating a ΔCT. An unfertilized sample (UF) was taken as representing baseline expression, and all other time points collected are reported as a relative fold increase or decrease based on UF ΔCT, as described previously by Juliano et al. (2006).

Western blotting

Egg and embryo total homogenates, or cellular fractions (75 μg of protein per lane) were subjected to standard sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and electro-transferred to PVDF membranes (Amersham Biosciences; 1 h at 30 mA). The blots were blocked with phosphate-buffered saline (PBS) (pH 7.2) and 3% nonfat dry milk and then incubated overnight with the respective rabbit antibody (anti-ROCKI, 1:1000; anti-RhoA, 1:2000; anti-β-tubulin, 1:5000). Blots were washed three times with PBS, then incubated for 1 h with a horseradish peroxidase-linked secondary antibody of either goat anti-rabbit immunoglobulin G (IgG), or anti-goat IgG (each at 1:3000). After washing with PBS, the membranes were exposed to a chemiluminescent detection system according to the manufacturer’s protocol (Amersham Biosciences). The images were scanned and processed using the densitometry program Scion Image.

Immunofluorescence

Eggs and embryos were fixed with 6% formaldehyde/PBS for 15 min, followed by washing with PBS (80 mmol/L Na2HPO4, 20 mmol/L NaH2PO4·2H2O, 100 mmol/L NaCl, pH 7.2), and then incubated overnight with 0.4% Triton-X 100/PBS for effective permeabilization. After blocking with 3% bovine serum albumin (BSA) in PBS for 2 h, the cells were incubated overnight in rabbit anti-ROCKI (1:200) or in rabbit anti-RhoA (1:200) antibody; after washing, the cells were exposed to Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:300) or Alexa Fluor-594-conjugated goat anti-rabbit IgG (1:300), respectively, for 1 h at 23°C. The cells were then washed with PBS/10 mmol/L azide and mounted on glass slides. Images were acquired with a confocal Zeiss LSM510 Meta microscope, optical sections throughout the cell depth were analyzed using Image Examiner software and images generated from the equatorial region of the cells.

ROCK inhibitor studies

Assays were conducted on eggs in suspension (1500 eggs/100 μL ASW) that had been dejellied and incubated for 30 min at 16°C in the absence or presence of 0.1, 1.0 or 3.0 μmol/L H-1152 in ASW (Calbiochem), or for 60 min with 1 ng/μL of C3 (Upstate Biotechnology). Sperm were acrosome reacted with egg jelly prior to their addition to the eggs, and after fertilization with 20 μL of diluted sperm, 5 μL were removed for microscopic observation to determine the percentage of eggs with elevated fertilization envelopes.

Immunoprecipitation

Eggs and embryos were collected by centrifugation and then lysed in ice-cold radio immunoprecipitation assay (RIPA) buffer (50 mmol/L Tris–HCl pH 7.4, 150 mmol/L NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 μg/μL pepstatin, 1 mmol/L NaF, 1 mmol/L Na3VO4, and 1% Sigma protease inhibitor cocktail) and centrifuged at 2000 g for 15 min. The supernatants were preincubated with Protein A-agarose beads for 10 min at 4°C, centrifuged (1000 g, 2 min) and then incubated overnight at 4°C with 1 μg of anti-RhoA or anti-ROCKI rabbit IgG. Protein A-agarose beads were added and incubated for 1 h at 4°C. The beads were rinsed three times with RIPA buffer and then washed with PBS. Immunoprecipitates were eluted with Laemmli loading buffer and processed for SDS–PAGE and western blotting.

SpROCK cDNA sequence

The full-length SpROCK cDNA sequence was obtained by RT–PCR using a collection of 36 primers (Operon Biotechnologies Inc, AL, USA) designed using the SpROCK sequence from the sea urchin genome project (XP_784423). Total egg RNA was extracted using RNeasy (Qiagen) according to the manufacturer’s instructions. cDNAs were synthesized from 5 μg of total RNA at 42°C for 1 h using SuperScript II RT (Invitrogen). Amplifications were carried out using 0.5 μmol/L primers and 400 μmol/L dNTP and were performed for 35 cycles (30 s 94°C, 30 s 53°C and 3 min 72°C). PCR products were analyzed on 0.8% agarose gels containing 0.5 μg/mL ethidium bromide, and fragments of the predicted sizes were excised, purified and sequenced. Sequencing reactions were carried out using exactly matched primers. The full-length SpROCK cDNA sequence was amplified, and the 4.3 kb SpROCK cDNA product was ligated into pCR-XL-TOPO (Invitrogen) and transfected into TOP10 Escherichia coli cells. The SpROCK cDNA sequence was deposited in GenBank under accession no. GU827561. The sequence was analyzed using Mega BLAST, BLAST EMBnet-CH/SIB, BLAST EXPASy, BLAST National Center for Biotechnology Information (NCBI), EMBL-EBI BLAST, Scansite Molecular Weight & Isoelectric Point Calculator, Net Phos 2.0, CLUSTAL 2.0.8 multiple sequence alignment, NCBI Conserved Domains, Swiss Model Workspace and other programs.

