Dynamic changes in the gene expression of zebrafish Reelin receptors during embryogenesis and hatching period

Abstract

The brain morphology of vertebrates exhibits huge evolutionary diversity, but one of the shared morphological features unique to vertebrate brain is laminar organization of neurons. Because the Reelin signal plays important roles in the development of the laminar structures in mammalian brain, investigation of Reelin signal in lower vertebrates will give some insights into evolution of vertebrate brain morphogenesis. Although zebrafish homologues of Reelin, the ligand, and Dab1, a cytoplasmic component of the signaling pathway, have been reported, the Reelin receptor molecules of zebrafish are not reported yet. Here, we sought cDNA sequence of zebrafish homologue of the receptors, vldlr and apoer2, and examined their expression patterns by in situ hybridization. Developmental gene expression pattern of reelin, dab1, vldlr, and apoer2 in the central nervous system of zebrafish was compared, and their remarkable expression was detected in the developing laminar structures, such as the tectum and the cerebellum, and also non-laminated structures, such as the pallium. The Reelin receptors exhibited different spatial and temporal gene expression. These results suggest a possibility that duplication and subsequent functional diversity of Reelin receptors contributed to the morphological and functional evolution of vertebrate brain.

Introduction

Development of complex morphology of the vertebrate brain involves multiple signal transduction pathways. Among these pathways, Reelin signal is unique in that this signal functions almost specifically in the nervous system (Rice & Curran 2001), because evident abnormalities of reeler, the Reelin-deficient mouse mutant, reported are essentially restricted in the nervous system (review in Katsuyama & Terashima 2009).

Reelin is a large extracellular glycoprotein (D’Arcangelo et al. 1995). Two lipoprotein receptors, very low density lipoprotein receptor (Vldlr) and apolipoprotein E receptor 2 (Apoer2) (also called Lrp8) were genetically and biochemically proven to be Reelin receptors (D’Arcangelo et al. 1999; Hiesberger et al. 1999). Dab1 recognizes NPxY peptide of these receptors by its phosphotyrosine binding (PTB) domain (Trommsdorf et al. 1998). Binding of Reelin to its receptors induces phosphorylation of Dab1 in a Src family kinases-dependent manner (Arnaud et al. 2003; Bock & Herz 2003). Phosphorylation of Dab1 is essential for function of Reelin signal transduction, because mutation in the tyrosine residues that receives phosphorylation by Src family kinases gives a brain phenotype that is almost identical to the reeler mutant (Howell et al. 2000). Some molecules of which activation is initiated by Dab1 phosphorylation were reported, such as PI3K (Bock et al. 2003), Lis1 (Assadi et al. 2003), Nck beta (Pramatarova et al. 2003), Crk/CrkL (Huang et al. 2004), N-WASP (Suetsugu et al. 2004), and these molecules are known to be involved in regulation of morphology and behavior of differentiating neurons. Among these molecules, Dab1 and Vldlr/Apoer2 convincingly comprise Reelin signal, for Dab1 null mutants and Vldlr/Apoer2 double knockout mutant exhibit almost identical and specific malformation of the brain (Howell et al. 1997; Trommsdorff et al. 1999; Hack et al. 2007).

Functions of Reelin signal have been extensively investigated in mouse and rat. Genome data of Drosophila and nematode indicate that these invertebrate animals do not, but the genome of an ascidian species (Ciona intestinalis) contains a Reelin homologue (Y. Katsuyama unpubl. data, 2010), suggesting that Reelin signal emerged along the evolutionary pathway of deuterostome. The Reelin-deficient mutant mice (and rats) exhibit drastic abnormalities especially in the laminar structures of brain, such as the cerebral and cerebellar cortices (Katsuyama & Terashima 2009), and the laminar alignment of the neural cells is a morphological feature unique to vertebrate brain. Thus, it is likely that Reelin signal had played some roles in evolution of the vertebrate brain (Bar et al. 2000; Nomura et al. 2008). However, we have little information about the Reelin signal in lower vertebrates of which brain morphology is significantly different from that of mammalians. Expression pattern of the Reelin homologue in zebrafish was extensively described previously (Costagli et al. 2002). Zebrafish homologues of Dab1 were also reported and their expression pattern was examined (Costagli et al. 2006; Herrero-Turrión et al. 2010). It is expected that comparison of spatial and temporal expression pattern of ligand, receptors, and intracellular components of the signaling pathway will give some insights into its function in the zebrafish brain development and vertebrate brain evolution. Here, we determined cDNA sequence of zebrafish homologue of Reelin receptors, and examined their expression pattern in comparison with those of reelin and dab1 genes during development.

