SEARCH

SEARCH BY CITATION

Keywords:

  • BK polyoma virus;
  • genotype;
  • immunosuppression;
  • tubulointerstitial nephritis;
  • viral capsid protein VP-1

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Case report
  5. Discussion
  6. References

Abstract  The BK polyomavirus (BKV) infects most of the human population, but clinically relevant infections are usually limited to individuals who are in an immunosuppressed state. The significance of BKV infection was investigated in a 50-year-old man who underwent cadaveric kidney transplantation and was treated with tacrolimus, mycophenolate mofetil and prednisolone. By staining renal biopsy specimens with a monoclonal antibody against BK large T antigen, we were able to observe the relationship between the appearance of the BKV antigen and the extent of immunosuppression in this patient. We also determined that BKV belonged to genotype I by analysis of viral DNA from the patient's urine.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Case report
  5. Discussion
  6. References

BK human polyoma virus (BKV) is a ubiquitous, non-enveloped, double-stranded, supercoiled DNA virus of about 5130 base pairs that measures about 45 nm. BKV is largely associated with disease in immunocompromised patients.1 In an immunocompetent host, it persists indefinitely as a latent infection with a special affinity for the urinary tract, usually without causing clinical manifestations. BKV was first identified in the urine of a renal transplant recipient with ureteral stenosis.2 BKV allograft nephropathy is a complication of renal transplantation that is being increasingly recognized in patients receiving potent antirejection therapies such as tacrolimus (Tac) and mycophenolate mofetil (MMF).3 BKV infection is usually thought to affect between 2 and 5% of the renal transplant population.3 If BKV infects a transplanted kidney, the rate of graft loss ranges from approximately 16.4 to 50.0%, according to recent reports.1,4 Although most studies of the pathogenesis of BKV infection have been based on a histological approach, some investigators have recently analyzed the viral genome. However, the relationship between BKV infection and renal dysfunction has not been clearly elucidated. We present the first Japanese case report on the analysis of the BKV capsid protein VP-1 region using viral DNA isolated from the urine of a renal transplant patient with BKV-tubulointerstitial nephritis (BKV-ISN).