Monitoring DNA synthesis by BrdU incorporation

The method described by Zhang et al. (2006) was used to monitor DNA replication in sea urchins. Basically, unfertilized egg suspensions were washed and resuspended in 1 mmol/L 3-amino-1,2,4-triazol (ATAZ) in ASW in the presence or absence of 1 μmol/L H-1152 for 30 min at 16°C. Then, 0.8 mg/mL of 5-bromo-2-deoxyridine (BrdU; Invitrogen) was added to the egg suspensions at 10 min postfertilization, and samples were taken at 30, 60, 75 and 100 min post-sperm addition. Fertilization envelopes were removed after a sample was assessed for percent fertilization and the cells fixed in 4 N HCl for 90 min at 23°C. After fixation in −20°C methanol for 30 min, eggs were washed in PBS-Tween (0.05%) and blocked overnight at 4°C. The cells were then incubated with Alexa Fluor anti-BrdU mouse monoclonal antibodies (Invitrogen) for 1 h at 23°C. Eggs were washed in PBS-Tween, then mounted on pre-washed slides in 50% glycerol and observed by fluorescence microscopy.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

SpROCK cDNA

The Strongylocentrotus purpuratus genome contains a sequence of 81.024 kb (accession no. XP_784423), including 37 exons, that is homologous to human ROCK. The coding region of SpROCK is predicted to be 4623 bp. However, this may be an annotation error because the cDNA cloned and sequenced from egg mRNA is 4095 bp, predicting 1365 residues (accession no. GU827561). It encodes a protein (accession no. ADF30050) with a predicted molecular mass of 158 kDa, close to the mass reported for mammalian ROCK (1388 residues, 164-kDa), expressed in several tissues (Leung et al. 1995; Matsui et al. 1996). Several programs predicted that the deduced amino acid sequence of the SpROCK protein is soluble and does not contain a signal sequence, with 33% of the residues being charged. The predicted pI is 6.35. There are five potential protein kinase A phosphorylation sites (T440, T705, S1027, S1329, S1350), two nuclear localization signals (NLS, amino acids 431–436 and 507–514), and one nuclear export signal (NES, amino acids 75–83). SpROCK has no significant internal repeating sequence elements. A schematic representation of the predicted SpROCK protein (Fig. 1A) shows the STKc_ROCK region, which contains a serine/threonine kinase catalytic domain (amino acids 79–404), a coiled-coil region (amino acids 430–1111), including the Rho-binding site (amino acids 951–1014), and a carboxyl terminal pleckstrin homology (PH) domain (amino acids 1125–1326) with an internal cysteine rich (CR) domain (amino acids 1236–1287). This structure is comparable to that of mammalian ROCK proteins, thus suggesting similar catalytic activity regulation.

image

Figure 1.  Sequence analysis of sea urchin Rho-kinase (SpROCK). (A) Schematic representation of the predicted functional domains of SpROCK. (B) Rooted neighbor-joining tree (using Clustal W) showing the relationship of SpROCK with other ROCK proteins. Abbreviations: BtRock2, Bos taurus ROCK2, NP_776877.1; HsRock2, Homo sapiens ROCK2, NP_004841.2; XlRock, Xenous laevis ROCK, NP_001154860.1; XlRock2, Xenopus laevis ROCK2, NP_001080945.1; HsRock1, Homo sapiens ROCKI, NP_005397.1; EcRock1, Equus caballus ROCKI, NP_001157457.1; SpRock, Strongylocentratus purpuratus ROCK, ADF30050, and NvRock, Nasonia vitripennis ROCK, NP_001154860.1; MmRock2, Mus musculus ROCK2, NP_033098.2; DrRock2, Danio rerio ROCK2, NP_777288.1; CiRock2, Ciona intestinalis ROCK2, XP_002123050.1; HsalRock2, Harpegnathos saltator ROCK2, EFN88393.1; HvRock, Hydra vulgaris ROCK, CAK22283.1; BmRock, Brugia malayi Protein kinase domain containing protein, XP_001901340.1; LiRock, Loa loa AGC/DMPK/ROCK protein kinase, XP_003136297.1.