Materials and methods

Fish embryos

Wild-type zebrafish (Danio rerio) embryos were obtained from natural crosses of fish with the AB genetic background. The embryos were incubated at 28.5°C in E3 embryo medium (Brand et al. 2002).

cDNA cloning

Using blast searches of the zebrafish genome database (http://www.ensembl.org) with the mouse Dab1, Vldlr or Apoer2 (Lrp8) protein sequence, we identified the predicted transcripts of their zebrafish homologues. The cDNA fragments of these genes were amplified by polymerase chain reaction (PCR) using zebrafish embryonic cDNA library as a template and specific primers (vldlr: GTGAGCAGTCTCAGTTCCAGTGTGG and ACTCACAGCAGGGTACGTGTGGCC, apoer2: GCATGTAAGAACGGCCAGTGTGTCC and GGGTAGACGTGTCCGATCTGCTCG, dab1b: GTCAACAGAGGCTGAACCTCAAGC and CATGCTGGCGAGGGGGATCAGAC). PCR reactions were carried out using BD advantage2 PCR system (BD Biosciences Clontech). The PCR products were cloned in pGEM easy T/A cloning vectors (Promega), and sequenced. RACE (rapid amplification of cDNA ends) protocol was carried out to determine full length sequence of apoer2 cDNA. The molecular phylogenetic tree of Lrp protein family was generated by CLUSTALW (http://align.genome.jp).

Whole mount in situ hybridization

Distribution of mRNA of the zebrafish Reelin signal components was visualized using Digoxigenin-labeled antisense RNA probes. A detailed procedure of our whole mount in situ hybridization was described previously (Katsuyama et al. 2007). cDNA clones amplified as described above were used as template for synthesizing antisense RNA probe of vldlr, apoer2, and dab1. Template cDNA of reelin amplified by us is the same sequence in a previous report (Costagli et al. 2002). The serial sections were cut using cryostat. Expression of dab1a became too faint to show in photos during sectioning procedure for reasons unknown to us. Brain regions were identified referring to Mueller et al. (2006) and Hoppmann et al. (2008).

Results

Sequence of zebrafish Reelin receptors

To gain insights into evolution of Reelin signal during vertebrate evolution, we sought to clone zebrafish homologues of Dab1, Apoer2, and Vldlr. Blast search of the ENSEMBL genome database using amino acid sequence of mouse Dab1 protein returned two positive hits, ENSDARG00000059939 and ENSDARG00000003290. We designated ENSDARG00000059939 (on the chromosome 20) and ENSDARG00000003290 (on the chromosome 2) to dab1a and dab1b, respectively. We independently cloned cDNA and determined their nucleotide sequence, but other groups already reported these zebrafish dab1 genes (Costagli et al. 2006; Herrero-Turrión et al. 2010). The name of dab1 homologues is consistent to these previous reports by other groups.

Similar blast search using mouse Apoer2 and Vldlr amino acid sequences returned hitting ENSDARG00000070074 (which is on the chromosome 6) and ENSDARG00000006257 (which is on the chromosome 10), respectively. Although full length sequence of a genuine zebrafish vldlr cDNA had been registered in database, only predicted partial cDNA sequences of zebrafish apoer2 were found in databases. Thus, we determined full length cDNA sequence of zebrafish apoer2 using RACE protocol. Sequence alignment of the putative amino acid sequence of vldlr and apoer2 protein was shown in Figure 1A. Repeats of low density lipoprotein (LDL) receptor class A domain, which contains highly conserved cysteine residues, were observed (indicated by yellow underlines). Three calcium binding epidermal growth factor (EGF) like repeats (indicated by blue underlines) and five YWTD motif containing LDLR class B repeats (indicated by green underlines) were also observed. Although biochemical characters of these sequences have not been investigated, their high conservation in Vldlr and Apoer2 proteins of mouse and their zebrafish homologues suggests their importance in the functions of these proteins. Six LDLR class A repeats are found in Apoer2 protein, whereas eight repeats are found in Vldlr protein of mouse. Interestingly, zebrafish apoer2 has seven repeats of this conserved sequence. Sequence alignment indicates that amino acid residues between position 470 and 513 shown in Figure 1A was deleted from Apoer2 protein of mouse, whereas a shorter deletion in this region gave one more class A repeat to zebrafish apoer2 protein. NPxY motif, which is essential for binding of Dab1 protein, is highly conserved among these two LDL receptor proteins and a Drosophila protein called LDLa. Although NPxY motif of zebrafish apoer2 protein received insertion of three amino acids, it is not clear if this insertion affects binding of dab1 proteins to it. The molecular phylogenetic tree (Fig. 1B) suggests that apoer2 and vldlr are closely related proteins among the LDL receptor protein family and derived from an ancestral single protein, which also bore LDLa of Drosophila during animal evolution.