Case report

  1. Top of page
  2. Abstract
  3. Introduction
  4. Case report
  5. Discussion
  6. References

The patient was a 50-year-old Japanese man with end-stage renal disease secondary to chronic glomerulonephritis. After hemodialysis for 10 years, he underwent cadaveric renal allografting on 7 October, 2000. His immunosuppression regimen comprised of Tac, azathioprine (Az), prednisolone (PSL) and antilymphocyte globulin (Fig. 1). Since mild liver dysfunctions occurred on day 3, Az was replaced with MMF. Initially the graft functioned satisfactorily and serum creatinine levels (SCr) decreased from 9.62 mg/dL to 1.51 mg/dL within 35 days. On day 30, screening computed tomography detected a lymphocele with a diameter of 10 cm and mild hydronephrosis of the allograft in the pelvic cavity. On day 39, SCr increased to 2.10 mg/dL. After needle aspiration of the lymphocele with injection of a sclerosant, SCr decreased to 1.78 mg/dL. However, allograft function became worse on day 107, along with hydronephrosis, probably related to recurrence of lymphocele. The patient underwent allograft biopsy followed by needle aspiration with an injection of sclerosant and ureteric stenting. Serum creatinine levels immediately decreased from 2.43 mg/dL to 1.96 mg/dL, but increased again to 2.23 mg/dL after 5 days. Since allograft biopsy revealed hydronephrosis, toxic tubulopathy and no evidence of acute rejection (Fig. 2a), the dose of Tac was reduced from 10 mg to 6 mg. On day 125, the patient underwent laparoscopic fenestration because of the re-recurrence of lymphocele. Serum creatinine levels initially decreased to 1.83 mg/dL, but gradually increased to 2.12 mg/dL with proteinuria and an increase of serum lactic dehydrogenase 10 days after the procedure. Viral inclusion cells (decoy cells) with ground-glass nuclear inclusion bodies were detected by routine urine cytology on day 120 (Fig. 3). Immunostaining with anti-BKV antibody (a mouse monoclonal anti-BK virus large T antigen antibody; Cemicon, Temecula, CA) on postoperative day 108 also showed many positive nuclei in the tubular epithelium (Fig. 2b). A second allograft biopsy (Fig. 2c) was carried out and the specimen was immunostained with anti-BK virus antibody. Acute rejection (type IA, Banff 97) was detected with a much milder toxic tubulopathy than detected at the time of the first allograft biopsy, while BK infected uroepithelial cells decreased in number (Fig. 2d). Although steroid pulse therapy was duly considered, we were afraid of BKV reactivation, as BKV infects a transplanted kidney and the rate of graft loss can reach approximately 50%.1 Shiraki et al. reported that Mizoribine (Mz) suppressed human cytomegalovirus replication depending on increases in concentration.5 Since BKV belongs to the same double-stranded DNA  virus  category  as  cytomegalovirus,  we  expected a suppression of BKV replication. Therefore, we decreased the dose of MMF from 2000 mg to 1500 mg for the suppression of BKV reactivation, increased the dose of Tac from 6 mg to 8 mg for prevention of acute rejection, and added Mz at a dose of 50 mg for suppression of BKV replication or immunosuppression. Five months after transplantation, SCr was stabilized at 1.9–2.2 mg/dL. At 6 months after transplantation, pneumonia developed due to mixed infection with Staphylococcus aureus and Mycobacterium avium. The doses of Tac and MMF were reduced from 8 mg to 6 mg and from 1500 mg to 1000 mg, respectively, and the dose of PSL was also decreased to 10 mg. Serum creatinine levels remained stable at 2.0–2.3 mg/dL, but urinary excretion of protein increased to about 500 mg/day. Decoy cells were still found in the urine, but showed a decreasing tendency. At 8 months after transplantation, the patient suffered from Haemophilus influenzae pneumonia. Since pneumonia was not very severe, we reduced only the dose of prednisolone to 7.5 mg. Serum creatinine levels gradually rose to 3.4 mg/dL and urinary protein loss became higher than 1000 mg/day. Fourteen months after transplantation, renal allograft biopsy (Fig. 2e) revealed tubulointerstitial nephritis and borderline acute rejection (t:1, i:1, g:0, ah:1, v:0). Only a few BK-positive cells were seen (Fig. 2f). At this point, some clinical findings of rejection were seen, so we considered that the development of the renal allograft rejection coincided with that of BKV-ISN. First, methylprednisolone pulse therapy was performed for 3 days. Then, for the treatment of BK nephropathy, maintenance immunosuppression was reduced by gradual decreases in the dose of Tac, a reduction in the dose of MMF to 750 mg and the discontinuance of Mz. Subsequently, SCr decreased from 3.40 to 3.03 mg/dL within 2 weeks, but increased again to 4.03 mg/dL a week later. Decoy cells were still detected in the urine.

image

Figure 1. Clinical course after kidney transplantation. †, POD 125–Laparoscopic unroofing; ‡, POD 180–pneumonia (Staphylococcus aureus and Mycobacterium avium); §, POD 355 pneumonia (Haemophilus influenzae); ¶, methylprednisolone 500 mg. Cr, serum creatinine; MMF, mycophenolate mofetil; Mz, mizoribine; POD, postoperative day; PSL, prednisolone; Tac, tacrolimus; U-Pro, excretion of urinary protein.

Download figure to PowerPoint

image

Figure 2. Light microscopy after transplantation on POD 108, 135 and 454. BKV antigen-positive tubular cell nuclei appear in accordance with the disappearance of lymphocytic infiltration from the stroma. (A) Hydronephrosis and drug-induced toxic tubulopathy. HE staining. (B) Many tubular cells have nuclei that are positive for BK virus large T antigen. Immunostaining for BK virus large T antigen. (C) Numerous lymphocytes infiltrating the interstitium with wide-spread tubulitis. HE staining. (D) Few BK virus-infected cells are seen. Immunostaining for BK virus large T antigen. (E) Borderline acute rejection with marked tubular damage is seen. The infiltrating inflammatory cells consist of heterogeneous lymphocytes and occasional plasma cells. HE staining. (F) Some tubular cells show positive nuclear staining. Immunostaining for BK virus large T antigen. MMF, mycophenolate mofetil; Mz, mizoribine; POD, postoperative day; PSL, prednisolonine; Tac, tacrolimus.