Download figure to PowerPoint

Phylogenetic analysis of the complete sequences of ROCK proteins using the neighbor-joining method shows more than 45% overall identity with proteins from different species belonging to the Chordata phylum and slightly <45% with ROCK proteins of species from the Arthropoda, Nematoda and Cnidaria phyla (Fig. 1B). Alignment of the STKc_ROCK region of SpROCK with similar regions from other organisms shows that this protein exhibits the amino acid sequences involved in the protein kinase activity of ROCK proteins, and this domain is 77% identical to hsROCKI and hsROCKII (data not shown). Therefore, the cloned cDNA predicts a SpROCK protein.

Expression of SpROCK in eggs and early embryos

Quantitative RT–PCR (qPCR) was used to analyze the levels of mRNA for SpROCK in eggs and embryos. Poly(A)+ RNA obtained from unfertilized eggs and early embryos was analyzed by qPCR for SpROCK transcripts normalized to ubiquitin transcripts (Wong & Wessel 2009). SpROCK transcripts were quantified in unfertilized eggs and early embryos at 15, 60, 90, 120 (2 cell stage), and 180 min (4 cell stage) postfertilization (Fig. 2A). SpROCK mRNA levels decrease to 35% in embryos 15 min postfertilization and remain low up to the 4 cell stage.

image

Figure 2.  Recognition of Rho-kinase (ROCK) in sea urchin eggs and the temporal expression profile of SpROCK to the 4 cell stage. (A) Relative expression of mRNA transcripts by quantitative polymerase chain reaction (qPCR). The data represent an average of three independent experiments, each sample in duplicate. Error bars indicate the SD resulting from the triplicate qPCR reactions. The transcript number is normalized to ubiquitin transcripts, (top panel shows cell morphologies at different times postfertilization); (B) whole extracts of sea urchin eggs were subjected to western blot analysis using anti-hROCK-I, 75 μg protein per lane. Lanes correspond to: 1, egg whole-cell lysate; 2, secondary antibody alone with no primary antibody; (C) SpROCK levels were confirmed by western blotting and by relative quantification of the bands; the blot was reprobed with anti-β-tubulin, which was used as the loading control, 75 μg protein per lane. (D) Relative levels of SpROCK protein. Data are the average of three independent experiments. Data were compared with β-tubulin as a loading control.

Download figure to PowerPoint

SpROCK was analyzed by western blotting using a rabbit antibody directed against hROCKI. As seen in Figure 2B (lane 1), anti-hROCKI reacted with a protein of 158 kDa in sea urchin egg homogenates; this value is the predicted molecular mass of SpROCK. No signal appeared when anti-hROCKI was omitted and the blot exposed only to secondary antibody (Fig. 2B, lane 2). These data confirm the presence of SpROCK in eggs and the specificity of the antibody. Figure 2C shows that SpROCK and β-tubulin proteins were detected in all stages analyzed, and in Figure 2D some variability can be observed in the overall levels of the SpROCK protein relative to β-tubulin protein levels.

Subcellular localization of SpROCK in sea urchin eggs

Although SpROCK does not exhibit the hydrophobic characteristics of a membrane protein, ROCK proteins can be distributed between the cytosol and membrane compartments in many cell types, and Rho binding may contribute to ROCK’s membrane recruitment (Leung et al. 1995). Because RhoA localizes preferentially to the cortical granules of the egg cortex (Cuéllar-Mata et al. 2000), we investigated whether SpROCK follows a similar subcellular distribution pattern. Immunoblots of fractions prepared from egg lysates revealed that SpROCK localizes preferentially to the membrane fraction compared to the cytosolic fraction (Fig. 3A, lanes 2 and 3, respectively). Additionally, immunostaining performed with anti-hROCKI showed that SpROCK is concentrated in the egg cortex, with low levels detected in the cytoplasm and nucleus (Fig. 3B-b). The retention of cortex staining in fertilized eggs indicates that SpROCK is not a component of cortical granules (Fig. 3B-b). In zygotes at 30 min postfertilization (at the time of pronuclear fusion and the beginning of the first S-phase), we found that SpROCK remained in the periphery (data not shown); this localization is similar to RhoA at this cellular stage (Cuéllar-Mata et al. 2000). In 2 cell embryos, SpROCK is localized to the cortex and the cleavage furrow (Fig. 3B-c).