Figure 1.  The amino acid sequence deduced from the nucleotide sequence of cloned cDNA s of Reelin receptors. (A) Sequence alignment of Reelin receptor proteins of zebrafish and mouse and LDLa, a closely related protein of Drosophila. The alignment was carried out using MULTIN web software (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_multalin.html). Red letters indicate identical residues among all proteins. Green letters indicate residues conserved in more than two proteins. Blue letters indicate NDQEBZ conserved positions (Corpet, 1988). The yellow underlines indicate LDL receptor class A domain. The blue underlines indicate calcium binding EGF like repeats. The green underlines indicate low density lipoprotein receptor repeat class B. The red underline indicate NPxY motif. These are conserved regions registered at the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/Database/). (B) Phylogenetic neighbor-joining (NJ) method tree reconstruction depicting the evolutionary relationships of Lrp family proteins generated by using CLUSTALW. Lrp1 to Lrp12 are mouse proteins. Lrp8 is a synonym of Apoer2 protein.

Gene expression in the gastrulating period

Hybridization of zebrafish embryos up to the early somite stage to anti-reelin RNA probe did not give staining of the specimens above negative control (not shown), indicating that reelin is not expressed during gastrulating period and tailbud stage. However, expression of other signal components, dab1, vldlr, and apoer2 genes, was detected (Fig. 2). Dense and a little bit weaker stainings were obtained by dab1b and dab1a probes, respectively, from early cell cleavage stages (data not shown). These stainings in the very early embryonic stage (Fig. 2A,B) may indicate maternally deposited transcripts of dab1 genes. The intensity of the ubiquitous staining of specimens hybridized to dab1 probes was observed until 100% epiboly stage (Fig. 2A,B), gradually became weak as the embryogenesis went on, and disappeared in the early somite stage embryos (Fig. 2I). Expression of vldlr and apoer2 became detectable during epiboly. The onset of the zygotic expression of vldlr and apoer2 was earlier than that of reelin and dab1 genes. Similar to the case of dab1 genes, hybridization to vldlr probe gave ubiquitous staining, which was weak but higher than negative control experiments, and gradually became weak during gastrulation. In addition to this ubiquitous expression, distinct vldlr expression started to be observed in the midline of the embryos during epiboly (Fig. 2C). Such a pattern similar to the expression of ntl gene (Schulte-Merker et al. 1994) suggests that vldlr zygotic expression during this embryonic period is in the axial mesoderm. Expression of apoer2 was detected in the anterior most ectodermal region called prepolster (Gardiner et al. 2005) of 80% epiboly embryos (Fig. 2D). This expression was enhanced and expanded laterally as the gastrulation went on (Fig. 2E). As the somitogenesis went on, expression of apoer2 became detectable and gradually got stronger in the neural tube and the eye primordium (Fig. 2F–H). Expression of dab1b exhibited specific expression in the eyes and the midbrain at the bud stage, which is very similar to the expression of apoer2 (Fig. 2H,I).