Download figure to PowerPoint

image

Figure 3. (A) Decoy cells detected by urine cytology. Amorphous ground-glass type intranuclear inclusion bodies are seen in epithelial cells from the urine. Papanicolaou stain × 200. (B) Electron micrograph of urine cytology. The nuclear inclusions consist of naked, round electron-dense viral particles.

Download figure to PowerPoint

Two years after transplantation, decoy cells have disappeared from the urine, but SCr has increased to 4.58 mg/dL and the urinary protein loss is over 2500 mg/day. Proteinuria is very severe, but there was no evidence of glomerulonephritis in any of the three allograft biopsy specimens and the other laboratory findings. Cytomegalovirus, herpes simplex virus and Epstein-Barr virus have not been detected.

Isolation of DNA from urine samples

Urine samples were centrifuged at 10 000 g for 2 min in a 1.5-mL microtube. Then the sediment was washed in 1 mL of phosphate buffered saline and centrifuged for 2 min The pellet was resuspended in 100 µL of distilled water and heated at 95°C for 5 min to break up cells and release DNA. Finally, the tube was centrifuged for 10 sec and the supernatant was used for polymerase chain reaction (PCR).

Polymerase chain reaction amplification

Equivalent amounts of DNA (1.5 µg), as determined by spectrophotometry at 260 nm, were placed into Eppendorf tubes. Fifty nanograms of DNA was subjected to PCR amplification in a reaction mixture with a total volume of 25 µL; containing 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2, each primer at 0.5 µm, dNTPs at 200 µm and 0.625 U of Taq Polymerase. Denaturation was carried out for 2 min at 94°C, followed by 35 cycles of denaturation at 91°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 1 min. A final extension cycle of 1 min at 55°C and 4 min at 72°C was added. Polymerase chain reaction was performed using an automated DNA thermal cycler (Hybaid, Teddington, Middlesex). Two pairs of primers were used to detect VP-1 (VP1-327–1: CAAGTGC CAAAACTACTAAT and VP1-327–2r: TGCATGAAG GTTAAGCATGC) and non-coding region (NCR; NCR-1: TCCATGAGCTCCATGGATTCTTC and NCR-2r: CTAGGTCCCCCAAAAGTGCTAGA).6 Polymerase chain reaction products were subjected to electrophoresis on 2.5% agarose gel in tris-borate-EDTA buffer and stained with ethidium bromide. The PCR product was expected to be 327 bp in size for the subtype-specific region of VP-1 and 600–800 bp for the entire NCR. To confirm the PCR product, the 327 bp band of VP-1 was cut out from the gel, purified, and directly sequenced in the forward and reverse directions using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA).

BKV typing by restriction enzyme analysis of PCR products

Typing of BKV was performed by restriction enzyme digestion of the PCR products according to the method described by Jin.6 In brief, the PCR product for the VP-1 region was digested with Alul, after which degraded samples were assigned to genotypes I or II and intact samples were assigned to genotypes III or IV. Polymerase chain reaction products belonging to genotypes I or II were then digested with XmnI, while products belonging to genotypes III or IV were cleaved with AvaII. Degradation by XmnI indicated genotype II and degradation by AvaII indicated genotype III, while intact samples were assigned to genotypes I or IV, respectively.

Results of PCR amplification

Urine samples showed PCR products corresponding to the VP-1 region (327 bp) and the NCR (600–800 bp). In Figure 4a, lanes 1–3 and lanes 5–7 are from patient urine, while lanes 4 and 8 are negative controls. When the 327 bp band was cut from the gel, purified and directly sequenced in the forward and reverse directions, the VP-1 sequence was detected. The PCR product of VP-1 was cleaved by Alu I into two pieces of 186 and 141 bp (Fig. 4b, lane 1). When the PCR products were further digested with XmnI, no additional band appeared (Fig. 4b, lane 3). To confirm the results of restriction enzyme analysis, we also digested the PCR product with RsaI. The cleaved product (281 bp) is shown in Figure 4b, lane 5, while lanes 2 and 4 are the original VP-1 products. These findings indicated that the virus belonged to BKV genotype I.