image

Figure 3.  Distribution of endogenous sea urchin Rho-kinase (SpROCK) in eggs. (A) Immunoblot analysis of the intracellular distribution of SpROCK. Eggs lysates (lane 1) were separated into membrane (lane 2) and soluble (lane 3) fractions and subjected to immunoblotting to detect SpROCK. Note that the major concentration of SpROCK is associated with the membrane fraction. (B) To determine the localization or distribution of SpROCK within the egg, immunofluorescence microscopy was used, from which the accumulation of cortical and nuclear (dotted circle) SpROCK are shown. B (a, d) Phase contrast; (b, c) immunofluorescence. Images were generated from the equatorial region of the cells. Bar 50 μm.

Download figure to PowerPoint

Effect of H-1152 on DNA replication

Y-27632 is a selective inhibitor of ROCKs and is a useful tool for studying the participation of the Rho/ROCK pathway in different cellular processes (Davies et al. 2000). In a previous study, we showed that sea urchin eggs pretreated for 90 min with 60 μmol/L Y-27632 do not undergo the pH increase associated with metabolic activation (Rangel-Mata et al. 2007). However, in this earlier study, we did not assess the potential downstream effects known to be dependent on the pH increase, such as DNA replication. H-1152 is a ROCK antagonist with an inhibitory potency 125-fold greater than Y-27632 (Tamura et al. 2005). It has been reported that H-1152 inhibits ROCK selectively among several kinases, including proten kinase A (PKA), proten kinase C (PKC), and myosin light chain (MLC) (Sasaki et al. 2002). Preincubation of eggs with H-1152 did not appear to cause any damage to the eggs based on microscopic observations (data not shown). Because H-1152 is known to inhibit the sea urchin sperm acrosome reaction (de la Sancha et al. 2007), sperm were stimulated to undergo the acrosome reaction by treatment with egg jelly prior to addition to the eggs, which was confirmed by removing sperm from the cuvette and checking that they had undergone the acrosome reaction 5 min after fertilization (not shown). Although fertilization occurred (as assessed by the elevation of the fertilization envelope), eggs preincubated for 30 min with 0.8 or 1 μmol/L H-1152 and then fertilized failed to divide at rates of 50 and 90%, respectively, when observed at 2 cell stage embryos (Fig. 4A). H-1152 did not affect the formation of the fertilization envelope (Fig. 4B), which appeared normal. These results are consistent with those reported for the Y-27632 ROCK inhibitor (Rangel-Mata et al. 2007). Additionally, as a control of other cellular processes, we studied if H-1152 affected the overall rate of protein synthesis since it has been reported that it increases minutes later after fertilization (Grainger et al. 1979; Manzo et al. 2003). For this, sea urchin eggs were previously preincubated with [35S]metionine, followed by addition of 1 μmol/L H-1152 and then fertilized. Global rate of protein synthesis was essentially the same in the absence or presence of ROCK antagonist at all stages analyzed up to 120 min postfertilization (2 cell stage embryos) (data not shown).

image

Figure 4.  H-1152 inhibits the first cell division in a dose-dependent manner. (A) Histograms showing the effects of H-1152 on the division of zygotes exposed to 0 (control), 0.1, 0.8, 1 or 3 μmol/L H-1152. Bars represent the means ± SD of six experiments, in which 100 cells were counted per experiment after 120 min postfertilization. (B) Visualization of the samples by microscopy without or with 3 μmol/L H-1152. Bar 50 μm.

