Muramyldipeptide and diaminopimelic acid-containing desmuramylpeptides in combination with chemically synthesized Toll-like receptor agonists synergistically induced production of interleukin-8 in a NOD2- and NOD1-dependent manner, respectively, in human monocytic cells in culture

Authors


E-mail dent-ht@mail.tains.tohoku.ac.jp; Tel. (+81) 22 717 8305; Fax (+81) 22 717 8309.

Summary

Two types of synthetic peptidoglycan fragments, diaminopimelic acid (DAP)-containing desmuramylpeptides (DMP) and muramyldipeptide (MDP), induced secretion of interleukin (IL)-8 in a dose-dependent manner in human monocytic THP-1 cells, although high concentrations of compounds are required as compared with chemically synthesized Toll-like receptor (TLR) agonists mimicking bacterial components: TLR2 agonistic lipopeptide (Pam3CSSNA), TLR4 agonistic lipid A (LA-15-PP) and TLR9 agonistic bacterial CpG DNA. We found marked synergistic IL-8 secretion induced by MDP or DAP-containing DMP in combination with synthetic TLR agonists in THP-1 cells. Suppression of the mRNA expression of nucleotide-binding oligomerization domain (NOD)1 and NOD2 by RNA interference specifically inhibited the synergistic IL-8 secretion induced by DMP and MDP with these TLR agonists respectively. In accordance with the above results, enhanced IL-8 mRNA expression and the activation of nuclear factor (NF)-κB induced by MDP or DMP in combination with synthetic TLR agonists were markedly suppressed in NOD2- and NOD1-silenced cells respectively. These findings indicated that NOD2 and NOD1 are specifically responsible for the synergistic effects of MDP and DMP with TLR agonists, and suggested that in host innate immune responses to invading bacteria, combinatory dual signalling through extracellular TLRs and intracellular NODs might lead to the synergistic activation of host cells.

Introduction

All animals and plants should possess a means of innate defence against microbial attack. In innate immune system, pattern recognition of microorganisms should initiate host defence against invasive pathogens, where pathogen-associated molecular patterns (PAMPs) are recognized by the pattern recognition molecules (PRMs) of hosts. In bacteria, representative PAMPs are distributed on cell surfaces; peptidoglycans (PGNs) in almost all bacteria except mycoplasma which lack cell walls, lipoproteins (the active entities of which are lipopeptides) in all bacteria including mycoplasma, and lipopolysaccharides (LPS; the active entities of which are lipid A) in almost all Gram-negative bacteria. In addition, bacterial DNA whose abundant CpG motifs are not methylated also serves as PAMPs. Recent studies demonstrated that in mammals these PAMPs are recognized specifically by the respective Toll-like receptor (TLR) on cell surfaces of hosts; PGN and lipopeptides are mainly recognized by TLR2, and LPS and bacterial CpG DNA is recognized by TLR4 and TLR9 respectively (Takeda et al., 2003).

Plenty  of  studies  have  shown  numerous  bioactivities of bacterial PGN including immunoadjuvant activities, most of which have been reproduced by a chemically synthesized low-molecular PGN fragment, muramyldipeptide (MDP; N-acetylmuramyl-l-alanyl-d-isoglutamine, MurNAc-l-Ala-d-isoGln) (Takada and Kotani, 1985; Takada and Kotani, 1995). Another type of PGN fragment, desmuramylpeptides (DMPs), has also been chemically synthesized to mimic PGN containing meso-diaminopimelic acid (meso-DAP), and DMPs exerted similar bioactivities to MDP (Goto and Aoki, 1987). We found that MDP lacked TLR2 agonist activity (Yoshimura et al., 1999; Takada et al., 2002). We also found that MDP exerted remarkable synergistic effects with and priming effects on LPS to induce the production of inflammatory cytokines in human monocytic cells in culture (Yang et al., 2001). MDP also primed mice for induction of cytokines in response to various bacterial components including LPS and lipid A, although MDP by itself did not induce cytokines in mice (Takada et al., 2002). These findings suggest that DMPs as well as MDP possibly exert synergistic effects with various TLR agonistic PAMPs in human monocytic cells in culture in a TLR2-independent manner.