Figure 2.  Expression pattern of Reelin signal components during early stage of zebrafish embryogenesis. (A) Expression of dab1a in a 100% epiboly stage embryo. The in situ hybridization procedure was done together with the specimen shown in Fig. 3J,K in the same test tube, indicating that this dense staining is specific. (B) Expression of dab1b in a 100% epiboly stage embryo. The in situ hybridization procedure was done together with the specimen shown in Figures 2B and 3M,N in the same test tube, indicating that this dense staining is specific. (C) Expression of vldlr in a 100% epiboly stage embryo. Expression of apoer2 in the 80% epiboly stage (D), bud stage (E), and early somite (15 hpf [hours postfertilization) stage (F–H). F, G, and H show dorsal, frontal, and lateral views of an apoer2 specimen, respectively. (I) A lateral view of a 15 hpf embryo showing dab1b expression. A scale bar in G indicates 0.1 mm.

Gene expression in the segmentation period

Consistent with the previous report (Costagli et al. 2002), the strongest expression of reelin was detected in the rhombomere 4 in the pharyngula stage (24 hpf [hours postfertilization]) (Fig. 3B,S). Moderate expression was observed in the rhombomere 2, 3, and 7, whereas the expression was much weaker in the rhombomere 5 and 6. Expression of reelin in the rhombomere 5 was undetectable in some specimens. Expression of vldlr and apoer2 was observed in the rhombomere 2–6 at a similar intensity of staining, whereas it was unclear in the rhombomere 7 (Fig. 3E,H,S). Expression of apoer2 was narrow, and extended more dorsally than vldlr expression in the rhombomere 5 and 6 (Fig. 3S). Very weak but significant expression of dab1a was observed in the rhombomere 2–6 (Fig. 3K,S). Very weak expression of dab1b was observed in the anterior hindbrain, but posterior boundary of dab1b expression was not clear (Fig. 3N,S).

Figure 3.  Gene expression in the segmentation period. Expression of reelin (A–C), vldlr (D–F), apoer2 (G–I), dab1a (J–L), dab1b (M–O), and deltaA (O, Q, R) at 20 somite stage (20 hpf) (A, D, G, J, M, P) and primula 5 stage (24 hpf) (B, C, E, F, H, I, K, l, N, O, Q, R–T). S and T shows higher magnification lateral views in the hindbrain and spinal cord regions, respectively. Detected transcripts are indicated as rn (reelin), vl (vldlr), ap(apoer2), da (dab1a), db (dab1b), and dl (deltaA). Ce, cerebellum; Di, diencephalon; FB, forebrain region; HB, hindbrain region; Hy, hypothalamus; MB, midbrain region; OV, otic vesicle; Teg, tegmentum; Tel, telencephalon; TeO, tectum. Scale bars in A, C, S indicate 0.1 mm.

Expression of all of the Reelin signal components was clearly detected in the spinal cord of the pharyngula stage (24 hpf) embryos (Fig. 3T). Expression of deltaA, the pan-neuronal marker, spanned the entire width of the spinal cord along the dorso-ventral axis (Appel & Eisen 1998). As reported previously (Costagli et al. 2002), reelin expression was detected in the middle line within the spinal cord marking the spinal interneurons (Fig. 3T). Although faint, dab1a expression was very similar to that of reelin. Very faint expression of dab1b was detected in the ventral aspect of the spinal cord, where the motoneurons reside (Fig. 3T). Expression of vldlr was strong in the line of interneurons. Expression of apoer2 was significant in the line of sensory neurons and strong in the motoneurons, whereas excluded from the line of interneurons. Thus, two reelin receptors exhibit complementary expression pattern in the spinal cord, which is a similar situation to their homologues in the mouse spinal cord (Yip et al. 2004).

During the segmentation period (10–24 hpf) (Dahm 2002), expression pattern of vldlr was very similar to that of reelin. In the mid-segmentation stage embryos such as 20 hpf, expressions of reelin (Fig. 3A) and vldlr (Fig. 3D) were detected obscurely throughout the brain. Both genes exhibited slightly stronger expression in the telencephalon (Fig. 3A,D). The moderate and broad expression of these two genes in the embryonic brain gradually became distinct in three regions (Fig. 3B,E). The telencephalon expressed reelin, dab1a, vldlr, and apoer2, and hypothalamus exhibited distinct expression of all components of Reelin signal that we examined here (Fig. 3B,E,H,K,N). In the midbrain, apoer2 was expressed in the presumptive tectum, and the ventral aspect expressed apoer2 and vldlr (Fig. 3E,H). Expression of dab1b in the midbrain region started from around the 10-somite stage (varied among specimens), became evident at the 15-somite stage in all in situ specimens (Fig. 2I), and maintained throughout the segmentation period (Fig. 3M–O). The upper rhombic lip, which gives rise to the cerebellum, expressed reelin, vldlr, apoer2, and dab1a (Fig. 3B,E,H,K). Developing eyes expressed reelin and dab1 genes weakly (Fig. 3C,L,O), vldlr moderately (Fig. 3F), and apoer2 strongly (Fig. 3I) during the segmentation period. Distinct expression of dab1b was detected in the otic placode (Fig. 3N,S).