Download figure to PowerPoint

To test the effect of ROCK inhibitors on DNA synthesis, eggs were preincubated with BrdU. BrdU-loaded eggs were fertilized, and embryos were collected at various times and processed for immunostaining using an anti-BrdU mouse IgG-Alexa Fluor 546 monoclonal antibody. DNA synthesis can be observed in embryos not exposed to H-1152 (Fig. 5A–E). However, eggs that were pretreated for 30 min with 1 μmol/L H-1152 and then fertilized failed to replicate their DNA (Fig. 5F–J). These results suggest that SpROCK plays a crucial role in pathways before or during DNA synthesis.

image

Figure 5.  Sea urchin Rho-kinase (SpROCK)regulates DNA synthesis. DNA replication was monitored by the incorporation of 5-bromo-2-deoxyridine (BrdU) into DNA. Untreated eggs show BrdU incorporation (A–E), while eggs treated with 1 μmol/L H-1152 and then fertilized (F–J) did not undergo DNA synthesis up to 100 min postfertilization. Fluorescent nuclei in the 2 cell stage are seen at 100 min. Bar 50 μm.

Download figure to PowerPoint

Rho-ROCK interaction in eggs and embryos

We postulated that a Rho/ROCK signaling pathway is important in regulating the cleavage divisions of early sea urchin embryos, which it does in many cell types (Shi & Wei 2007). Therefore, we analyzed whether Rho and ROCK associate in unfertilized eggs and in 30 min postfertilization embryos. In both eggs and embryos, the ROCKI antibody co-immunoprecipitated RhoA, and conversely, anti-RhoA co-immunoprecipitated SpROCK (Fig. 6A,B). To test the specificity of this interaction, eggs were pre-incubated for 60 min with 1 ng/μL C3 toxin, which inactivates Rho irreversibly by adenosine diphosphate (ADP)-ribosylation. The egg culture was divided into two portions, and one of these was fertilized. Both samples were processed for co-immunoprecipitation. As shown in Figure 6B, in the presence of C3, no SpROCK or RhoA were detected in immunoprecipitates with anti-RhoA and anti-ROCKI. Immunolocalization experiments showed that SpROCK and Rho have a similar cellular distribution (Fig. 7A,B). These data indicate that Rho and ROCK remain associated in unfertilized eggs and 30 min embryos.

image

Figure 6.  RhoA/sea urchin Rho-kinase (SpROCK)-association. (A) Cell lysates of eggs and embryos were subjected to immunoprecipitation (IP) with anti-ROCK-I or anti-RhoA followed by immunoblotting to detect SpROCK (left) and RhoA (right). (B) Pretreatment of the cells with exotoxin C3 adenosine diphosphate (ADP)-ribosyltransferase (C3), which interferes with Rho function, disrupted the RhoA/SpROCK association.

Download figure to PowerPoint

image

Figure 7.  Localization patterns of sea urchin Rho-kinase (SpROCK) and RhoA during early sea urchin development. Independent cells were stained for SpROCK (green) or RhoA (red), as described in the Materials and methods. It is evident that both proteins have a similar distribution. The lower panel represents phase contrast images of a RhoA panel of fluorescent images. Phase contrast images of a ROCK panel are not shown, but the same pattern was observed as for RhoA.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

At fertilization, the sperm activates the egg to begin embryonic development, but the pathway connecting the beginning of this process with subsequent sea urchin development is not totally understood. One of the links in this signaling pathway is Rho-kinase (ROCK). The results of this study indicate that ROCK from the sea urchin S. purpuratus (SpROCK) participates in the pathway leading to sea urchin early embryonic development. SpROCK is present in eggs, and an antibody directed against hROCKI recognizes an approximately 158 kDa protein localized to the egg cortex. Pretreatment of eggs with H-1152, an inhibitor of ROCK, was observed to block DNA synthesis and the first cell division. These results provide evidence for the existence of a ROCK protein in sea urchin eggs that participates in early sea urchin development and suggest a possible mechanism by which ROCK can regulate DNA synthesis.

In many cell types, Rho-kinase is involved in the regulation of at least two cytoskeletal systems, actin and intermediate filaments (IF), and affects many cellular processes, such as migration, adhesion, cytokinesis, transcriptional activity, shape rearrangements, and contraction (Yoneda et al. 2005; Shi & Wei 2007). The unique structure of this serine/threonine kinase may enable it to be involved in many diverse processes (Yamaguchi et al. 2006). The observation that SpROCK localizes preferentially in the egg cortex with a similar cellular distribution to RhoA (Fig. 7A,B) is consistent with the model of a Rho/ROCK signaling pathway playing a role in early embryonic development (Rangel-Mata et al. 2007). In dividing HeLa cells, ROCK localizes to the cleavage furrow regulating the progression of cytokinesis (Yokoyama et al. 2005). In this study, we demonstrated that SpROCK accumulates at the cleavage furrow in eggs, and we investigated the possibility of an interrelationship between RhoA and ROCK. Our results agree with previously reported results showing that in sea urchin eggs, the initial increase in contractility does not require Rho-kinase, but this signaling pathway is required for successful cytokinesis (Lucero et al. 2006). These results suggest a relationship between RhoA and ROCK, but it is not yet clear how this pathway regulates cell division.