Recently, NOD2 was revealed to be an intracellular receptor for MDP (Girardin et al., 2003a; Inohara et al., 2003). Thereafter, it has also been reported that NOD1 senses a PGN motif containing DAP (Chamaillard et al., 2003; Girardin et al., 2003b). Using synthetic compounds, Inohara et al. (2003) showed that γ-d-glutamyl-meso-DAP (iE-DAP) is sufficient for NOD1 activation, indicating that this is the minimal structure recognized by NOD1 (Chamaillard et al., 2003). NOD1 and NOD2 are members of a family of intracellular proteins termed NBS-LRR possessing a central nucleotide-binding site (NBS) and a C-terminal leucin-rich repeat (LRR) domain, and these intracellular PRMs mediate host defence by detecting two types of PGN motifs that invade the cytosolic compartment (Philpott et al., 2001; Inohara et al., 2002; Tschopp et al., 2003).

In this study, we first examined possible synergistic effects of MDP/DMPs and TLR agonistic PAMPs. We used chemically synthesized PAMPs to avoid the influence of minor components in bacterial fractions: synthetic Escherichia coli-type lipid A (LA-15-PP) as a TLR4 agonist, synthetic E. coli-type triacyl lipopeptide Pam3CSSNA as a TLR2 agonist, and bacterial CpG DNA as a TLR9 agonist. Synthetic DMPs were used as possible NOD1 agonists. Then, we examined whether NOD2 and NOD1 are specifically responsible for the synergistic effects of MDP and DMPs with TLR agonistic PAMPs respectively.

Results

Induction of IL-8 secretion by synthetic PAMPs in human monocytic THP-1 cells in culture

First, we examined the activities of synthetic PAMPs to induce IL-8 in OCT-treated THP-1 cells in culture. Pam3CSSNA, lipid A, CpG DNA, MDP, FK156, FK565 and iE-DAP induced IL-8 production in a dose-dependent manner (Fig. 1A and B). Among PGN fragments, MDP exerted stronger activity than DMPs and the three DMPs were  practically  equal  in  this  respect  (Fig. 1B).  It  must be noted that MDP and DMPs required more than a million-, thousand- and hundred-fold concentrations compared with those of Pam3CSSNA, lipid A and CpG DNA, respectively, to exert comparable activity in this experiment.

Figure 1.

Induction of IL-8 secretion by synthetic PAMPs in THP-1 cells in culture. OCT-treated THP-1 cells were stimulated with Pam3CSSNA (A), lipid A (A), CpG DNA (A), MDP (A and B), and FK156 (A and B), FK565 (B) and iE-DAP (B) at the indicated concentrations for 24 h in triplicate. IL-8 levels in the culture supernatants were determined by ELISA and expressed as means ± SD. *, P < 0.01 versus medium alone. The results are representative of three different experiments.

Synergistic effect of MDP with synthetic PAMPs for induction of IL-8 secretion in THP-1 cells in culture

To elucidate possible synergistic effects of MDP with various TLR agonists, we examined whether MDP exhibited synergistic effects with synthetic PAMPs: TLR2 agonistic lipopeptide Pam3CSSNA, TLR4 agonistic lipid A LA-15-PP, and TLR9 agonistic CpG DNA to induce IL-8 secretion in THP-1 cells. Clear synergistic effects were observed between MDP and three synthetic PAMPs (Fig. 2). These findings clearly indicated that synergistic effects of MDP were exerted not only with TLR4 agonist as suggested by our previous study (Yang et al., 2001), but also with other TLR agonists.

Figure 2.

Synergistic effect of MDP with synthetic PAMPs for induction of IL-8 secretion in THP-1 cells in culture. OCT-treated THP-1 cells were stimulated with MDP plus lipid A (A), Pam3CSSNA (B) or CpG DNA (C) at the indicated concentrations for 24 h in triplicate. Concentrations of IL-8 in the culture supernatants were determined by ELISA, and the mean values are shown. * and ♯, P < 0.01 versus respective control. Significant (P < 0.05) synergistic effects were detected in A–C by anova including an interaction term. The results are representative of two different experiments.

Synergistic effect of DMP with synthetic PAMPs for induction of IL-8 secretion in THP-1 cells in culture

Next, we examined whether or not DMP containing DAP has a synergistic effect with the synthetic PAMPs. Similar to MDP, FK156 exhibited definite synergistic effects with these PAMPs on IL-8 secretion in THP-1 cells (Fig. 3). With a combination of FK565 and synthetic PAMPs, similar synergistic effects were also observed (data not shown). These findings clearly indicated that DMPs possess similar potency to MDP to induce synergistic effects with various TLR agonists.

