SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Epidemiological studies support that chronic periodontal infections are associated with an increased risk of cardiovascular disease. Previously, we reported that the periodontal pathogen Porphyromonas gingivalis accelerated atherosclerotic plaque formation in hyperlipidemic apoE–/– mice, while an isogenic fimbria-deficient (FimA-) mutant did not. In this study, we utilized 41 kDa (major) and 67 kDa (minor) fimbria mutants to demonstrate that major fimbria are required for efficient P. gingivalis invasion of human aortic endothelial cells (HAEC). Enzyme-linked immunosorbent assay (ELISA) revealed that only invasive P. gingivalis strains induced HAEC production of pro-inflammatory molecules interleukin (IL)-1β, IL-8, monocyte chemoattractant protein (MCP)-1, intracellular adhesion molecule (ICAM)-1, vascular cellular adhesion molecule (VCAM)-1 and E-selectin. The purified native forms of major and minor fimbria induced chemokine and adhesion molecule expression similar to invasive P. gingivalis, but failed to elicit IL-1β production. In addition, the major and minor fimbria-mediated production of MCP-1 and IL-8 was inhibited in a dose-dependent manner by P. gingivalis lipopolysaccharide (LPS). Both P. gingivalis LPS and heat-killed organisms failed to stimulate HAEC. Treatment of endothelial cells with cytochalasin D abolished the observed pro-inflammatory MCP-1 and IL-8 response to invasive P. gingivalis and both purified fimbria, but did not affect P. gingivalis induction of IL-1β. These results suggest that major and minor fimbria elicit chemokine production in HAEC through actin cytoskeletal rearrangements; however, induction of IL-1β appears to occur via a separate mechanism. Collectively, these data support that invasive P. gingivalis and fimbria stimulate endothelial cell activation, a necessary initial event in the development of atherogenesis.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Increasing evidence has focused attention on infection with specific microbial pathogens as a risk factor and novel reservoir of agents that potentiate atherosclerosis and its associated inflammatory changes (Ross, 1999). Much of this interest has been centred on infection with Chlamydia pneumoniae, a common respiratory pathogen, because of epidemiological and experimental reports linking infection with this organism to atherosclerosis (Kuo et al., 1993; Jackson et al., 1997; Moazed et al., 1999). The association between human periodontal disease, a chronic bacterial infection of the tissue that supports the teeth, and cardiovascular disease (CVD) has also been recently strengthened by both epidemiological and in vitro studies (Beck et al., 1996; Loesche et al., 1998; Arbes et al., 1999; Dorn et al., 1999; Haraszthy et al., 2000; Loos et al., 2000; Kolltveit and Eriksen, 2001; Glurich et al., 2002). Chiu (1999) reported that 42% of specimens obtained from human atherosclerotic plaques reacted with antibody to the primary aetiological agent of periodontal disease, Porphyromonas gingivalis. In addition to a broad array of known virulence factors, this organism expresses two distinct types of fimbria, the 41 kDa and 67 kDa protein subunit types denoted as major and minor respectively (Hamada et al., 1994). The major fimbria has been shown to be required for adhesion to gingival cells, gingival fibroblasts and endothelial cells (Lamont et al., 1995; Deshpande et al., 1998; Nakagawa et al., 2002). P. gingivalis major fimbria have been reported to induce the expression of inflammatory cytokines, such as tumour necrosis factor (TNF)-α and interleukin (IL)-1β, in both human and murine monocytes/macrophages or monocytic cell lines. These studies indicated that the major fimbria of P. gingivalis plays a crucial role as both a bacterial adhesin and a potent stimulus capable of eliciting host inflammatory responses (Ogawa et al., 1994; Saito et al., 1996; Hajishengallis et al., 2002a; Graves et al., 2005). Recently, we reported that infection of apolipoprotein E (ApoE) knockout mice with invasive P. gingivalis plays a major role in accelerated atheroma development. Results from these studies showed that only wild-type P. gingivalis (possessing the major fimbria), but not the non-invasive (FimA-) mutant, could accelerate plaque formation in the aortic arch of these mice despite the observation of both wild-type and FimA mutant DNA in the blood and aortic arch tissue of infected animals (Gibson III., et al., 2004). As compared with the major fimbria, very little is known about the function(s) of minor fimbria. In purified native form, the minor fimbria of P. gingivalis has been reported to induce TNF-α, IL-1β, or IL-6 production in human monocytic cell lines and murine peritoneal macrophages (Hajishengallis et al., 2002a; Hiramine et al., 2003). However, the precise role of the minor fimbria in P. gingivalis virulence remains poorly defined.

The healthy vascular endothelium maintains an intact, anti-inflammatory state that inhibits thrombosis (Charo et al., 1998). Disruption of this homeostatic state by a mechanical breach of this barrier, or by exposure to bacterial or viral infection, can readily convert the endothelium to a pro-thrombotic environment (Visser et al., 1988). Pro-inflammatory cytokines, cell adhesion molecules (CAMs) and Toll-like receptors (TLRs) are believed to be actively involved in this infection-mediated activation of the endothelium (Collins et al., 1995; Faure et al., 2001; Zeuke et al., 2002) and acceleration of atherosclerosis (Nageh et al., 1997; Boring et al., 1998; Gu et al., 1998; Bjorkbacka et al., 2004; Michelsen et al., 2004). Numerous studies have been reported on the interaction of endothelial cells and Chlamydia pneumonia (Gaydos et al., 1996; Fryer et al., 1997; Campbell et al., 1998; Dechend et al., 1999; Gaydos, 2000). These studies demonstrated that Chlamydial infection of these cells can induce expression of many pro-inflammatory mediators associated with atherosclerosis including cytokines, CAMs and chemokines, as well as molecules associated with pro-coagulant activity and those promoting the oxidation of low density lipoprotein (Kaukoranta-Tolvanen et al., 1996; Fryer et al., 1997; Molestina et al., 1998; Krull et al., 1999; Summersgill et al., 2000; Dittrich et al., 2004). We recently demonstrated that P. gingivalis invasion of human aortic endothelial cells (HAEC) stimulates TLR expression, priming these cells to respond to interactions with TLR-specific ligands (our unpubl. data). However, this response was not observed with non-invasive P. gingivalis, heat-killed organisms, purified native P. gingivalis major or minor fimbria, or P. gingivalis lipopolysaccharide (LPS).

In this study, using defined P. gingivalis fimbrial mutants, as well as purified native P. gingivalis major and minor fimbria, we demonstrated that an invasive P. gingivalis genotype and both the major and minor fimbria of P. gingivalis can stimulate potent inflammatory responses consistent with expression of pro-inflammatory chemokines and adhesion molecules in HAEC. In addition, we demonstrate that only invasion by intact P. gingivalis induces the more complex, temporally accelerated pro-inflammatory response potentially seen in HAEC during the initial events of a developing atherosclerotic lesion in vivo.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Inactivation of the 67 kDa minor fimbrillin gene (mfa1) of P. gingivalis

Porphyromonas gingivalis attachment to host cells has been suggested to be a bi-phasic process whereby the major fimbria is responsible for initially tethering the bacteria to the host cell (Lamont and Jenkinson, 1988; Njoroge et al., 1997). The exact mechanism by which more intimate attachment occurs is currently undefined. As P. gingivalis possesses two types of fimbria, 41 kDa and 67 kDa protein subunits, we generated several fimbria-deficient mutants in the wild-type strain 381 background. To create a P. gingivalis 67 kDa fimbrial mutant, the truncated 67 kDa fimbrillin gene (mfa1) was amplified by polymerase chain reaction (PCR) and cloned into pBluescriptII KS+ and disrupted by the tetQ gene (Fig. 1A). Transformation of the recombinant plasmid into P. gingivalis strain 381 and previously constructed P. gingivalis DPG3 (Malek et al., 1994) generated two new strains, 381MF1 (a minor fimbria-deficient mutant) and DPGMFB (a major and minor fimbria-deficient mutant) respectively. Growth curves for all strains of P. gingivalis demonstrated no differences in growth over a 36 h period (data not shown). Both newly generated strains failed to express the 67 kDa minor fimbria as demonstrated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and by immuno-blotting with anti-67-kDa fimbria antiserum (Fig. 1B). It should be noted that immuno-blots of cell lysates from similar colony-forming units (cfu) counts of wild-type strain 381, DPG3 and 381MF1 verified that loss of Mfa1 or fimA does not result in altered expression of the 41 kDa or 67 kDa fimbrial proteins by 381MF1 and DPG3 respectively (data not shown). As expected, SDS-PAGE and immuno-blot analysis of purified fimbria isolated from all strains revealed that each fimbrillin protein appeared as a single band, with the corresponding molecular weights of 41 kDa and 67 kDa, respectively, and reacted to their anti-41-kDa (major) or anti-67-kDa (minor) fimbria-specific antiserum (Fig. 1C). Electron microscopy revealed that strain 381MF1 expressed fimbria that were distinct from fimbria of strain DPG3. As expected, no filamentous structures were observed on the cell surface of DPGMFB (Fig. 1D). These strains and purified native fimbrial proteins were utilized for the remainder of our studies.

image

Figure 1. Establishment of P. gingivalis 41 kDa (major) and 67 kDa (minor) fimbria mutants. A. Construction of the recombinant plasmid for inactivation of the 67 kDa (minor) fimbrillin gene. The truncated 67 kDa fimbrillin gene (mfa1, so called minor fimbria gene) was cloned into a pBluescriptII KS+ plasmid and disrupted by the tetracycline resistance gene tetQ. The resulting plasmid was transformed into strain 381 and DPG3 following linearization with SacI. Tetracycline resistant transformants were recovered after 2–3 weeks of anaerobic culture. B. SDS-PAGE and immuno-blot analysis of the fimbrial mutants (wild-type strain 381 – expresses 41 kDa major and 67 kDa minor fimbria, mutant strain DPG3 – expresses only the 67 kDa minor fimbria (Malek et al., 1994), mutant strain 381MF1 – expresses only the 41 kDa major fimbria, and mutant strain DPGMFB – does not express either fimbria). C. SDS-PAGE and immuno-blot analysis of purified native fimbria isolated from strains 381, DPG3 and 381MF1. Whole cell samples of the bacterial cells or purified native fimbria were separated using 12% gels stained by Coomassie brilliant blue R-250 or transferred to PVDF membranes and incubated with rabbit anti-major or anti-minor fimbria-specific antiserum for detection of fimbria as indicated (B and C). D. Electron microscopy analysis of fimbria mutants. P. gingivalis cells were fixed and applied to collodion coated copper grids, negatively stained by 2% uranyl acetate and visualized with a JEM1220 transmitting electron microscope. Bars indicate 200 nm.