A interesting finding of this study was the nuclear localization of SpROCK (Fig. 3), which is in contrast to findings from studies in rat embryo fibroblasts demonstrating that ROCKI is largely diffuse in the cytoplasm, more concentrated in perinuclear regions, and sometimes associated with stress fibers (Yoneda et al. 2005). These results indicate the importance of ROCK in a number of activities taking place in the nucleus, similar to results reported in mouse skin fibroblasts (MSFs) indicating that ROCKII plays a critical role in the timely initiation of centrosome duplication and DNA replication (Ma et al. 2006).

The SpROCK protein levels fluctuated only slightly for an early embryo (Fig. 2D). Additionally, the observed decrease in SpROCK mRNA during early embryo development may be a result of the general maternal-to-zygotic transition and the loss of maternal mRNAs. Therefore, these results suggest that SpROCK regulation occurs at the level of its catalytic activity.

Inhibition of ROCK with H-1152 results in a block to cytokinesis, consistent with other studies proposing a role for RhoA and ROCK in cleavage (D’Avino et al. 2005; von Dassow 2009). We also observed that the inhibition of ROCK by H-1152 prevented DNA synthesis. The specificity of H-1152 in the concentration range used in this study has been previously described (Sasaki et al. 2002; Breitenlechner et al. 2003), and blocking sea urchin cytokinesis using a different ROCK inhibitor, Y-27632, has also been reported (Rangel-Mata et al. 2007). Therefore, SpROCK likely acts as a positive regulator of development in the early sea urchin embryo. The activity of SpROCK is required after the initial release of Ca2+ and the subsequent cortical granule exocytosis following fertilization because treated embryos raised fertilization envelopes that were normal in appearance. However, they failed to undergo DNA synthesis and progress through cell division. This is in contrast to results from other studies in which H-1152 had no effect on DNA synthesis in sea urchins (Lucero et al. 2006; Uehara et al. 2008). This may be due to differences in the techniques used. In this study, eggs were pretreated with the ROCK antagonist H-1152 for at least 30 min and were then fertilized; this amount of time is enough to inhibit ROCK activity. By contrast, in the other studies, the inhibitor was added several minutes after fertilization. These different conditions may determine the effect of ROCK on cytokinesis progression. Our findings are consistent with a previous study in sea urchin eggs and zygotes in which pretreatment of eggs with a different ROCK inhibitor, Y-27632, affected early events in fertilization, such as the pHi increase (Rangel-Mata et al. 2007), which has been suggested to be necessary for the elongation phase of DNA replication in the first cell cycle (Zhang & Ruderman 1993). Interestingly, ROCK inhibition also affects cell cycle regulators in mammalian cardiomyocyte proliferation (Zhao & Rivkees 2003).

These results show that Rho/ROCK plays a role in events that follow Ca2+-dependent cortical granule exocytosis; however, the specific stage of early development in which SpROCK participates is difficult to define. Rather, this signaling pathway may have multiple roles. The inhibition of the first cell division indicated that inhibition of DNA replication is one of the major effects of ROCK.

In summary, this study extends previous findings that ROCK is necessary for fertilization-induced pHi increase, is required for DNA synthesis, and associates with RhoA in the cleavage furrow before the first cell division in sea urchin embryos. Additional studies are required to determine whether ROCK participates in multiple pathways of early embryonic cell cycle regulation, such as the pHi and subsequent DNA synthesis, as well as cleavage furrow mechanics, or whether ROCK is a central player in coordinating multiple pathways.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

We thank Chistopher Osovitz and Gary W. Moy for expert technical assistance. We are grateful to Victor D. Vacquier and Kathy R. Foltz for valuable comments and for critically reading the manuscript. This work was supported by grant No. 82754 from the Consejo Nacional de Ciencia y Tecnología (CONACYT) of Mexico and by the Universidad de Guanajuato through the Programa de Fortalecimiento a la Investigación Institucional (J. G. S.). B.A.A is the recipient of a doctoral scholarship from the CONACYT.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References