Figure 3.

Synergistic effect of FK156 with synthetic PAMPs for induction of IL-8 secretion in THP-1 cells in culture. OCT-treated THP-1 cells were stimulated with FK156 plus lipid A (A), Pam3CSSNA (B) or CpG DNA (C) at the indicated concentrations for 24 h in triplicate. Concentrations of IL-8 in the culture supernatants were determined by ELISA, and the mean values are shown. * and ♯, P < 0.01 versus control. Significant (P < 0.05) synergistic effects were detected in A–C by anova including an interaction term. The results are representative of two different experiments.

Specific suppression of synergistic IL-8 production induced by a combination of MDP or DMP with synthetic PAMPs using dsRNA targeting NOD2 and NOD1 respectively

To elucidate whether NOD molecules are specifically responsible for the synergistic effects of MDP and DMPs with TLR agonistic PAMPs, we utilized RNA interference assays targeting NOD1 and NOD2 mRNA. NOD1 and NOD2 mRNA levels determined by reverse transcription polymerase chain reaction (RT-PCR) assay were suppressed by c. 80% using specific double-stranded RNA (dsRNA) in THP-1 cells (Fig. 4A and B). As shown in Fig. 4C, synergistic effects induced by MDP and synthetic PAMPs were significantly inhibited in NOD2-silenced THP-1 cells. On the other hand, synergistic effects induced by FK156 and synthetic PAMPs were significantly suppressed in NOD1-silenced THP-1 cells (Fig. 4D). It must be also noted that weak activity of MDP was also significantly suppressed in NOD2-silenced cells (Fig. 4C). Furthermore, we examined the dipeptide iE-DAP, which is a known NOD1 agonist (Chamaillard et al., 2003), for synergistic effect with lipid A in comparison with FK156 and FK565. We confirmed that FK156/565 and iE-DAP had similar abilities in this respect (Fig. 4E). In accordance with the above results, the induction of IL-8 mRNA induced by MDP or DMP and synthetic PAMPs was markedly suppressed in NOD2- and NOD1-silenced cells respectively (Fig. 4F and G). FK565 showed similar results (data not shown). These results clearly demonstrated that NOD2 and NOD1 are critical molecules for the synergistic effects induced by MDP and DMPs in combination with TLR agonists respectively.

Figure 4.

Specific suppression of synergistic effect of MDP and FK156 with synthetic PAMPs in THP-1 cells using dsRNA for NOD2 and NOD1 respectively.
A and B. Targeting of NOD1 and NOD2 by dsRNA. THP-1 cells were transfected with NOD1-specific (A) or NOD2-specific (B) dsRNA. After the transfection for the period indicated, the expression of NOD1, NOD2 and GAPDH mRNA was analysed by RT-PCR.
C–E. Suppression of IL-8 secretion. THP-1 cells were transfected with dsRNA targeting NOD1 or NOD2, or buffer. After 24 h, the transfected cells were stimulated with 100 µg ml−1 MDP (C and E), FK156 (D and E) or iE-DAP (E) plus lipid A (100 ng ml−1) (C–E), Pam3CSSNA 100 pg  ml−1 (C and D) or CpG DNA (1 µM) (C and D) for an additional 24 h in triplicate. Concentrations of IL-8 in the culture supernatants were determined by ELISA. * and ♯, significantly different from the respective medium alone control (P < 0.01). ♯, significantly different from the respective positive control (P < 0.01). Error bars indicated SD. Results are representative of three different experiments.
F and G. THP-1 cells were transfected with dsRNA targeting for NOD1 or NOD2, or buffer. After 24 h, the transfected cells were stimulated with 100 µg ml−1 MDP or FK156 plus lipid A (100 ng ml−1), Pam3CSSNA (100 pg ml−1) or CpG DNA (1 µM) for 8 h in triplicate. After the incubation, the expression of IL-8 and GAPDH mRNA were analysed by RT-PCR. Bands were further quantified using an imaging analyser (F). The results are expressed relative to GAPDH mRNA (G). Three additional experiments gave similar results to those shown here.
H. Suppression of NF-κB activation. THP-1 cells were transfected with dsRNA targeting NOD1 or NOD2, or buffer. After 24 h, the transfected cells were stimulated with 100 µg ml−1 MDP or FK156 plus lipid A (100 ng ml−1), Pam3CSSNA (100 pg ml−1) or CpG DNA (1 µM) for 1 h in triplicate. Whole-cell extracts were added to wells with oligonucleotide containing the NF-κB consensus sites, and incubated for 1 h. Anti-p65 antibody was added for 1 h followed by horseradish peroxidase-conjugated anti-mouse IgG. All samples were assayed in triplicate, and the results are expressed as means ± SD. *, significantly different from the respective control (medium alone) (P < 0.01). ♯, significantly different from the respective positive control (P < 0.01).