Download figure to PowerPoint

Efficient P. gingivalis invasion of HAEC requires 41 kDa (major) fimbria

Previously we reported that human umbilical vein endothelial cells (HUVEC) express chemokines (Nassar et al., 2002) and adhesion molecules (Khlgatian et al., 2002) in response to invasive P. gingivalis. Since publication of the aforementioned manuscripts, several groups have demonstrated diversity in the biochemical composition (Ghitescu and Robert, 2002), as well as differences in gene expression patterns (Chi et al., 2003), between arterial and venous endothelial cells. As the aorta is a principal site of atherosclerotic plaque accumulation during CVD, we obtained primary HAEC from multiple donors and challenged these cells with live P. gingivalis. To examine the role of the major and minor fimbria in the invasion efficiency of P. gingivalis into HAEC, we first carried out infection experiments with our constructed fimbria mutants. As shown in Fig. 2A, the invasion efficiency of P. gingivalis into HAEC was dependent upon expression of the major fimbria. Internalization of the bacteria occurred predominantly within the first hour of infection for strains possessing the major fimbria. P. gingivalis strain 381MF1, possessing only the major fimbria, exhibited invasion efficiencies comparable to wild-type P. gingivalis strain 381; while the P. gingivalis strains failing to express the major fimbria (DPG3 and DPGMFB) displayed 100- to 1000-fold lower invasion efficiencies, respectively, when compared with wild-type P. gingivalis after 6 h infection of HAEC (Fig. 2A). To ensure that observed differences in invasion efficiency were not the result of altered susceptibility to antibiotic treatment, existing strains 381 and DPG3, as well as newly constructed mutant strains 381MF1 and DPGMFB were tested for susceptibility to metronidazole killing. No differences were observed in efficiency of metronidazole killing for any of the strains tested (data not shown).

image

Figure 2. P. gingivalis wild-type and fimbrial mutant invasion of HAEC. A. Non-centrifuged invasion efficiency of P. gingivalis wild-type and mutant strains into HAEC. Endothelial cells were infected for 1, 2 and 6 h. Internalized bacterial cells were recovered by lysis of HAEC with water. Cell lysates were plated onto blood agar plates and incubated anaerobically at 37°C for 7 days prior to cfu count. Percent invasion was expressed as the percentage of the initial inoculums. B. Centrifuge-enhanced invasion of the endothelium. Bacteria were either added to medium (black bars) or centrifuged onto HAEC monolayers (350 g for 5 min) (open bars). After 1 h, internalized bacteria were recovered as described above and percent invasion was expressed as the percentage of the initial inoculums. All assays were performed in triplicate. Values represent the mean of triplicate samples and are indicative of a typical experiment ± standard error.

Download figure to PowerPoint

As mentioned previously, the interaction of P. gingivalis with host cells has been described as a two-stage process of initial attachment mediated by the 41 kDa major fimbria, followed by more intimate attachment facilitating endocytosis of the bacteria (Lamont and Jenkinson, 1988; Njoroge et al., 1997). In addition, it has been demonstrated that expression of Fim A is not sufficient for invasion and that other surface molecules may be involved (Dorn et al., 2000). As a minimal percentage of the initial DPG3 (0.0023%) and DPGMFB (0.00041%) inoculums, which are devoid of the major or both fimbria, respectively, were able to invade the endothelial cells, we next determined the contribution of the minor fimbria and other surface components in P. gingivalis invasion of HAEC. To better define the initial process of major fimbria-mediated attachment, wild-type P. gingivalis and the fimbrial mutants were centrifuged onto HAEC, as described previously (Walter et al., 2004), to enhance the rate of infection and potentially alleviate the requirement for major fimbria in achieving efficient invasion. Centrifugation of the bacteria resulted in a two-log-unit increase in invasion for both the DPG3 and DPGMFB strains when compared with non-centrifuged bacteria (Fig. 2B). In addition, the enhancement of DPG3 attachment to the endothelial surface resulted in invasion percentages that were similar to non-centrifuged wild-type 381 and mutant strain 381MF1 which possess the major fimbria. Collectively, these results stress the importance of major fimbria for initiation of attachment and provide novel information regarding the role of the minor fimbria in endothelial invasion.

Chemokine and cytokine responses of HAEC infected with P. gingivalis

To functionally assess the invasive capabilities of the P. gingivalis fimbria mutants, we next examined chemokine and cytokine expression by HAEC in response to invasive P. gingivalis infection utilizing enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase polymerase chain reaction (RT-PCR). Infection with invasive P. gingivalis strains 381 and 381MF1 (expressing the major fimbria) stimulated production of monocyte chemoattractant protein (MCP)-1, IL-8 and IL-1β by HAEC (Fig. 3A, C and E respectively). It should be noted that infection with P. gingivalis 381MF1 stimulated IL-8 mRNA expression at 6 h (196 relative densitometry units, RDU) (Fig. 3C) that remained elevated for 24 h (209 RDU), while infection with wild-type strain 381 resulted in an initial induction of IL-8 mRNA at 6 h (167 RDU) that appeared to decrease over time (104 RDU). In addition, infection with invasive strains of P. gingivalis resulted in protein levels of IL-1β (Fig. 3E) which increased markedly after 2 h, followed by decreased levels observed at the 6 and 24 h time points. This trend was not observed with either MCP-1 (Fig. 3A) or IL-8 production (Fig. 3C). As expected, neither the major fimbria mutant DPG3 nor the fimbrial-null mutant DPGMFB stimulated expression of MCP-1, IL-8, or IL-1β (Fig. 3A, C and E respectively). To confirm that active invasion of P. gingivalis into HAEC was required for the observed chemokine and cytokine responses, cells were treated with 1 µg ml−1 of cytochalasin D prior to the addition of P. gingivalis. Trypan blue staining (Singh et al., 1985) revealed that cells remained viable after cytochalasin D treatment. However, we observed that cytochalasin D treatment did inhibit P. gingivalis invasion (data not shown). In addition, production of MCP-1 and IL-8 was significantly decreased (P < 0.05) by cytochalasin D to 5% and 30%, respectively, when compared with non-inhibited, P. gingivalis challenged, HAEC control (Fig. 3B and D). In contrast, we observed no significant inhibition of IL-1β production by HAEC treated with cytochalasin D following stimulation with wild-type P. gingivalis or the fimbrial mutants (Fig. 3F). These data suggest that while the observed chemokine responses appear to be dependent on cytoskeletal rearrangements induced by P. gingivalis invasion of HAEC, induction of the cytokine IL-1β seems to occur via a separate mechanism.

image

Figure 3. Expression of MCP-1, IL-8 and IL-1β by HAEC infected with P. gingivalis. HAEC were incubated with P. gingivalis strains at an moi of 100 for 1 h, 6 h and 24 h as indicated below each panel. A, C and E. Vertical stripes, black bars, open bars, grey bars and diagonal stripes represent uninfected control, 381, DPG3, 381MF1 and DPGMFB respectively. B, D and F. For inhibition of invasion, HAEC were treated with 1 µg ml−1 (open bars) of cytochalasin D for 30 min prior to infection. Cells were then infected with P. gingivalis strains at moi of 100 for 6 h. Control samples not treated with cytochalasin D are indicated by black bars. Supernatant and total RNA from infected HAEC were analysed by ELISA and semi-quantitative RT-PCR. Production of MCP-1 (A and B), IL-8 (C and D) and IL-1β (E and F) were expressed as mean ± SDs. Corresponding gene expression, as determined by RT-PCR, is displayed below each graph (A–F). Semi-quantitative densiometric analyses have been performed for all mRNA data as indicated below each panel and are listed as relative densitometry units (RDUs). The results shown are representative of three independent experiments. *P < 0.05 versus uninfected control. ♯P < 0.05 control versus cytochalasin D treated HAEC.

Download figure to PowerPoint

Invasion-induced expression of adhesion molecules in HAEC

In addition to chemokines, other markers of vascular activation including CAMs, have been indicated as contributors to the pro-inflammatory state associated with CVD (Davies et al., 1993; O’Brien et al., 1993; 1996; Johnson-Tidey et al., 1994; DeGraba et al., 1998). To assess CAM expression on endothelial cells infected with P. gingivalis, HAEC were cultured with wild-type P. gingivalis and fimbrial mutants for 1, 6 and 24 h. CAM expression was determined by flow cytometry and RT-PCR. Following 6 h of infection, we observed increased levels of mRNA for ICAM-1, VCAM-1 and E-selectin in HAEC cultured with invasive strains 381 and 381MF1 (Fig. 4A). No differences in P-selectin mRNA expression were observed at 6 or 24 h for any of the strains tested; however, total surface expression of P-selectin by HAEC appeared to decrease from 6 to 24 h. Protein levels of all CAMs stimulated by invasive strains of P. gingivalis were maximally expressed on HAEC by 6 h of infection with a gradual return to baseline expression levels following 24 h of infection (Fig. 4C). The major fimbria-deficient mutants, DPG3 and DPGMFB, did not induce similar CAM responses. In addition, heat-killed P. gingivalis 381 did not induce surface expression of CAMs (data not shown). Taken together, these results suggest that P. gingivalis viability and an invasion phenotype is required to stimulate increased expression of adhesion molecules on HAEC.

image

Figure 4. Expression of cell adhesion molecules by HAEC infected with P. gingivalis. HAEC were incubated with 381, DPG3, 381MF1 and DPGMFB at an moi of 100 for 1, 6 and 24 h as indicated. Samples were analysed by RT-PCR (A) and FACScan flow cytometry with FITC-conjugated anti-ICAM-1, anti-VCAM-1, anti-E-/P-selectin or anti-P-selectin antibody (C). Expression of E-selectin was estimated by subtraction of the measured intensity for P-selectin from the measured intensity for E-/P-selectin. Black, red, green, blue and pink lines represent uninfected control, 381, DPG3, 381MF1 and DPGMFB infected samples respectively. (B) Semi-quantitative densiometric analyses have been performed for all mRNA data and are listed as relative densitometry units (RDUs). Results are representative of three independent experiments.