image

Figure 4. (a) Polymerase chain reaction (PCR) amplification of BKV from urine samples. Postive PCR products corresponding to the VP-1 region (327 bp) and NCR (600–800 bp) are seen. Lanes 1–3 and 5–7 are from the patient's urine. Lanes 4 and 8 are negative controls. (b) BKV typing by restriction enzyme analysis of PCR products. The PCR product of VP-1 was digested with Alu I into two smaller products of 186 and 141 bp (lane 1). When the PCR products were further digested with XmnI, no additional band appeared (lane 3). To confirm this restriction enzyme analysis, we digested the PCR product with RsaI. The cleaved product (281 bp) is shown in lane 5. Lanes 2 and 4 are original VP-1 products.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Case report
  5. Discussion
  6. References

BK virus nephropathy has been anecdotally associated with the use of newer immunosuppressants such as Tac and MMF.4 Although the reactivation of latent BKV infection by excessive-immunosuppression may be one of the main causes of BKV-ISN, it is unlikely that immunosuppression alone accounts for the high prevalence of BKV infection in renal transplant recipients. The genome of BKV can be functionally divided into three regions: (i) a non-coding regulatory region; (ii) an early region coding for the small and late T proteins that are transcribed before DNA replication; and (iii) a late region coding for the agnoprotein and the capsid proteins (VP-1, VP-2, and VP-3) that are transcribed after DNA replication. The major viral strains associated with BKV-ISN are difficult to determine and possibly differ from those detected in healthy individuals and kidney transplant recipients without BKV-ISN. Although histopathology is still the gold standard for diagnosis of BKV-ISN, it has been shown that a quantitative PCR assay of BKV DNA in renal biopsy specimens can contribute to the prediction and diagnosis of BKV-ISN.7 Nickeleit et al.8 reported that testing for BKV DNA in plasma is a specific and sensitive way of identifying renal allograft recipients with BKV-ISN. Analysis of the BKV transcription control regulatory region (TCR) has identified 2 specific variants (the AS and WW strains). Given the various histological findings, Boldorini et al. have speculated that different BKV strains may cause different kinds of damage in transplanted kidneys.9 Accordingly, the BKV strain in the present patient may be related to BKV-ISN and it was diagnosed as BKV subtype I (Fig. 4) by Jin's method.6

The extent of immunosuppression, the BKV subtype, the host response and other factors probably play a role in the mechanism of renal tissue injury by BKV infection and may influence the spectrum of BKV-ISN. The source of infection in the present patient may include the reactivation of latent viruses, development of a new BKV variant, de novo infection and the transplanted kidney. A clinical outcome review of the recipient of the other kidney from the donor showed two episodes of acute rejection that responded to antirejection therapy. The maintenance immunosuppressants used for the other patient were ciclosporin, methylprednisolone and Mz, with SCr levels of 0.8 mg/dL 2 years after transplantation. Biopsy specimens showed no histological evidence of BKV-ISN. These findings may suggest either a de novo infection or that the reactivation of latent infection was caused by immunosuppression with Tac and MMF in the present patient, although we did not measure plasma BKV by PCR method before transplantation.

In many cases, the diagnosis of renal allograft rejection precedes or coincides with the diagnosis of BKV infection. In one report, concomitant acute allograft rejection occurred in 54% of patients with BKV infection.1 Although it is often difficult to distinguish between these two diagnoses, their management is opposite. Specifically, the treatment of rejection may promote the onset of BKV-related disease, while a decrease in immunosuppression can lead to rejection. Maintaining a balance between control of BKV infection and control of rejection is very difficult. The possibility that both processes are concurrently active must also be considered. Mayr et al. successfully managed a patient with early BKV-ISN accompanied by acute allograft rejection and introduced diagnostic and therapeutic algorithms.10 In their patient with two coexisting diagnoses, the rejection episode was treated first with 3 days of methylprednisolone pulse therapy, after which BKV-ISN was handled by reducing the doses for maintenance immunosuppression. We have experienced two difficult situations: first, although the number of BKV positive cells was decreased in the biopsy specimen, there was also acute rejection of Banff IA and second, the development of borderline mononuclear cell infiltration coincided with that of tubulointerstitial nephritis. We found that in the former there was slight BKV infection with acute rejection, while in the latter, borderline acute rejection coexisted with BKV-ISN. In the former, as we were afraid of BKV reactivation we did not perform methyprednisolone pulse therapy. In the latter, as we considered that borderline acute rejection was associated with BKV-ISN, we also performed methylpredonisolone pulse therapy for 3 days, followed by a reduction in the doses of drugs for maintenance immunosuppression according to the management plan. However, allograft function did not recover. At this period, marked tubular damage and atrophy with borderline acute rejection was seen in the pathological specimen. We speculated that, since these findings indicated the late stage of BKV-ISN, virally induced damage made graft functions unrecoverable.