Recent studies have shown that NOD1 and NOD2 signalling activated nuclear factor (NF)-κB (Bertin et al., 1999; Inohara et al., 1999; Inohara et al., 2001). Thereafter, we examined whether the synergistic effects induced by MDP or DMPs in combination with TLR agonists involve NF-κB signalling. As shown in Fig. 4H, the activation of NF-κB induced by MDP or DMP and synthetic PAMPs was markedly suppressed in NOD2- and NOD1-silenced cells respectively.

Discussion

In this study, we clearly demonstrated that MDP and DAP-containing DMPs exhibited remarkable synergistic effects with TLR2, TLR4 and TLR9 agonists to induce the production of inflammatory cytokines in human monocytic cells. We also demonstrated that NOD2 and NOD1 are responsible for the synergistic effects of MDP and DMPs, respectively, in combination with TLR agonists. This is the first report that DMP as well as MDP has synergistic effects with TLR2 agonistic lipopeptide and TLR9 agonistic bacterial CpG DNA as well as TLR4 agonistic lipid A. It should be emphasized that we used chemically synthesized PAMPs to avoid the influences of minor components in bacterial preparations. It must also be mentioned that commercially available LPS preparations might be contaminated with NOD ligand(s) (Chamaillard et al., 2003; Inohara et al., 2003), and that PGN preparations themselves are TLR2 agonists and could also serve as NOD1 or NOD2 agonists after degradation. These points suggest that the strong bioactivity of LPS, PGN and other PAMPs demonstrated using bacterial preparations might be partially attributable to possible synergistic effects between TLR and NOD signalling.

It must be noted that MDP does not exhibit clear activity. Nagao et al. (1990) reported species dependency of in vitro macrophage activation of MDP; guinea pig and rat cells were responsive, but murine cells were not. In human peripheral blood mononuclear cell cultures, MDP is a powerful cytokine inducer comparable to LPS. In mice, MDP by itself does not induce lethal toxicity and serum cytokines, but MDP-primed mice are hypersensitive to an injection of endotoxin (Takada and Galanos, 1987; Parant et al., 1990; Takada et al., 2002). As mentioned above, in our previous study (Yang et al., 2001), MDP exhibited a synergistic effect with and priming effect on endotoxin stimulation in human monocytic THP-1 cells similarly to the present study. In contrast, Wolfert et al. (2002) reported that MDP induced TNF-α mRNA expression, but not TNF-α production, because of a deficiency of translation following the care of MDP stimulation in human Mono Mac 6 cells, which resulted in apparent synergistic effects with LPS. This might be the case in the cells, but in THP-1 cells, MDP alone showed clear cytokine-inducing activity (Yang et al., 2001 and this study). It must be emphasized that the marked synergistic effects observed in this and the previous studies are much greater than the additive effects of MDP and TLR ligands. The upregulation of MyD88 expression by MDP (Yang et al., 2001) through NOD2 signalling followed by NF-κB activation (Fig. 4) might be at least partially responsible for the synergistic effects.

As mentioned above, chemically synthesized MDP is capable of reproducing various functions of PGN, especially those observed in vivo (Takada and Kotani, 1985; 1995). Recent studies in vitro indicated that PGN activated various cells through TLR2 (Takeuchi et al., 1999; Yoshimura et al., 1999), while MDP lacked TLR2 agonistic activity (Vidal et al., 2001; Yang et al., 2001; Takada et al., 2002). Therefore, PGN might exert bioactivities in vivo through intracellular NOD2, not extracellular TLR2. It must be noted in this context that PGN and MDP must be administered to animals in suitable vehicles such as a water-in-oil emulsion for the induction of cell-mediated immunity as adjuvants (Stewart-Tull, 1985). The vehicle might deliver efficiently the PGN fragments to the intracellular receptor NOD2 in target cells such as macrophages. The mechanism by which PGN fragments are sent to intracellular NOD receptors is not clear at present. In this study, considerably high concentrations of MDP and DMP were required as compared with TLR agonists to exert sufficient activity. Only small amounts of NOD ligands might be sent to the respective intracellular receptors.