Download figure to PowerPoint

Stimulation of HAEC with purified native fimbria induces MCP-1 and IL-8, but not an IL-1β response

To better define the role of fimbria in invasion-induced expression of inflammatory molecules, we examined protein production and gene expression of MCP-1 (Fig. 5A) and IL-8 (Fig. 5B) following incubation of HAEC with purified native major or minor fimbria. Following 6 h incubation with either the major or minor fimbria, we observed a dose- and time-dependent increase in MCP-1 protein production and gene expression by HAEC (Fig. 5A). Incubation of HAEC with major or minor fimbria (10 µg ml−1) stimulated 25 and 40 ng ml−1 of MCP-1, respectively, as observed at 24 h post infection. Protein levels of IL-8 on HAEC appeared to follow a similar trend as that observed for MCP-1 (Fig. 5B); however, the dose–response of mRNA induced by either fimbria was no longer observed at 24 h. Interestingly, we observed that unlike infection with live bacteria, IL-1β was not produced following stimulation of HAEC with either type of fimbria (data not shown). These results indicate that purified native minor fimbria of P. gingivalis is as capable as the major fimbria in stimulating chemokine secretion by HAEC. Additionally, the lack of detectable IL-1β expression in response to either purified antigen suggests a complex, and potentially interactive role for major and minor fimbria in mediating the stimulation of HAEC by live P. gingivalis.

image

Figure 5. MCP-1 and IL-8 expression by HAEC incubated with purified native fimbria. HAEC were incubated in the presence of purified native major or minor fimbria for 1, 6 or 24 h as indicated. The supernatants and total RNA from cells were analysed by ELISA and RT-PCR respectively. The values of MCP-1 (A) and IL-8 (B) for unstimulated control (vertical stripes), 10 µg ml−1 of major fimbria (black bars), 1 µg ml−1 of major fimbria (open bars), 10 µg ml−1 of minor fimbria (grey bars) and 1 µg ml−1 of minor fimbria (diagonal stripes) were expressed as mean ± SDs. Corresponding gene expression is displayed below the graph. Semi-quantitative densiometric analyses have been performed for all mRNA data as indicated below each panel and are listed as relative densitometry units (RDUs). *P < 0.05 compared with unstimulated control.

Download figure to PowerPoint

Expression of adhesion molecules following stimulation of HAEC with purified native fimbria

After observing similar chemokine responses by endothelial cells incubated with live bacteria or purified fimbrial antigen, we next assessed CAM expression of HAEC cultured with fimbria by RT-PCR and FACS respectively (Fig. 6A and C). As previously reported with other endothelial cells (McEver et al., 1989; Khlgatian et al., 2002), we observed that P-selectin gene expression in HAEC was constitutive and that differences between samples were not observed at 1 and 6 h time points. Interestingly, a slight decrease in P-selectin mRNA expression, relative to unstimulated HAEC control (185 RDU) was observed with the highest concentrations of major and minor fimbria stimulation after 24 h (121 and 134 RDU respectively). It should be noted that a similar decrease in 24 h mRNA expression of P-selectin was also observed with live P. gingivalis (Fig. 4A). P-selectin is one of the first cell surface molecules to be expressed on endothelial cells in response to inflammatory stimuli and triggers initial neutrophil rolling along the vascular endothelium (Jones et al., 1993; Mayadas et al., 1993; Smith, 1993; Nolte et al., 1994; Kanwar et al., 1997; Burns et al., 1999; Akgur et al., 2000; Takano et al., 2002). Its expression on the luminal surface of the endothelial cell has been shown to peak within minutes following activation by circulating mediators (Akgur et al., 2000). This rapid surface expression reflects the release of preformed P-selectin from Weibel-Palade (WP) bodies located inside the cell membrane (Weibel and Palade, 1964; Bonfanti et al., 1989; Hattori et al., 1989a,b; McEver et al., 1989; Burns et al., 1999). However, the mechanisms by which P-gingivalis triggers this rapid P-selectin expression remains to be elucidated. In Fig. 4B, it is clear that P-selectin is expressed in response to invasive strains 381 and 381MF1 which possess the major fimbria. As purified major fimbria failed to induce surface expression of P-selectin (Fig. 6C), it appears that strains 381 and 381MF1 activate P-selectin expression in a manner that is independent of the major fimbria and that this expression may instead be dependent upon invasion.

image

Figure 6. Cell adhesion molecule expression in response to purified native fimbria. A and C. HAEC were incubated in the presence of purified native major or minor fimbria for 1, 6 and 24 h as indicated. Samples were analysed by RT-PCR (A) and FACScan flow cytometry with FITC-conjugated anti-ICAM-1, anti-VCAM-1, anti-E-/P-selectin or anti-P-selectin antibody (C). Black, red and blue lines represent uninfected control, and 1, or 10 µg ml−1 of fimbria incubated samples respectively. Expression of E-selectin was estimated by subtraction of measured intensity for P-selectin from the measured intensity for E-/P-selectin. The stimulus and antibody used for detection are indicated to the left of each panel. B. Semi-quantitative densiometric analyses have been performed for all mRNA data as indicated below each panel and are listed as relative densitometry units (RDUs). These results were representative of three independent experiments.

Download figure to PowerPoint

Following a 6 h stimulation of HAEC with major or minor fimbria, we observed increased transcription of ICAM-1, VCAM-1 and E-selectin in a dose-dependent manner. Analysis of cell surface expression of these adhesion molecules by FACS demonstrated a similar increase for ICAM-1, VCAM-1 and E-selectin for the same 6 h period. Following 24 h incubation with major or minor fimbria, surface expression of VCAM-1 had returned to preincubation levels while surface expression of ICAM-1 remained at significantly elevated levels (P < 0.001) (Fig. 6C). These results indicate that both the P. gingivalis major and the minor fimbria are capable of inducing CAM expression on HAEC.

Stimulation of HAEC with purified native fimbria induces chemokine production through regulation of actin cytoskeleton dynamics

Previous studies have reported that fimbria-mediated adhesin of P. gingivalis to gingival epithelial cells induces the formation of integrin-associated focal adhesions with subsequent remodelling of the actin cytoskeleton (Yilmaz et al., 2002; 2003). Reports by Okada et al. (1998) suggested that a mechanical breach of the vascular cell wall potentially promotes atherogenesis. This study demonstrated that cyclic stretch in human endothelial cells resulted in alteration of actin cytoskeletal integrity and resultant enhancement of MCP-1 and IL-8 secretion. To determine whether rearrangement of the actin cytoskeleton plays a role in fimbria-mediated induction of chemokines by HAEC, endothelial cells were treated with 1 µg ml−1 of cytochalasin D for 30 min prior to incubation with purified major or minor fimbria. We observed that incubation with purified native major or minor fimbria, cultured with cytochalasin D treatment, significantly inhibited (P < 0.05) MCP-1 (Fig. 7A) and IL-8 (Fig. 7B) production by HAEC at 24 h, when compared with untreated controls. Similar inhibition of MCP-1 and IL-8 was observed with cytochalasin D treated HAEC 6 h after fimbrial stimulation (data not shown). These findings indicate that HAEC responses to native major or minor fimbria are highly dependent upon maintenance and rearrangement of an intact endothelial actin cytoskeleton.

image

Figure 7. The inhibitory effect of cytochalasin D on induction of MCP-1 (A) and IL-8 (B) by HAEC incubated with purified native fimbria. To inhibit chemokine induction by HAEC, endothelial cells were treated with 1 µg ml−1 (open bars) of cytochalasin D for 30 min prior to incubation with purified native major or minor fimbria (1 or 0.1 µg ml−1) for 24 h. Control samples of HAEC not treated with cytochalasin D are indicated by black bars. Supernatants from infected HAEC were analysed by ELISA. Production of MCP-1 (A) and IL-8 (B) were expressed as mean ± SDs. The results shown are representative of three independent experiments. *P < 0.05 compared with unstimulated control.