Gene expression in the hatching period

In the 2 dpf (days postfertilization), reelin expression was detected in the telencephalon, hypothalamus, diencephalon, midbrain, and hindbrain (Fig. 4A), as previously reported (Costagli et al. 2002). Spatially different expression of the two receptors was observed in the midbrain region (Fig. 4C,E). Expression of apoer2 was strongly detected in the presumptive tectum, and expression of vldlr was detected in the tegmentum but not in the dorsal aspect of the midbrain. The hypothalamus expressed vldlr evidently, but not very clearly apoer2. Expression of dab1a became much stronger than that in the 24 hpf embryos (Fig. 4G,H). Expression of dab1b was still weak in the 2 dpf larvae, but evident expression of dab1b was detected in the tectum and the hypothalamus (Fig. 4I). The otic placode expressed dab1b, but not dab1a. The telencephalon expressed reelin, apoer2, vldlr, and dab1a, but not dab1b.

Figure 4.  Gene expression in the hatching period. Expression of reelin (A, B), vldlr (C, D), apoer2 (E, F), dab1a (G, H), and dab1b (I, J) at 2 dpf (A, C, E, G, I) and 3 dpf (B, D, F, H, J). Ce, cerebellum; Di, diencephalon; FB, forebrain region; HB, hindbrain region; Hy, hypothalamus; MB, midbrain region; OV, otic vesicle; Teg, tegmentum; Tel, telencephalon; TeO, tectum. A scale bar in A indicates 0.1 mm.

Expression of dab1a became weak in the telencephalon and hindbrain, but strong in the presumptive tectum and cerebellum of the 3 dpf brain (Fig. 4H). Specific expression of dab1b in the tectum and the eyes became stronger in the 3 dpf brain (Fig. 4J). The pallium, dorsal telencephalon, exhibited strong and specific expression of reelin and apoer2 (Fig. 5A,K). However, vldlr and dab1b exhibited broad expression showing dorsal-high and ventral-low gradient in the forebrain including pallial region (Fig. 5F,G,P,Q). In the midbrain region, all of the Reelin signal components were expressed in the presumptive tectum. A thin layer at the dorsal surface of tectum expressed reelin faintly (Fig. 5C), and the entire width of the tectum exhibited homogenous expression of dab1b (Fig. 5R; Costagli et al. 2002). Expression of apoer2 was moderate and broad, and not restricted in the tectal region at the midbrain level (Fig. 5M). Expression of vldlr was dorsally high in the tectum and formed a gradient becoming weak laterally (Fig. 5H). A weaker expression of vldlr was observed in the tegmentum (Fig. 5H). Expression of reelin, vldlr, apoer2, and dab1b was detected clearly in the presumptive cerebellar region (Fig. 5D,I,N,S). In the hindbrain, reelin was expressed in the interneurons (Costagli et al. 2002; Fig. 5E), and apoer2 was expressed lateral to reelin (Fig. 5O). Expression of vldlr was observed strongly in the thin layer at the dorsal surface and moderately in the lateral wall (Fig. 5J). Expression of dab1b was observed in the dorsolateral surface of hindbrain and the area of interneurons (Hoppmann et al. 2008) (Fig. 5T). Gene expression pattern of Reelin receptors in 24 hpf, 2 and 3 dpf brain was summarized in Table 1.