In the course of studying the active moiety of PGN for immunoadjuvant activity, Fleck et al. (1974) first reported that a DAP-carrying DMP prepared from E. coli together with test antigen in a water-in-oil emulsion induced a delayed-type hypersensitivity in guinea pigs, although they suggested that the DMP moiety of Lys-type PGN might be similarly active in this respect. The report has not been highly valued so far, because chemically synthesized MDP, but not Lys-type DMP, exhibited immunoadjuvant activity (Kotani et al., 1975). The recent discovery of different intracellular receptors for DAP-carrying DMP and MDP, i.e. NOD1 and NOD2, might make DMP a focus of investigators. A series of studies by the Fujisawa group on chemically synthesized DMPs (Kitaura et al., 1982), and the two representative compounds FK156 and FK565 used in this study, should be re-evaluated. For example, Kitaura et al. (1982) reported that N2-γ-d-Glu-meso-DAP (iE-DAP in this study) is the minimal structure for bioactivity of DMP. FK156 was first chemically synthesized to mimic an active compound found in fermentation broths of strains of Streptomyces (Goto and Aoki, 1987), then the leading compound FK565 was selected among many FK156 derivatives. The DAP moiety of FK156 and FK565 was linked to Gly and d-Ala respectively. Various bioactivities of these two compounds have been examined in experiments in vitro and in vivo. The recent study of Girardin et al. (2003b) showed that meso-DAP should be at the terminal position for sensing NOD1. The apparent discrepancy between their study and the present study might be derived from the fact that we used DMP, while they used muramylpeptides.

As described above, most bacteria possess TLR agonistic PAMPs: TLR2 agonistic lipoproteins, TLR4 agonistic LPS in the case of Gram-negative bacteria, and TLR9 agonistic CpG DNA. Most bacteria except mycoplasma also possess a PGN which can sense directly TLR2 and also sense either NOD1 or NOD2 after degradation by bacteria or host PGN-lytic enzymes. Therefore, in host innate immune responses to invading bacteria, combinatory dual signalling through extracellular TLR molecules and intracellular NOD molecules should lead to the synergistic activation of host cells, which in turn initiate or modulate acquired immune responses. Further study is required to elucidate the mechanisms of the synergistic effects between TLR and NOD signalling, which might add a new viewpoint to host–bacterial interactions including bacterial infections and possible beneficial roles of normal bacterial flora.

Experimental procedures

Materials

The synthetic MDP was purchased from Protein Research Foundation Peptide Institute. The E. coli-type triacyl lipopeptide Pam3CSSNA was chemically synthesized, as described previously (Nakamura et al., 2002). The synthetic E. coli-type lipid A (LA-15-PP) was purchased from Protein Research Foundation Peptide Institute. The synthetic DMP, a PGN fragment containing DAP, FK156 (d-lactoyl-l-Ala-γ-d-Glu-meso-DAP-Gly) and its derivative, FK565 (heptanoyl-γ-d-Glu-meso-DAP-d-Ala) (Kitaura et al., 1981), was supplied by Fujisawa Pharmaceutical. iE-DAP was synthesized as described previously (Chamaillard et al., 2003). Phosphorothioate-stabilized CpG DNA 1826, as a strong human cell stimulant (TCCATGACGTTCCTGATGCT) (Hemmi et al., 2000), was obtained from Proligo. The chemical structures of PAMPs are shown in Fig. 5. All other reagents were obtained from Sigma-Aldrich, unless otherwise indicated.

Figure 5.

Chemical structures of synthetic PAMPs. Chemical structures of E. coli-type lipid A (LA-15-PP), E. coli-type triacyl lipopeptide Pam3CSSNA, CpG DNA, muramyldipeptide (MDP; MurNAc-l-Ala-d-isoGln), and a desmuramylpeptide iE-DAP (γ-d-Glu-meso-DAP), FK156 (d-lactyl-l-Ala-γ-d-Glu-meso-DAP-Gly) and its derivative FK565 (heptanoyl-γ-d-Glu-meso-DAP-d-Ala) are shown.