Download figure to PowerPoint

Porphyromonas gingivalis LPS fails to elicit CAM/selectin expression by HAEC

In addition to fimbria, it has been reported that other surface expressed antigens of P. gingivalis, such as LPS, stimulate host cells (Tabeta et al., 2000; Bainbridge and Darveau, 2001; Hirschfeld et al., 2001; Martin et al., 2001; Darveau et al., 2004). To determine whether P. gingivalis LPS stimulates the previously observed cytokine, chemokine and cellular adhesion molecule (CAM) response from HAEC, we stimulated these cells with ultra-purified P. gingivalis LPS (generously provided by Dr Richard Darveau, University of Washington, Seattle, Washington). In these studies, HAEC were cultured with 1 or 0.1 µg ml−1 of P. gingivalis LPS, 0.01 or 0.1 µg ml−1 of Escherichia coli LPS, and 1 or 10 µg ml−1 of Saccharomyces cerevisiae zymosan. Surface expression of ICAM-1, VCAM-1, E-selectin and P-selectin were analysed by flow cytometry at 1, 6 and 24 h. We observed that P. gingivalis LPS failed to stimulate ICAM-1, VCAM-1 or selectin expression from HAEC at either of the doses tested (Fig. 8A). Similar results were observed for S. cerevisiae zymosan (Fig. 8B and data not shown). Stimulation of HAEC with 0.1 µg ml−1 of E. coli LPS was able to induce significant expression of ICAM-1 at 24 h (P < 0.001) (Fig. 8B). Low level increases in the surface expression of VCAM-1 and E-selectin were also observed (data not shown). These data suggest a potentially unique and important role for fimbria in the process of endothelial cell activation by P. gingivalis. In addition, P. gingivalis may employ TLR4 as a means of inducing CAM/selectin expression on HAEC.

image

Figure 8. Cell adhesion molecule expression by HAEC in response to P. gingivalis LPS, E. coli LPS or S. cerevisiae zymosan. A. HAEC were incubated with P. gingivalis LPS for 1, 6 and 24 h as indicated. Samples were analysed by FACScan flow cytometry with FITC-conjugated anti-ICAM-1, anti-VCAM-1, anti-E-/P-selectin or anti-P-selectin antibody. Black, red and blue lines represent uninfected control, 1 µg ml−1 and 0.1 µg ml−1 of LPS respectively. Expression of E-selectin was estimated by subtraction of measured intensity for P-selectin from the measured intensity for E-/P-selectin. B. HAEC were incubated for 6 h with P. gingivalis LPS, E. coli LPS or S. cerevisiae zymosan Samples were then analysed by FACScan flow cytometry with FITC-conjugated anti-ICAM-1, anti-VCAM-1, anti-E/P-selectin or anti-P-selectin antibody. Black, red and blue lines represent uninfected control, 0.1 µg ml−1 and 1 µg ml−1 of P. gingivalis LPS; uninfected control, 10 ng ml−1 and 100 ng ml−1 of E. coli LPS; and uninfected control, 1 µg ml−1 and 10 µg ml−1 of S. cerevisiae zymosan respectively. These results were representative of three independent experiments.

Download figure to PowerPoint

Porphyromonas gingivalis LPS inhibits fimbria-mediated MCP-1 and IL-8 production by HAEC

Porphyromonas gingivalis LPS has been previously demonstrated to inhibit Fim A protein-induced NF-κβ-dependent transcription of pro-inflammatory molecules (Hajishengallis et al., 2002b). To attempt to identify a similar mechanism responsible for the observed ability of purified native minor fimbria to stimulate chemokine expression in HAEC (Fig. 5A and B), but its failure to do so when present on the surface of intact P. gingivalis strain DPG3 (Fig. 3A and C), we next tested the potential of P. gingivalis LPS to inhibit minor fimbria activation of HAEC. Endothelial cells were stimulated with 1 µg ml−1 of purified native major or minor fimbria, or fimbria plus increasing concentrations of P. gingivalis LPS. Following 6 h of stimulation, we observed that major and minor fimbria-mediated production of MCP-1 by HAEC was inhibited in a dose-dependent manner by P. gingivalis LPS (Fig. 9). Notably, the amount of P. gingivalis LPS required to significantly (P < 0.05) inhibit minor fimbria-mediated production of MCP-1 was 10 times less (100 ng ml−1) compared with that required to inhibit the major fimbria (1 µg ml−1). Similar results were observed for IL-8 production (data not shown). These results suggest that P. gingivalis LPS may be responsible for inhibiting the stimulatory capability of the minor fimbria when it is expressed in its native state on the surface of live bacteria.

image

Figure 9. P. gingivalis LPS inhibition of fimbria-mediated MCP-1 production by HAEC. Endothelial cells were stimulated with 1 µg ml−1 of purified native major or minor fimbria, or fimbria plus increasing concentrations of P. gingivalis LPS. The results shown represent an average of three independent experiments. *P < 0.05 versus unstimulated control. **P < 0.001 versus unstimulated control.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The ability of microbial pathogens, such as P. gingivalis and C. pneumoniae, to potentiate atherosclerosis by establishment of an inflammatory state within the endothelium, is receiving increased attention. Previous reports have established that bacterial infection of endothelial cells stimulates inflammatory markers such as tissue factor, IL-6, chemokines and CAMs (Fryer et al., 1997; Deshpande et al., 1998; Molestina et al., 1998; Dechend et al., 1999; Khlgatian et al., 2002). In this study, we have utilized a series of P. gingivalis fimbria mutants to demonstrate that the expression of 41 kDa (major) fimbria is required for efficient invasion of HAEC. In addition, we have demonstrated that following major fimbria-mediated initial attachment, the minor fimbria appear to play an important role in more intimate attachment facilitating endocytosis of the bacteria. We show that internalization of P. gingivalis by HAEC resulted in the induction of an inflammatory response, which included increased production of the cytokine, IL-1β; chemokines, MCP-1 and IL-8; as well as adhesion molecules, ICAM-1, VCAM-1 and E-selectin by HAEC. Additionally, we observed that P. gingivalis strains devoid of major fimbria elicited a markedly reduced inflammatory response by HAEC. As expected, incubation of HAEC with purified native major or minor fimbria induced expression of both MCP-1 and IL-8 in addition to CAMs, yet failed to elicit IL-1β. Recently (Chi et al., 2004) demonstrated that IL-1 plays a crucial role in the inflammatory cascade involved in the progression of atherosclerosis and suggested that bacteria mediate this response through an IL-1 signalling pathway. Linking P. gingivalis infection and induction of an IL-1β mediated inflammatory signal cascade in the endothelium requires additional experimentation to assess the mechanistic link between P. gingivalis endothelial cell infection and atherosclerosis.

The induction of IL-1β by HAEC in response to infection with invasive strains of P. gingivalis, and the notable absence of its production when endothelial cells are incubated with purified fimbria, indicate a potential context-dependent expression of both the major and minor fimbria on the surface of intact P. gingivalis. To this end, we observed an approximately fivefold greater chemokine response by HAEC incubated with purified native major or minor fimbria when compared with infection with intact P. gingivalis. Unexpectedly, P. gingivalis LPS did not induce inflammatory responses by HAEC. Previous reports by (Coats et al., 2003) have demonstrated that P. gingivalis LPS can antagonize E. coli LPS activation of TLR4 in human endothelial cells. Additionally (Hajishengallis et al., 2004) has provided evidence suggesting that P. gingivalis LPS may be capable of directly engaging TLR4 and inhibiting the ability of the major fimbria to activate this receptor. As live invasive P. gingivalis possesses LPS and our fimbrial preparations are free of LPS, we hypothesized that the absence of LPS in our purified native preparations of major or minor fimbria, in part, accounts for the greater stimulation of chemokine production by HAEC in response to purified antigen. As demonstrated in this study, P. gingivalis LPS appears to antagonize the pro-inflammatory effects of minor fimbria, and to a lesser extent the major fimbria, when cells are exposed simultaneously to both molecules. Such an anti-inflammatory mechanism has been proposed previously by Hajishengallis et al. to have a survival value for both the pathogen and, in the cases of extreme inflammatory reactions, for the host (Hajishengallis et al., 2002b).

It should be noted that a recent study by (Darveau et al., 2004) demonstrated that P. gingivalis LPS is highly heterogeneous, containing more lipid A species than previously described. In addition, this study showed that purification of LPS can preferentially fractionate these lipid A species and proposed that their presence may contribute to cell activation through both TLR2 and TLR4. As mentioned previously, several groups have shown differences in gene expression between arterial and venous endothelial cells. Faure et al. (2001), has demonstrated that human dermal microvessel endothelial cells (HMEC) and HUVEC predominantly express TLR4 and show very weak TLR2 expression. In contrast, Dunzendorfer et al. (2004), has proposed that human coronary artery endothelial cells express predominantly TLR2 and utilize intracellularly localized TLR4 to respond to enterobacterial LPS. We have shown that HAEC express TLR4 and have intracellular stores of both TLR2 and TLR4 (M. Davey, unpubl. results), which is consistent with our data displaying upregulation of ICAM-1 in response to E. coli LPS, but not to S. cerevisiae zymosan. The dynamics of major and minor fimbrial interaction with surface expressed TLR4 and intracellularly localized TLR2, as well as the role of P. gingivalis LPS, in mediation of an inflammatory signalling cascade in the aortic endothelium warrant further investigation.

Endothelial cell receptor recognition of antigenic peptides alerts the immune system to the presence of infection or other types of danger that may be detrimental to the host. P. gingivalis fimbria are an important virulence determinant that would justifiably initiate such a response. Previous studies have reported that fimbria-mediated adhesion of P. gingivalis to host cells induces integrin-associated remodelling of the actin cytoskeleton (Yilmaz et al., 2002; 2003). Reports by Okada et al. (1998) demonstrated that alteration of the actin cytoskeleton resulted in enhancement of MCP-1 and IL-8 secretion by human endothelial cells. Here, we report that internalization of P. gingivalis by HAEC resulted in the induction of IL-1β that precedes an MCP-1 and IL-8 response by HAEC. As expected, incubation of HAEC with purified native major or minor fimbria induced expression of both MCP-1 and IL-8, yet failed to elicit IL-1β. Taken together, these observations indicate that HAEC responses to intact P. gingivalis or purified native fimbria are temporally regulated and at least partially dependent upon the context in which the antigens are presented to endothelium.

The inhibitory effect of cytochalasin D on MCP-1 and IL-8 production by HAEC, in response to invasive bacteria or incubation with either purified fimbria, suggests that internalization is necessary for the observed responses. However, in addition to its inhibition of endocytosis, cytochalasin D may also affect the processing and transport of de novo synthesized cellular proteins (Wagner et al., 2001). As induction of IL-1β was not inhibited by cytochalasin D treatment of HAEC in response to invasive P. gingivalis, it appears that the ability of P. gingivalis to induce initial IL-1β production occurs via a distinct mechanism from the secondary chemokine response. Definitive proof for endocytosis of P. gingivalis or its fimbria as an obligatory requirement for activation of the endothelium remains to be elucidated and will require further investigation.