Figure 5.  Serial coronal sections of the in situ hybridization specimens at 3 dpf (days postfertilization). Expression of reelin (A–E), vldlr (F–J), apoer2 (K–O), and dab1b (P–T) at telencephalon (A, F, K, P), diencephalon (B, G, L, Q), midbrain (C, H, M, R), and cerebellum (D, I, N, S) and hindbrain (E, J, O, T) levels. Ce, cerebellum; Di, diencephalon; FB, forebrain region; HB, hindbrain region; Hy, hypothalamus; MB, midbrain region; OV, otic vesicle; Teg, tegmentum; Tel, telencephalon; TeO, tectum; Pa, pallium. A scale bar in A indicates 0.1 mm.

Table 1.   Gene expression pattern of Reelin receptors during zebrafish brain development

	24 hpf		2 dpf		3 dpf
	apoer2	vldlr	apoer2	vldlr	apoer2	vldlr
Dorsal telencephalon	+++	++	+++	++	+++	++
Hypothalamus	++	+++	−	+	−	+
Tectum	++	−	+++	−	++	+++
Tegmentum	++	++	+	++	+	+
Cerebellum	++	+	+	+	+	+++

Discussion

Reelin signal active sites in the developing zebrafish brain

Because gene expressions of Reelin signal components including the ligand, receptors, and intracellular molecules were detected in the telencephalon, tectum, cerebellum, hindbrain, spinal cord, and the eyes during zebrafish development, morphogenesis of these regions in the zebrafish central nervous system (CNS) likely involves Reelin signal. Because distribution of reelin transcripts observed in 3 dpf larvae was basically similar to that in 5 dpf reported by Costagli et al. (2002), this stable expression likely owes synaptic function of neurons, which are integrated in neuronal networks (for review: Herz & Chen 2006). Gene expression of other components of the signaling pathway also became stable during hatching period except for that in the tectum and the cerebellum. Expression of apoer2 and dab1a in the cerebellum, and dab1b expression in the tectum gradually became stronger during hatching period (from 2 to 3 dpf). As morphogenesis in these brain regions is ongoing at this late stage, upregulation of the gene expression supports an idea that Reelin signal is important for the cerebellar and tectal morphogenesis. It is worthwhile to note that strong expression of all components of the signaling pathway, which we examined in this report, was observed in the tectum of this developmental period, because the most remarkable lamination is observed in the tectum of the zebrafish brain. This is consistent with the fact that Reelin expression is very strong in the developing chicken tectum (Bernier et al. 2000) which also exhibits prominent lamination. However, Nguyen et al. (1999) suggested that the lamination mechanism of fish tectum is different from that of the mammalian cerebral cortex. Thus, it is interesting to examine function of Reelin signal in the fish tectal morphogenesis.

Expression of dab1 genes, vldlr, and apoer2 was detected prior to the onset of reelin expression in non-neural tissues of zebrafish embryos. Because Reelin is not the only one ligand for the LDL receptors (Reddy et al. 2011), these gene expressions may have some developmental function in the tissues involved in other signaling pathways.

Reelin signal and evolution of brain morphogenesis

The detailed observations of gene expression in the serial sections of 3 dpf specimens (Fig. 5) showed that these genes are basically expressed in the dorsal aspects of the brain at every level along the anterior–posterior axis. Because prominent laminar structures, such as the cerebral cortex, cerebellum, and tectum, localize in the dorsal part of the vertebrate brains, dorsal restriction of gene expression of Reelin signal components in the fish, which is considered to represent primitive vertebrate, may imply that these genes had played some roles in evolution of laminar structures.

Reelin is broadly expressed in the dorsal telencephalon of chick (Bernier et al. 2000). Overexpression of Reelin at the pial surface, which mimics Reelin expression by Cajal-Retzius cells in the mammalian cortex, could recapitulate formation of mammalian-like radial fibers and subsequent neuronal migration along them (Nomura et al. 2008). Expression pattern of Reelin in the zebrafish telencephalon is similar to that in chick (Costagli et al. 2002). According to the hypothesis provided by Nomura et al. (2008), non-laminar dorsal telencephalon of fish is due to its situation predating establishment of pial surface expression of Reelin.

Duplication of dab1 is a unique genomic feature of the teleosts (Herrero-Turrión et al. 2010). Expression of two dab1 genes was observed in different brain regions, rather than different spatial expression in the same brain region. Thus, two dab1 genes function largely independently, and it is less likely that collaboration of these dab1 genes is involved in formation of a complex laminar structure as suggested in the function of two LDL receptors in the mouse corticogenesis (Hack et al. 2007).