Today, BKV-ISN is recognized as a disorder of post-transplant renal dysfunction. However, BKV-ISN had never been reported in Japan when we highly suspected the present patient as having BKV-ISN. Carefully reviewing the clinical course of the present patient retrospectively, we consider we should have made a correct diagnosis of BKV-ISN based on the biopsy on day 108. The most desirable therapeutic decision at this time period was to reduce the dose of the immunosuppressive agent, Tac, from 10 mg to 6 mg, as well as those of MMF and steroids because there was evidence of BKV activation. If we decided with confidence that cellular infiltration observed in the biopsy specimen on day 135 was related with BKV-ISN rather than acute rejection, we could not have increased the dose of Tac from 6 mg to 8 mg and not have used the loading small amount of Mz for the purpose of suppression of BKV replication. Furthermore, if we correctly judged the late phase of BKV-ISN in biopsy at day 454, we could have avoided steroid pulse therapy.

Management of patients with BKV-ISN is a very difficult task. Since decoy cells can be found in healthy people, monitoring of BK viremia by PCR was essential. As described in a report by Mary et al., it is very important to perform screening and monitoring of decoy cells in urine cytology and BKV DNA in plasma, as an early diagnosis of BKV-ISN seems to be crucial for functional recovery.10 Recently, it has been reported that cidofovir is an effective pharmacotherapeutic agent for BKV-ISN. In future, we should consider when and how to use cidofovir for BKV infection. Furthermore, since BKV variants may affect the pathogenesis of BKV-ISN, we must continue to research the subtype and DNA sequence of BKV.9

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Case report
  5. Discussion
  6. References
  • 1
    Nickeleit V, Hirsch HH, Binet IF et al. Polyomavirus infection of renal allograft recipients: from latent infection to manifest disease. J. Am. Soc. Nephrol. 1999; 10: 108089.
  • 2
    Gardner SD, Field AM, Coleman DV, Hulme B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1971; 19: 12537.
  • 3
    Randhawa PS, Demetris AJ. Nephropathy due to polyomavirus type BK. N. Engl. J. Med. 2000; 342: 13613.
  • 4
    Ramos E, Drachenberg CB, Papadimitriou JC et al. Clinical course of polyoma virus nephropathy in 67 renal transplant patients. J. Am. Soc. Nephrol. 2002; 13: 214551.
  • 5
    Shiraki K, Ishibashi M, Okuno T et al. Effect of cyclosporine, azathioprine, mizoribine, and predonisolone on replication of human cytomegalovirus. Transplant. Proc. 1990; 22: 16825.
  • 6
    Jin L. Molecular methods for identification and genotyping of BK virus. Methods Mol. Biol. 2001; 165: 3348.
  • 7
    Randhawa PS, Vats A, Zygmunt D et al. Quantitation of viral DNA in renal allograft issue from patients with BK virus nephropathy. Transplantation 2002; 74: 4858.
  • 8
    Nickeleit V, Klimkait T, Binet IF et al. Testing for polyomavirus type BK DNA in plasma to identify renal-allograft recipients with viral nephropathy. N. Engl. J. Med. 2000; 342: 1309315.
  • 9
    Boldorini R, Omodeo-Zorini E, Suno A et al. Molecular characterization and sequence analysis of polyomavirus strains isolated from needle biopsy specimens of kidney allograft recipients. Am. J. Clin. Pathol. 2001; 116: 48994.
  • 10
    Mayr M, Nickeleit V, Hirsch HH et al. Polyomavirus BK nephropathy in a kidney transplant recipient. critical issues of diagnosis and management. Am. J. Kidney Dis. 2001; 38: E13.