In addition to the elevated cytokine levels in HAEC stimulated with invasive strains of P. gingivalis, we also observed increased expression of the adhesion molecules ICAM-1, VCAM-1 and E-selectin. The accumulation of blood-borne leukocytes within the inflamed aorta, in response to antigenic stimulation, is an important principal event in the atherosclerotic process (Noll, 1998). A recent publication by our laboratory demonstrated that the molecules involved in the initial process of leukocyte binding to the activated endothelium, including ICAM-1, VCAM-1 and E-selectin (Davies et al., 1993; O’Brien et al., 1993; Noll, 1998; Kerr, 1999) were upregulated in response to invasive bacterial infection as demonstrated by high-density oligonucleotide microarray analysis (Chou et al., 2005). In the present study, we also observed increased mRNA expression levels for these adhesion molecules at 6 and 24 h post infection. Additional ELISA analysis of protein levels showed a corresponding increase in ICAM-1 production by HAEC at 6 and 24 h; however, initial increases in surface expression of VCAM-1 at 6 h was followed by a subsequent decrease at 24 h. As antibody blocking studies have shown that lymphocyte adhesion was predominantly mediated by VCAM-1, and that stimulation of the endothelium resulted in reduced expression of VCAM-1 but not ICAM-1 or E-selectin (Stone et al., 2005), it is plausible that a similar downregulation of VCAM-1 occurred with P. gingivalis infection of HAEC. Alternatively, the potential of P. gingivalis protease (gingipain) degradation of VCAM-1 can not be ruled out, as protease inhibitors were not utilized in these experiments. However, the sustained increases in IL-8 production by HAEC at 24 h, which has been previously shown to be degraded by gingipains (Mikolajczyk-Pawlinska et al., 1998), makes such a course of action unlikely.

It is important to stress that the interpretation of our study is based upon the use of primary aortic endothelial cells from multiple donors. Previous reports have shown interindividual variability (Canals et al., 1996; Rice et al., 1996) and heterogeneity within the vasculature of the same organ (Antonov et al., 1986; Ghitescu and Robert, 2002) in experiments conducted utilizing primary endothelial cells. We observed some variability in the amounts of chemokine and cytokine produced in response to the various stimuli employed in this study; however, similar trends were observed in the results from all donors.

A sensitive and timely response of endothelial cells to the presence of LPS is crucial for the host response to bacterial infection. In this investigation, it was demonstrated that P. gingivalis LPS failed to directly stimulate ICAM-1, VCAM-1, E- or P-selectin expression by the endothelium. In contrast, E. coli LPS was able to induce significant expression of ICAM-1, but only weak expression of VCAM-1 and P-selectin. These findings are in partial disagreement with previous studies whose results demonstrated E. coli LPS stimulation of all three CAMs (Kapiotis et al., 1994; Darveau et al., 1995). It should be noted that these studies utilized HUVEC and, as mentioned previously, several groups have shown differences in the responsiveness and gene expression patterns between arterial and venous endothelial cells. In addition, a recent publication by Marschang et al. (2006) demonstrated that HAEC express significantly increased levels of ICAM-1, VCAM-1 and E-Selectin in response to TNF-α, while activation with post-absorptive LDL only induced surface expression of ICAM-1. Collectively, these studies and the results presented in this manuscript, suggest that endothelial cell responses may be both cell-type and/or ligand-specific and provides a plausible explanation for the failure of E. coli LPS to stimulate significant expression of E-selectin, P-selectin or VCAM-1.

Endothelial cells line the most inner layer of blood vessels maintaining a homeostatic state and establishing a uniquely protective barrier between the underlying tissues and the molecules present in the blood. A variety of vascular processes, including regulation of blood pressure, angiogenesis, formation of thrombi and fibrinolysis are continually carried out by endothelial cells (Rubanyi, 1993). Disruption of these normal functions can alter the endothelial state leading to the establishment of inflammation and a diseased endothelial state characteristic of atherosclerosis. Activation of endothelial cells by cytokines, chemokines and growth factors, likely in part mediates the host inflammatory response responsible for initiation of atherosclerosis. Although definitive proof of a casual role of infectious agents contributing to atherosclerosis is still lacking, this investigation has demonstrated that invasive P. gingivalis evoke cellular and molecular changes of aortic endothelial cells that support such a role. In addition, our results propose a mechanism by which both the major and minor fimbria of intact P. gingivalis can facilitate inflammatory responses by endothelial cells through modification of the actin cytoskeleton. Most importantly, alterations in the expression of fimbria may contribute to the ability of P. gingivalis to elicit inflammatory changes in the endothelium that predispose the site to subsequent atheroma development.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains and growth conditions

Wild-type P. gingivalis strain 381 and a major fimbria-deficient mutant (DPG3) (Malek et al., 1994), were maintained anaerobically (10% H2, 10% CO2 and 80% N2) at 37°C in brain heart infusion broth (BHI; Difco) supplemented with 0.5% of Yeast extract (Difco), 5 µg ml−1 of haemin and 1 µg ml−1 of menadione. Erythromycin 1 µg ml−1 and tetracycline 2 µg ml−1 were added according to the selection requirements of the strains. E. coli strain DH5α was grown in Luria–Bertani broth with or without ampicillin 100 µg ml−1.

Construction of P. gingivalis fimbria mutants

The DNA fragment encoding the truncated minor fimbrial gene (mfa1) was amplified by PCR from chromosomal DNA of strain 381. Prior to PCR, a primer set (Forward – 5′AGTGAGCTCG GATCAAGCTAACCCTGACTACCATTA: Reverse – 5′-AGTGG TACCTTCTTGATGCTCTTGATGTGGATATG), of which SacI and KpnI restriction sites were added to the 5′-end, was synthesized based on the DNA sequence of the minor fimbrial gene of this organism (GenBank Accession number AB16284). The truncated fragment was cloned between SacI and KpnI sites of pBluescriptII KS+ (Stratagene) and then disrupted by a blunted SacI fragment encoding the tetQ gene of pMJF3 (Feldhaus et al., 1991). The recombinant plasmid was transformed into E. coliDH5α in order to obtain an appropriate amount of DNA for subsequent transformations. The plasmids were linearized by SacI prior to transformation. Electroporation into P. gingivalis was performed using GenePulser (Bio-Rad), as described previously (Takahashi et al., 1999). After pulse impression, 1 ml of BHI medium was added to the cuvette; the transformed mixture was then transferred to a new tube and incubated anaerobically for 16 h, followed by spreading onto BHI-5% sheep blood agar plates containing tetracycline and erythromycin as required. Plates were incubated anaerobically for 2 weeks. For morphological study, bacterial strains were grown in broth, fixed, stained with uranyl acetate and observed by transmission electron microscopy (JEM1220, JOEL) operated at 20 kV as described previously (Hamada et al., 1994).

SDS-PAGE and immuno-blotting

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and immuno-blotting were carried out by the conventional method described elsewhere (Takahashi et al., 1999). For immuno-blotting, duplicate gels were transferred to PVDF membrane, blocked and probed with rabbit polyclonal antisera raised against either the 41 kDa major of 67 kDa minor fimbria of ATCC 33277 respectively (Takahashi et al., 1999). These sera cross-react with fimbria of strain 381 (data not shown). Following the washing step, blots were incubated with HRP-conjugated goat anti-rabbit IgG (Sigma) and developed with an ECL Western blotting detection kit (Amersham Biosciences).

Purification of the 41 kDa (major) and 67 kDa (minor) fimbria of P. gingivalis

Fimbria of P. gingivalis were prepared according to the method described elsewhere (Arai et al., 2000) with slight modifications. In this study, a DEAE Sepharose Fast Flow (Amersham Biosciences) column was employed instead of a DEAE Sepharose CL-6B column. The fimbrial preparations were analysed for LPS contamination through electrophoresis by loading on polyacrylamide gels and visualized with Silver Stain Plus (Bio-Rad). In addition, each fimbrial preparation was verified to be LPS free by the Limulus amebocyte lysate assay (< 0.1 endotoxin U ml−1; Cambrex). LPS of P. gingivalis strain ATCC 33277 was kindly provided by Dr Richard P. Darveau (University of Washington). Ultra pure E. coli 0111:B4 LPS (InvivoGen) and S. cerevisiae zymosan (Sigma) were utilized as controls.

Aortic endothelial cell culture

Human aortic endothelial cells from multiple donors (HAEC, Cascade Biologics) were maintained in Medium 200 supplemented with 20 µl ml−1 of Low Serum Growth Supplement (Cascade Biologics) at 37°C in 5% CO2 in tissue culture flasks. Semi-confluent HAEC were removed from flasks with trypsinization and seeded into six- or 24-well culture dishes at a cell density of 6–8 × 105 or 1.25–1.5 × 105 cells per well respectively. Confluent second to fifth-passage cells were used in all experiments.

Invasion of HAEC by P. gingivalis fimbrial mutants

Invasion of HAEC cells by P. gingivalis strains was quantified by determining the number of cfu following infection at a multiplicity of infection (moi) of 100. HAEC cells were incubated with P. gingivalis strains for 1, 2 and 6 h followed by treatment with metronidazole for killing of adherent external bacteria as previously described (Deshpande et al., 1998). For ‘enhanced rate of infection’ assays only, bacteria were centrifuged onto HAEC monolayers (350 g for 5 min) as described (Walter et al., 2004). Internalized bacterial cells from HAEC were isolated by lysis with water prior to spreading on CDC anaerobic blood agar plates (BD Diagnostic Systems). The plates were then incubated anaerobically at 37°C for 7 days, after which cfu counts of invasive P. gingivalis were determined. Invasion was expressed as the percentage of bacteria recovered from cell lysis to those of the initial inoculums. For invasion inhibition studies, HAEC were treated with cytochalasin D (1 µg ml−1) for 30 min prior to infection with P. gingivalis. Trypan blue viability staining of HAEC was performed as described previously (Singh et al., 1985). Culture supernatants collected 6 h after infections were assessed for chemokine production by HAEC using ELISA analysis. Inhibition of invasion was confirmed by plating bacterial cultures and performing cfu count. All assays were performed in triplicate.