Cells and cell culture

The human monocytic leukaemia cell line THP-1, supplied by the Health Science Research Resources Bank, was cultured in RPMI 1640 medium (Nissui Seiyaku) with 10% heat-inactivated fetal calf serum (FCS; Life Technologies) at 37°C in a humidified CO2 atmosphere. The THP-1 cells were maintained in a logarithmic phase of growth (2 × 105 to 2 × 106) by passage every 3–4 days. Cells (2 × 105 ml−1) were then treated with 0.1 µM 22-oxyacalcitriol (OCT), an analogue of 1α,25-dihydroxy-vitamin D3 (Kubodera et al., 1997), supplied by Chugai Pharmaceutical for 3 days. OCT treatment induced the differentiation of THP-1 cells into macrophage-like cells strongly expressing membrane CD14 (mCD14), whereas the THP-1 cells expressed TLR2/4 constitutively irrespective of OCT treatment (Yang et al., 2001).

RT-PCR

Total cellular RNA was prepared from THP-1 cells with Isogen (Nippon Gene) according to the manufacturer's instructions. Reverse transcription of RNA samples to cDNA was performed with avian myeloblastosis virus transcripts (RT) XL (Life Sciences) and random primer (non-adeoxyribonucleotide mixture; Takara). The primers used for PCR had the following sequences: NOD1, 5′-TAGTGCTGTTTCTGCCTCTC-3′, 5′-AATTTGACCCC TGCGTCTAG-3′; NOD2, 5′-AGCCATTGTCAGGAGGCTC-3′, 5′-CGTCTCTGCTCCATCATAGG-3′; and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5′-CATCACCATCTTCCA GGAGC-3′, 5′-CATGAGTCCTTCCACGATACC-3′. Amplified samples were visualized on 2.0% agarose gels stained with ethidium bromide and photographed under UV light. The bands on the photographs were scanned and then analysed with an Image Master ID (Pharmacia Biotech). The results are expressed as relative mRNA accumulation corrected with reference to GAPDH mRNA as an internal standard.

Measurement of interleukin (IL)-8

OCT-treated THP-1 cells were collected and washed twice in phosphate-buffered saline (PBS). The cells (105 per 200 µl per well) were incubated with or without stimulant in RPMI 1640 medium with 1% FCS for 24 h in 96-well round-bottomed plates (Falcon). After cultivation, the culture supernatants were collected and the levels of interleukin (IL)-8 were determined with enzyme-linked immunosorbent assay (ELISA) kits (OptEIA ELISA kits, BD Pharmingen). The concentration of cytokines in the supernatants was determined using the softmax data analysis program (Molecular Devices).

RNA interference

Transfections for targeting endogenous NOD1 and NOD2 were carried out using Lipofectamine 2000 (Invitrogen) and dsRNA (final concentration, 200 nM). The sequences of target mRNAs used in this study are NOD1, 5′-AAGAGCCTCTTTGTCTTCACC-3′; and NOD2, 5′-AAGACATCTTCCAGTTACTCC-3′.

Assay for NF-κB activity

Activated NF-κB was measured with an NF-κB assay kit specific for the p65 subunit according to the manufacturer's instructions (Active Motif). Briefly, samples of whole-cell extracts (1–10 µg of protein per well) were added to 96-well plates coated with an oligonucleotide containing the NF-κB consensus site (5′-GGGACTTTCC-3′), and incubated for 1 h at room temperature with mild agitation. After three washes, NF-κB p65 antibody was added for 1 h without agitation followed by horseradish peroxidase-conjugated anti-mouse IgG1. Colorimetric reactions were developed, stopped and measured at 450 nm. The specificity of binding was also examined using an oligonucleotide containing a wild-type or mutated NF-κB consensus binding site.

Data analysis

All experiments were performed at least three times to confirm the reproducibility of the results. For most experiments, results are shown as the mean ± standard deviation (SD) of triplicate assays. The statistical significance of differences between two means was evaluated with a one-way analysis of variance (anova), using the Bonferroni or Dunnett method, and P-values less than 0.05 were considered significant. In combinatory stimulation experiments, anova of the interaction between PAMPs was carried out to examine the synergistic effects of the agents.

Acknowledgements

This report is dedicated to a pioneer in PGN and muramylpeptide research, Dr S. Kotani (Osaka University) who was deceased on May 2, 2004. We thank Dr N. Inohara (Michigan University) for helpful advice. We also thank D. Mrozek (Medical English Service, Kyoto, Japan) for reviewing the paper. This work was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (14370576). A.U. was supported by a research fellowship from the Japan Society for the Promotion of Science (PD6961).

Ancillary