Simultaneous knockout of the two receptors can give a disruption of cerebral and cerebellar cortices similar to those in the Reelin or Dab1 deficient mice (Trommsdorff et al. 1999), suggesting that largely these LDL receptors are functionally redundant. The present study has demonstrated coexpression of vldlr and apoer2 in the telencephalon, hypothalamus, cerebellum, and hindbrain during zebrafish embryogenesis, suggesting redundant function of the two Reelin receptors in these brain regions. Although single knockout mouse of these two LDL receptors showed weak abnormalities in brain morphology, different abnormalities in migration of cortical neurons were reported (Hack et al. 2007). Differences in biochemical functions between Apoer2 and Vldlr proteins were reported in mouse. The proteins and genes coding for these proteins exhibit different spatial distribution during brain development of mouse (Perez-Garcia et al. 2004; Hack et al. 2007). Apoer2 and Vldlr can bind to Reelin, but binding affinity of these receptors to Reelin is different (Jossin et al. 2004; Hibi et al. 2009). Pafah1b1 is an intracellular protein required for brain morphogenesis, and the mice deficient for this gene exhibit a brain phenotype similar to reeler (Assadi et al. 2003). Interestingly Pafah1b protein complex can bind Vldlr, but not Apoer2 (Zhang et al. 2007). It is possible that these functional divergences between Vldlr and Apoer2 are essential for the evolution of prominent laminar structure of vertebrate brain. Thus, expression of vldlr and apoer2 in the same brain regions of zebrafish can underlie development of morphological complexity of the brain structures.

An ascidian (XM_002120348) and a sea urchin (XM_779194) species have Reelin homologue, but Drosophila and nematode do not. Dab1 homologue is involved in epithelial morphogenesis and axon guidance of neurons in Drosophila (Song et al. 2010). Thus, involvement of Dab family protein in regulation of cell behavior had been established before divergence of the deuterostome and the protostome, and emerged Reelin binds and regulates Dab1 function in the deuterostomes. It is unlikely that Reelin signal regulates cell movement in development of simple morphology of CNS of the lower deuterostomes. Mouse studies revealed function of Reelin in synaptic function (Liu et al. 2001) and dendrogenesis of neurons (Niu et al. 2004). Thus, primary functions of Reelin signal in the lower deuterostomes are possibly involved in such aspects.

We carried out blast searches of the amphioxus genome databases (http://genome.jgi-psf.org/Brafl1/Brafl1.home.html) using mouse protein sequences. Queries by both Vldlr and Lrp8 sequence returned hitting the same amphioxus sequences, Bf_V2_113 and Bf_V2_149, and these are partial sequences of the same gene, XP_002597607. Similar results were obtained when blast searches were carried out using genome database of the cosmopolitan ascidian species, Ciona intestinalis (http://genome.jgi-psf.org/ciona4/ciona4.home.html) and lamprey (http://pre.ensembl.org/Petromyzon_marinus/blastview). These in silico investigations suggest that the protochordates and agnatha have only one gene similar to Vldlr and Apoer2 at the same degree, and the gene duplication, which generated vldlr and apoer2, occurred in the period of emergence of jawed vertebrates. Thus, evolutionary emergence of prominent laminar structure looks coincident with gene duplication to generate vldlr and apoer2.

Acknowledgments

We thank members of the Division of Anatomy and Developmental Neurobiology, Kobe University Graduate School of Medicine and The Laboratory for Vertebrate Body Axis, CDB RIKEN for their support throughout this work. We also thank Miss Sayaka Makino (Tohoku University, Graduate School of Medicine) for her technical support. This work was supported by KAKENHI (Kiban B No. 20101892 to TT and YK; Wakate B No. 10359862 to YK) and Shourei-Kenkyu-Josei of the Hyogo Science and Technology Association (to YK). HI was supported by a research grant from Japan Society for the Promotion Science (No. 21003671).

Appendix

The accession numbers of the zebrafish apoer2 gene are AB690376 and AB690576. The latter contains a sequence different from that shown in Fig.1 indicating the expression of multiple alternative splicing variants in zebrafish embryos.