Reverse transcriptase PCR

Total RNA from HAEC was isolated with an RNeasy kit (Qiagen) and 100 ng of RNA utilized for each RT-PCR reaction. All reactions were performed with SuperScriptTM. One-Step RT-PCR Systems (Invitrogen) using an iCycler thermal cycler (Bio-Rad), according to the manufacturer's instructions. The designs of PCR primers and reaction conditions are indicated in Table 1. The GADPH housekeeping gene was employed as a control. PCR reaction products were visualized on 2% agarose gels following ethidium bromide staining. The densities of the bands were measured for semi-quantitative analysis by using Bio-Rad quantity one 4.1.1 software. Background measurements were subtracted and a relative number was assigned to each band intensity.

Table 1.  Polymerase chain reaction (PCR) primers used for detection of gene expression.
GenePrimerSequenceAnnealing temperature (°C)PCR (cycles)
ICAM-1Forward5′-TATGGCAACGACTCCTTCT-3′5530
Reverse5′-CATTCAGCGTCACCTTGG-3′  
VCAM-1Forward5′-ATGACATGCTTGAGCCAGG-3′5530
Reverse5′-GTGTCTCCTTCTTTGACACT-3′  
E-selectinForward5′-CTCTGACAGAAGAAGCCAAG-3′5530
Reverse5′-ACTTGAGTCCACTGAAGCCA-3′  
P-selectinForward5′-TGAAGAAAAAGCACGCATTG-3′6036
Reverse5′-AGCGGCTCACACGAAATAG-3′  
MCP-1Forward5′-CAGCCAGATGCAATCAATGC-3′5530
Reverse5′-GTGGTCCATGGAATCCTGAA-3′  
IL-8Forward5′-ATGACTTCCAAGCTGGCCGTGGCT-3′6030
Reverse5′-TCTCAGCCCTCTTCAAAAACTTCTC-3′  
IL-1βForward5′-ATGGCAGAAGTACCTGAGCTCGC-3′5832
Reverse5′-TGTGTTTAACTGACCACTTCAGTCAA-3′  
GAPDHForward5′-GGTGAAGGTCGGAGTCAACGG-3′5536
Reverse5′-GGTCATGAGTCCTTCCACGAT-3′  

Flow cytometric analysis of adhesion molecule expression by HAEC

Human aortic endothelial cells were grown in six-well culture dishes. HAEC cultures were infected with P. gingivalis strains at an moi of 100 or incubated with purified native fimbria at 10 or 1 µg ml−1, P. gingivalis LPS (0.1 or 1 µg ml−1), E. coli LPS (10 or 100 ng ml−1) or S. cerevisiae zymosan (1 or 10 µg ml−1) for 1, 6 and 24 h. After dissociation with trypsin, cells were labelled with FITC-conjugated anti-human ICAM-1, VCAM-1, E/P-selectin and P-selectin mouse monoclonal antibodies or isotype control mouse IgG1 (Serotec) at a concentration of 5 µg ml−1 on ice, according to the manufacturer's directions. Following the antibody incubation with HAEC, cells were washed, suspended in PBS containing 2% FBS and analysed by flow cytometry using a FACScan flowcytometer (BD Immunocytometry Systems). A total of 10 000 events were counted for each condition. Geometric means of three independent experiments were utilized for statistical analysis.

Enzyme-linked immunosorbent assay for chemokines and cytokines

Culture supernatants for ELISA were collected at aforementioned time points, following incubation with P. gingivalis or purified native fimbria and stored in a −80°C freezer. For P. gingivalis LPS inhibition assays, HAEC were stimulated with 1 µg ml−1 of purified native major or minor fimbria, or fimbria plus (10 ng ml−1, 100 ng ml−1, or 1 µg ml−1) of P. gingivalis LPS for 6 h. Samples were then collected and analysed with ELISA kits for IL-1β, IL-8, MCP-1 and TNF-α (OptEIA, BD Biosciences) according to the manufacture's instructions.

Statistical analysis

Data are presented as arithmetic means ± standard deviations (SDs) or standard error as indicated. Statistical analyses with One-way Analysis of Variance (anova) and subsequent Tukey-Kramer Multiple Comparisons Test were performed with the use of GraphPad InStat 3.0 software (GraphPad Software, San Diego, CA). Statistical significance was assigned when the P-value was < 0.05 or < 0.001 as indicated for each figure.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

This work was supported by National Institutes of Health Grants PO1-DE-13191 and R01-DE-12517 (Dr Genco). We would like to thank Dr Nobushiro Hamada and Dr Toshio Umemoto for providing anti-fimbria antibodies and Dr Richard P. Darveau for providing P. gingivalis LPS.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Akgur, F.M., Zibari, G.B., McDonald, J.C., Granger, D.N., Brown, M.F. (2000) Kinetics of P-selectin expression in regional vascular beds after resuscitation of hemorrhagic shock: a clue to the mechanism of multiple system organ failure. Shock 13: 140144.
  • Antonov, A.S., Nikolaeva, M.A., Klueva, T.S., Romanov, Y.A., Babaev, V.R., Bystrevskaya, V.B., et al. (1986) Primary culture of endothelial cells from atherosclerotic human aorta. Part 1. Identification, morphological and ultrastructural characteristics of two endothelial cell subpopulations. Atherosclerosis 59: 119.
  • Arai, M., Hamada, N., Umemoto, T. (2000) Purification and characterization of a novel secondary fimbrial protein from Porphyromonas gingivalis strain 381. FEMS Microbiol Lett 193: 7581.
  • Arbes, S.J., Jr, Slade, G.D., Beck, J.D. (1999) Association between extent of periodontal attachment loss and self-reported history of heart attack: an analysis of NHANES III data. J Dent Res 78: 17771782.
  • Bainbridge, B.W., Darveau, R.P. (2001) Porphyromonas gingivalis lipopolysaccharide: an unusual pattern recognition receptor ligand for the innate host defense system. Acta Odontol Scand 59: 131138.
  • Beck, J., Garcia, R., Heiss, G., Vokonas, P.S., Offenbacher, S. (1996) Periodontal disease and cardiovascular disease. J Periodontol 67: 11231137.
  • Bjorkbacka, H., Kunjathoor, V.V., Moore, K.J., Koehn, S., Ordija, C.M., Lee, M.A., et al. (2004) Reduced atherosclerosis in MyD88-null mice links elevated serum cholesterol levels to activation of innate immunity signaling pathways. Nat Med 10: 416421.
  • Bonfanti, R., Furie, B.C., Furie, B., Wagner, D.D. (1989) PADGEM (GMP140) is a component of Weibel-Palade bodies of human endothelial cells. Blood 73: 11091112.
  • Boring, L., Gosling, J., Cleary, M., Charo, I.F. (1998) Decreased lesion formation in CCR2–/– mice reveals a role for chemokines in the initiation of atherosclerosis. Nature 394: 894897.
  • Burns, A.R., Bowden, R.A., Abe, Y., Walker, D.C., Simon, S.I., Entman, M.L., Smith, C.W. (1999) P-selectin mediates neutrophil adhesion to endothelial cell borders. J Leukoc Biol 65: 299306.
  • Campbell, L.A., Kuo, C.C., Grayston, J.T. (1998) Chlamydia pneumoniae and cardiovascular disease. Emerg Infect Dis 4: 571579.
  • Canals, M., Costa, J., Potau, J.M., Merindano, M.D., Pita, D., Ruano, D. (1996) Long-term cryopreservation of human donor corneas. Eur J Ophthalmol 6: 234241.
  • Charo, S., Gokce, N., Vita, J.A. (1998) Endothelial dysfunction and coronary risk reduction. J Cardiopulm Rehabil 18: 6067.
  • Chi, J.T., Chang, H.Y., Haraldsen, G., Jahnsen, F.L., Troyanskaya, O.G., Chang, D.S., et al. (2003) Endothelial cell diversity revealed by global expression profiling. Proc Natl Acad Sci USA 100: 1062310628.
  • Chi, H., Messas, E., Levine, R.A., Graves, D.T., Amar, S. (2004) Interleukin-1 receptor signaling mediates atherosclerosis associated with bacterial exposure and/or a high-fat diet in a murine apolipoprotein E heterozygote model: pharmacotherapeutic implications. Circulation 110: 16781685.
  • Chiu, B. (1999) Multiple infections in carotid atherosclerotic plaques. Am Heart J 138: S534S536.
  • Chou, H.-H., Yumoto, H., Davey, M., Takashi, Y., Miyamoto, T., Gibson, F.C., III. et al. (2005) Porphyromonas gingivalis fimbria-dependent activation of inflammatory genes in human aortic endothelial cells. Infect Immun 73: 53675378.
  • Coats, S.R., Reife, R.A., Bainbridge, B.W., Pham, T.T., Darveau, R.P. (2003) Porphyromonas gingivalis lipopolysaccharide antagonizes Escherichia coli lipopolysaccharide at Toll-like receptor 4 in human endothelial cells. Infect Immun 71: 67996807.
  • Collins, T., Read, M.A., Neish, A.S., Whitley, M.Z., Thanos, D., Maniatis, T. (1995) Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J 9: 899909.
  • Darveau, R.P., Cunningham, M.D., Bailey, T., Seachord, C., Ratcliffe, K., Bainbridge, B., et al. (1995) Ability of bacteria associated with chronic inflammatory disease to stimulate E-selectin expression and promote neutrophil adhesion. Infect Immun 63: 13111317.
  • Darveau, R.P., Pham, T.T., Lemley, K., Reife, R.A., Bainbridge, B.W., Coats, S.R., et al. (2004) Porphyromonas gingivalis lipopolysaccharide contains multiple lipid A species that functionally interact with both Toll-like receptors 2 and 4. Infect Immun 72: 50415051.
  • Davies, M.J., Gordon, J.L., Gearing, A.J., Pigott, R., Woolf, N., Katz, D., Kyriakopoulos, A. (1993) The expression of the adhesion molecules ICAM-1, VCAM-1, PECAM, and E-selectin in human atherosclerosis. J Pathol 171: 223229.
  • Dechend, R., Maass, M., Gieffers, J., Dietz, R., Scheidereit, C., Leutz, A., Gulba, D.C. (1999) Chlamydia pneumoniae infection of vascular smooth muscle and endothelial cells activates NF-kappaB and induces tissue factor and PAI-1 expression: a potential link to accelerated arteriosclerosis. Circulation 100: 13691373.
  • DeGraba, T.J., Siren, A.L., Penix, L., McCarron, R.M., Hargraves, R., Sood, S., et al. (1998) Increased endothelial expression of intercellular adhesion molecule-1 in symptomatic versus asymptomatic human carotid atherosclerotic plaque. Stroke 29: 14051410.
  • Deshpande, R.G., Khan, M.B., Genco C.A. (1998) Invasion of aortic and heart endothelial cells by Porphyromonas gingivalis. Infect Immun 66: 53375343.
  • Dittrich, R., Dragonas, C., Mueller, A., Maltaris, T., Rupp, J., Beckmann, M.W., Maass, M. (2004) Endothelial Chlamydia pneumoniae infection promotes oxidation of LDL. Biochem Biophys Res Commun 319: 501505.
  • Dorn, B.R., Dunn, W.A., Progulske-Fox, A. (1999) Invasion of human coronary artery cells by periodontal pathogens. Infect Immun 67: 57925798.
  • Dorn, B.R., Burks, J.N., Seifert, K.N., Progulske-Fox, A. (2000) Invasion of endothelial and epithelial cells by strains of Porphyromonas gingivalis. FEMS Microbiol Lett 2000: 139144.
  • Dunzendorfer, S., Lee, H.K., Soldau, K., Tobias, P.S. (2004) Toll-like receptor 4 functions intracellularly in human coronary artery endothelial cells: roles of LBP and sCD14 in mediating LPS responses. FASEB J 18: 11171119.
  • Faure, E., Thomas, L., Xu, H., Medvedev, A., Equils, O., Arditi, M. (2001) Bacterial lipopolysaccharide and IFN-gamma induce Toll-like receptor 2 and Toll-like receptor 4 expression in human endothelial cells: role of NF-kappa B activation. J Immunol 166: 20182024.
  • Feldhaus, M.J., Hwa, V., Cheng, Q., Salyers, A.A. (1991) Use of an Escherichia coli beta-glucuronidase gene as a reporter gene for investigation of Bacteroides promoters. J Bacteriol 173: 45404543.
  • Fryer, R.H., Schwobe, E.P., Woods, M.L., Rodgers, G.M. (1997) Chlamydia species infect human vascular endothelial cells and induce procoagulant activity. J Invest Med 45: 168174.
  • Gaydos, C.A. (2000) Growth in vascular cells and cytokine production by Chlamydia pneumoniae. J Infect Dis 181 (Suppl. 3): S473S478.
  • Gaydos, C.A., Summersgill, J.T., Sahney, N.N., Ramirez, J.A., Quinn, T.C. (1996) Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells. Infect Immun 64: 16141620.
  • Ghitescu, L., Robert, M. (2002) Diversity in unity: the biochemical composition of the endothelial cell surface varies between the vascular beds. Microsc Res Techn 57: 381389.
  • Gibson, F.C., III, Hong, C., Chou, H.-H., Yumoto, H., Chen, J., Lien, E., et al. (2004) Innate immune recognition of invasive bacteria accelerates atherosclerosis in apolipoprotein E-deficient mice. Circulation 109: 28012806.
  • Glurich, I., Grossi, S., Albini, B., Ho, A., Shah, R., Zeid, M., et al. (2002) Systemic inflammation in cardiovascular and periodontal disease: comparative study. Clin Diagn Lab Immunol 9: 425432.
  • Graves, D.T., Naguib, G., Lu, H., Desta, T., Amar, S. (2005) Porphyromonas gingivalis fimbriae are pro-inflammatory but do not play a prominent role in the innate immune response to P. gingivalis. J Endotoxin Res 11: 1318.
  • Gu, L., Okada, Y., Clinton, S.K., Gerard, C., Sukhova, G.K., Libby, P., Rollins, B.J. (1998) Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell 2: 275281.
  • Hajishengallis, G., Martin, M., Sojar, H.T., Sharma, A., Schifferle, R.E., DeNardin, E., et al. (2002a) Dependence of bacterial protein adhesins on Toll-like receptors for proinflammatory cytokine induction. Clin Diagn Lab Immunol 9: 403411.
  • Hajishengallis, G., Martin, M., Schifferle, R.E., Genco, R.J. (2002b) Counteracting interactions between lipopolysaccharide molecules with differential activation of Toll-like receptors. Infect Immun 70: 66586664.
  • Hajishengallis, G., Sojar, H., Genco, R.J., DeNardin, E. (2004) Intracellular signaling and cytokine induction upon interactions of Porphyromonas gingivalis fimbriae with pattern-recognition receptors. Immunol Invest 33: 157172.
  • Hamada, N., Watanabe, K., Sasakawa, C., Yoshikawa, M., Yoshimura, F., Umemoto, T. (1994) Construction and characterization of a fimA mutant of Porphyromonas gingivalis. Infect Immun 62: 16961704.
  • Haraszthy, V.I., Zambon, J.J., Trevisan, M., Zeid, M., Genco, R.J. (2000) Identification of periodontal pathogens in atheromatous plaques. J Periodont 71: 15541560.
  • Hattori, R., Hamilton, K.K., Fugate, R.D., McEver, R.P., Sims, P.J. (1989a) Stimulated secretion of endothelial von Willebrand factor is accompanied by rapid redistribution to the cell surface of the intracellular granule membrane protein GMP-140. J Biol Chem 264: 77687771.
  • Hattori, R., Hamilton, K.K., McEver, R.P., Sims, P.J. (1989b) Complement proteins C5b-9 induce secretion of high molecular weight multimers of endothelial von Willebrand factor and translocation of granule membrane protein GMP-140 to the cell surface. J Biol Chem 264: 90539060.
  • Hiramine, H., Watanabe, K., Hamada, N., Umemoto, T. (2003) Porphyromonas gingivalis 67-kDa fimbriae induced cytokine production and osteoclast differentiation utilizing TLR2. FEMS Microbiol Lett 229: 4955.
  • Hirschfeld, M., Weis, J.J., Toshchakov, V., Salkowski, C.A., Cody, M.J., Ward, D.C., et al. (2001) Signaling by Toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect Immun 69: 14771482.
  • Jackson, L.A., Campbell, L.A., Kuo, C.C., Rodriguez, D.I., Lee, A., Grayston, J.T. (1997) Isolation of Chlamydia pneumoniae from a carotid endarterectomy specimen. J Infect Dis 176: 292295.
  • Johnson-Tidey, R.R., McGregor, J.L., Taylor, P.R., Poston, R.N. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol 144: 952961.
  • Jones, D.A., Abbassi, O., McIntire, L.V., McEver, R.P., Smith, C.W. (1993) P-selectin mediates neutrophil rolling on histamine-stimulated endothelial cells. Biophys J 65: 15601569.
  • Kanwar, S., Bullard, D.C., Hickey, M.J., Smith, C.W., Beaudet, A.L., Wolitzky, B.A., Kubes, P. (1997) The association between alpha4-integrin, P-selectin, and E-selectin in an allergic model of inflammation. J Exp Med 185: 10771087.
  • Kapiotis, S., Quehenberger, P., Sengoelge, G., Partan, C., Eher, R., Strobl, H., et al. (1994) Modulation of pyrogen-induced upregulation of endothelial cell adhesion molecules (CAMs) by interleukin-4: transcriptional mechanisms and CAM-shedding. Circ Shock 43: 1825.
  • Kaukoranta-Tolvanen, S.S., Ronni, T., Leinonen, M., Saikku, P., Laitinen, K. (1996) Expression of adhesion molecules on endothelial cells stimulated by Chlamydia pneumoniae. Microb Pathog 21: 407411.
  • Kerr, J.R. (1999) Cell adhesion molecules in the pathogenesis of and host defense against microbial infection. J Clin Pathol Mol Pathol 52: 220230.
  • Khlgatian, M., Nassar, H., Chou, H.-H., Gibson, F.C., Genco, C.A. (2002) Fimbria-dependent activation of cell adhesion molecule expression in Porphyromonas gingivalis-infected endothelial cells. Infect Immun 70: 257267.
  • Kolltveit, K.M., Eriksen, H.M. (2001) Is the observed association between periodontitis and atherosclerosis causal? Eur J Oral Sci 109: 27.
  • Krull, M., Klucken, A.C., Wuppermann, F.N., Fuhrmann, O., Magerl, C., Seybold, J., et al. (1999) Signal transduction pathways activated in endothelial cells following infection with Chlamydia pneumoniae. J Immunol 162: 48344841.
  • Kuo, C.C., Shor, A., Campbell, L.A., Fukushi, H., Patton, D.L., Grayston, J.T. (1993) Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries. J Infect Dis 167: 841849.
  • Lamont, R.J., Jenkinson, H.F. (1988) Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 62: 12441263.
  • Lamont, R.J., Chan, A., Belton, C.M., Izutsu, K.T., Vasel, D., Weinberg, A. (1995) Porphyromonas gingivalis invasion of gingival epithelial cells. Infect Immun 63: 38783885.
  • Loesche, W.J., Schork, A., Terpenning, M.S., Chen, Y.M., Dominguez, B.L., Grossman, N. (1998) Assessing the relationship between dental disease and coronary heart disease in elderly U.S. veterans. J Am Dent Assoc 129: 301311.
  • Loos, B.G., Craandijk, J., Hoek, F.J., Wertheim-van Dillen, P.M., Van Der Velden, U. (2000) Elevation of systemic markers related to cardiovascular diseases in the peripheral blood of periodontitis patients. J Periodontol 71: 15281534.
  • McEver, R.P., Beckstead, J.H., Moore, K.L., Marshall-Carlson, L., Bainton, D.F. (1989) GMP-140, a platelet alpha-granule membrane protein, is also synthesized by vascular endothelial cells and is localized in Weibel-Palade bodies. J Clin Invest 84: 9299.
  • Malek, R., Fisher, A., Caleca, M., Stinson, C., Van Oss, J., Lee, J.-Y., et al. (1994) Inactivation of the Porphyromonas gingivalis fimA gene blocks periodontal damage in gnotobiotic rats. J Bacteriol 176: 10521059.
  • Marschang, P., Gotsch, C., Kirchmair, R., Kaser, S., Kahler, C.M., Patsch, J.R. (2006) Postprandial, but not postabsorptive low-density lipoproteins increase the expression of intercellular adhesion molecule-1 in human aortic endothelial cells. Atherosclerosis (in press).
  • Martin, M., Katz, J., Vogel, S.N., Michalek, S.M. (2001) Differential induction of endotoxin tolerance by lipopolysaccharides derived from Porphyromonas gingivalis and Escherichia coli. J Immunol 167: 52785285.
  • Mayadas, T.N., Johnson, R.C., Rayburn, H., Hynes, R.O., Wagner, D.D. (1993) Leukocyte rolling and extravasation are severely compromised in P selectin-deficient mice. Cell 74: 541554.
  • Michelsen, K.S., Wong, M.H., Shah, P.K., Zhang, W., Yano, J., Doherty, T.M., et al. (2004) Lack of Toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein E. Proc Natl Acad Sci USA 101: 1067910684.
  • Mikolajczyk-Pawlinska, J., Travis, J., Potempa, J. (1998) Modulation of interleukin-8 activity by gingipains from Porphyromonas gingivalis: implications for pathogenicity of periodontal disease. FEBS Lett 440: 282286.
  • Moazed, T.C., Campbell, L.A., Rosenfeld, M.E., Grayston, J.T., Kuo, C.C. (1999) Chlamydia pneumoniae infection accelerates the progression of atherosclerosis in apolipoprotein E-deficient mice. J Infect Dis 180: 238241.
  • Molestina, R.E., Dean, D., Miller, R.D., Ramirez, J.A., Summersgill, J.T. (1998) Characterization of a strain of Chlamydia pneumoniae isolated from a coronary atheroma by analysis of the omp1 gene and biological activity in human endothelial cells. Infect Immun 66: 13701376.
  • Nageh, M.F., Sandberg, E.T., Marotti, K.R., Lin, A.H., Melchior, E.P., Bullard, D.C., Beaudet, A.L. (1997) Deficiency of inflammatory cell adhesion molecules protects against atherosclerosis in mice. Arterioscler Thromb Vasc Biol 17: 15171520.
  • Nakagawa, I., Amano, A., Kuboniwa, M., Nakamura, T., Kawabata, S., Hamada, S. (2002) Functional differences among FimA variants of Porphyromonas gingivalis and their effects on adhesion to and invasion of human epithelial cells. Infect Immun 70: 277285.
  • Nassar, H., Chou, H.-H., Khlgatian, M., Gibson, F.C., Van Dyke, T.E., Genco, C.A. (2002) Role for fimbriae and lysine-specific cysteine proteinase gingipain K in expression of interleukin-8 and monocyte chemoattractant protein in Porphyromonas gingivalis-infected endothelial cells. Infect Immun 70: 268276.
  • Njoroge, T.G.R.J., Sojar, H.T., Hamada, N., Genco, C.A. (1997) A role of fimbriae in Porphyromonas gingivalis invasion of oral epithelial cells. Infect Immun 65: 19801984.
  • Noll, G. (1998) Pathogenesis of atherosclerosis: a possible relation to infection. Atherosclerosis 140 (Suppl. 1): S3S9.
  • Nolte, D., Schmid, P., Jager, U., Botzlar, A., Roesken, F., Hecht, R., et al. (1994) Leukocyte rolling in venules of striated muscle and skin is mediated by P-selectin, not by 1-selectin. Am J Physiol 267: H1637H1642.
  • O'Brien, K.D., Allen, M.D., McDonald, T.O., Chait, A., Harlan, J.M., Fishbein, D., et al. (1993) Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques. Implications for the mode of progression of advanced coronary atherosclerosis. J Clin Invest 92: 945951.
  • O'Brien, K.D., McDonald, T.O., Chait, A., Allen, M.D., Alpers, C.E. (1996) Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation 93: 672682.
  • Ogawa, T.O.H., Uchida, H., Hamada, S. (1994) Humoral and cellular immune responses to the fimbriae of Porphyromonas gingivalis and their synthetic peptides. J Med Microbiol 40: 397402.
  • Okada, M., Matsumori, A., Ono, K., Furukawa, Y., Shioi, T., Iwasaki, A., et al. (1998) Cyclic stretch upregulates production of interleukin-8 and monocyte chemotactic and activating factor/monocyte chemoattractant protein-1 in human endothelial cells. Arterioscler Thromb Vasc Biol 18: 894901.
  • Rice, J.W., Davis, J.E., Crowl, R.M., Johnston, P.A. (1996) Development of a high volume screen to identify inhibitors of endothelial cell activation. Anal Biochem 241: 254259.
  • Ross, R. (1999) Atherosclerosis-an inflammatory disease. N Engl J Med 340: 115126.
  • Rubanyi, G.M. (1993) The role of endothelium in cardiovascular homeostasis and diseases. J Cardiovasc Pharmacol 22 (Suppl. 4): S1S14.
  • Saito, A., Sojar, H.T., Genco, R.J. (1996) Porphyromonas gingivalis surface components induce interleukin-1 release and tyrosine phosphorylation in macrophages. FEMS Immunol Med Microbiol 15: 5157.
  • Singh, G., Bohnke, M., Von-Domarus, D., Draeger, J., Lindstrom, R.L., Doughman, D.J. (1985) Vital staining of corneal endothelium. Cornea 4: 8091.
  • Smith, C.W. (1993) Leukocyte–endothelial cell interactions. Semin Hematol 30: 4553; Discussion: 45–54.
  • Stone, P.C., Lally, F., Rahman, M., Smith, E., Buckley, C.D., Nash, G.B., Rainger, G.E. (2005) Transmigrated neutrophils down-regulate the expression of VCAM-1 on endothelial cells and inhibit the adhesion of flowing lymphocytes. J Leukoc Biol 77: 4451.
  • Summersgill, J.T., Molestina, R.E., Miller, R.D., Ramirez, J.A. (2000) Interactions of Chlamydia pneumoniae with human endothelial cells. J Infect Dis 181 (Suppl. 3): S479S482.
  • Tabeta, K., Yamazaki, K., Akashi, S., Miyake, K., Kumada, H., Umemoto, T., Yoshie, H. (2000) Toll-like receptors confer responsiveness to lipopolysaccharide from Porphyromonas gingivalis in human gingival fibroblasts. Infect Immun 68: 37313735.
  • Takahashi, Y., Kato, D., Hamada, N., Yoshimoto, H., Umemoto, T. (1999) Transformation and expression of a cloned fimA gene in Porphyromonas gingivalis. Infect Immun 67: 20132018.
  • Takano, M., Meneshian, A., Sheikh, E., Yamakawa, Y., Wilkins, K.B., Hopkins, E.A., Bulkley, G.B. (2002) Rapid upregulation of endothelial P-selectin expression via reactive oxygen species generation. Am J Physiol Heart Circ Physiol 283: H2054H2061.
  • Visser, M.R., Tracy, P.B., Vercellotti, G.M., Goodman, J.L., White, J.G., Jacob, H.S. (1988) Enhanced thrombin generation and platelet binding on herpes simplex virus-infected endothelium. Proc Natl Acad Sci USA 85: 82278230.
  • Wagner, O., Schuler, H., Hofmann, P., Langer, D., Dancker, P., Bereiter-Hahn, J. (2001) Sound attenuation of polymerizing actin reflects supramolecular structures: viscoelastic properties of actin gels modified by cytochalasin D, profilin and alpha-actinin. Biochem J 355: 771778.
  • Walter, C., Zahlten, J., Schmeck, B., Schaudinn, C., Hippenstiel, S., Frisch, E., et al. (2004) Porphyromonas gingivalis strain-dependent activation of human endothelial cells. Infect Immun 72: 59105918.
  • Weibel, E.R., Palade, G.E. (1964) New cytoplasmic components in arterial endothelia. J Cell Biol 23: 101112.
  • Yilmaz, O., Watanabe, K., Lamont, R.J. (2002) Involvement of integrins in fimbriae-mediated binding and invasion by Porphyromonas gingivalis. Cell Microbiol 4: 305314.
  • Yilmaz, O., Young, P.A., Lamont, R.J., Kenny, G.E. (2003) Gingival epithelial cell signalling and cytoskeletal responses to Porphyromonas gingivalis invasion. Microbiology 149: 24172426.
  • Zeuke, S., Ulmer, A.J., Kusumoto, S., Katus, H.A., Heine, H. (2002) TLR4-mediated inflammatory activation of human coronary artery endothelial cells by LPS. Cardiovasc Res 56: 126134.