SEARCH

SEARCH BY CITATION

Keywords:

  • hydrogen sulphide;
  • ischaemia–reperfusion injury;
  • renal transplantation;
  • organ preservation;
  • graft function;
  • survival

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

What's known on the subject? and What does the study add?

Hydrogen sulphide (H2S) has recently been classified as a member of the family of small gaseous molecules called gasotransmitters and has been found to have many important physiological functions. Several recent studies have elucidated the protective effects of H2S in many models of tissue ischaemia–reperfusion injury (IRI), including hepatic, myocardial, pulmonary, cerebral and renal IRI. It has previously been shown that H2S has a number of properties that may contribute to its protection against IRI, including vasodilatory, anti-apoptotic, anti-inflammatory and anti-oxidant effects, although the specific actions appear to vary between tissues.

The few studies investigating the effects of H2S against renal IRI have only involved clamping of the renal pedicle to induce warm IRI. This study investigated the protective effects of H2S in the context of renal transplantation (RTx), which generally involves a more severe period of prolonged cold IRI. A previous study investigated the actions of H2S in RTx, but it was performed ex vivo and did not involve actual transplantation of donor kidneys. To our knowledge, this is the first study using a clinically relevant model of RTx to show that treatment of donor kidneys with H2S during preservation is protective against prolonged cold IRI. These findings suggest that H2S has potential utility in improving clinical organ preservation techniques and increasing the overall success of organ transplantation.

OBJECTIVE

  • • 
    To characterize the effects of hydrogen sulphide (H2S), an endogenously produced molecule recently described to have protective effects against warm ischaemic tissue injury, in mitigating transplantation-associated prolonged cold ischaemia–reperfusion injury (IRI) in a clinically applicable in vivo model of renal transplantation (RTx).

MATERIALS AND METHODS

  • • 
    After undergoing bilateral native nephrectomy, Lewis rats underwent RTx with kidneys that were flushed with either cold (4 °C) standard University of Wisconsin preservation solution (UW) or cold UW + 150 µM NaHS (H2S) solution and stored for 24 h at 4 °C in the same solution.
  • • 
    Recipient rats were monitored for a 14-day time course using metabolic cages to assess various characteristics of renal graft function.
  • • 
    Renal grafts were removed at time of death or after the rats were killed for histological, immunohistochemical and quantitative PCR analysis.

RESULTS

  • • 
    H2S-treated rats exhibited immediate and significant (P < 0.05) decreases in serum creatinine levels, increased urine output and increased survival compared with UW-treated rats.
  • • 
    H2S-treated grafts showed significantly reduced glomerular and tubular necrosis and apoptosis, diminished graft neutrophil and macrophage infiltrates and a trend towards improved inflammatory and anti-apoptotic cytokine profiles.

CONCLUSION

  • • 
    Our results provide the first evidence that supplemental H2S can mitigate renal graft IRI incurred during transplantation and prolonged cold storage, improving early graft function and recipient survival in a clinically applicable model of RTx.

Abbreviations
H2S

hydrogen sulphide

IRI

ischaemia–reperfusion injury

RTx

renal transplantation

ATN

acute tubular necrosis

DCD

donor after cardiac death

ECD

expanded criteria donor

NO

nitric oxide

CO

carbon monoxide

IVC

inferior vena cava

MPO

myeloperoxidase

IFN

interferon

ICAM-1

intracellular adhesion molecule-1

BID

BH3 interacting domain

ERK-1

extracellular signal kinase-1

HPRT-1

hypoxanthine-guanine phosphoribosyltransferase-1

HLA

human leukocyte antigen.

INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

Ischaemia–reperfusion injury (IRI) has a significant impact on both early and long-term graft function and survival, and is unavoidable in the peri-transplant period. Cold renal graft ischaemia has been linked to acute tubular necrosis (ATN) and significant glomerular injury, whereas warm reperfusion is associated with induction of inflammatory mediators and reactive oxygen species [1–4], which further accentuate tissue damage. With more transplant centres accepting and using grafts near the limits of cold ischaemic times to accommodate their expanding waiting lists, delayed graft function and decreased long-term graft survival are becoming more prevalent [5,6]. Moreover, the growing disparity between the number of patients on the renal transplantation (RTx) waiting list has led to an increase in the use of organs procured from donors after cardiac death (DCDs) as well as from expanded criteria donors (ECDs) [7]. These ‘marginal’ donor organs are more susceptible to IRI compared with standard criteria organs [8,9]. Recent data from ECD kidneys show 10-year graft and patient survival rates of 29 and 47%, compared with 46 and 64% for non-ECD kidneys, respectively [7]. Given that ECD, DCD and ECD-DCD kidneys currently make up ∼ 30% of all kidney transplants performed in the USA [7], minimizing the degree of IRI-induced cellular damage during cold storage is of critical importance in improving transplant outcomes.

Recently, treatment of ischaemic tissues with gasotransmitters has become a promising avenue for minimizing IRI. Gasotransmitters are a relatively newly classified family of small gaseous molecules that, while initially thought to produce only toxic effects, have been found to be endogenously produced and possess many important physiological properties. Nitric oxide (NO) and carbon monoxide (CO) had been the two prominent members of this family of molecules, until the recent inclusion of hydrogen sulphide (H2S). While gasotransmitters have separate distinct physiological functions, all family members generally exhibit cellular signalling and vasodilatory and anti-inflammatory properties at low concentrations, as well as the ability to decrease cellular respiration via interactions with cytochrome c oxidase and other mitochondrial enzymes [10]. These key properties generated the notion that gasotransmitters may be effective in limiting cellular and tissue damage by IRI. NO is the best studied gasotransmitter and has been found to be cytoprotective in various models of tissue IRI, including myocardium [11], intestine [12,13] and liver [14]. In addition, CO has been shown to be cytoprotective in models of cold intestinal IRI and myocardial transplantation and RTx [15–18].

Hydrogen sulphide has long been known for its unsavoury smell and toxic effects at high concentrations; however, it has been noted that H2S levels are elevated in hibernating animals and high levels of exogenously administered H2S can induce a hibernation-like state of suspended animation in non-hibernating animals [19], raising the idea that H2S also has beneficial endogenous roles. Indeed, H2S has recently been shown to be produced endogenously at low concentrations in humans and other rats and has been implicated in many important physiological functions, e.g. cellular signalling [20,21]. Similar to the other gasotransmitters, exogenous H2S has been observed to be cytoprotective in models of myocardial [22], cerebral [23], lung [24] and hepatic [25] IRI. While H2S has been shown to be protective against warm renal IRI [26], the effects of H2S in mitigating prolonged cold renal IRI have not yet been characterized in an in vivo model of RTx.

The present study uses an in vivo model of RTx to show that supplementation of standard organ preservation solution with exogenous H2S is protective against renal graft IRI, even at prolonged periods of cold storage, leading to increased early graft function, and improved renal tubular function and overall survival. This protection appears to be mediated via the anti-inflammatory and anti-apoptotic actions of H2S. The results of the present study suggest that the administration of exogenous H2S during organ storage may have significant clinical applicability and provide a protective benefit in reducing IRI in transplanted kidneys to potentially improve both short- and long-term graft and patient survival.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

EXPERIMENTAL RATS

Male Lewis rats were purchased from Charles River Canada and used at 225–250 g (n = 18). Rats were maintained in the Animal Care and Veterinary Services facility at the University of Western Ontario (London, ON) under standard conditions. All housing conditions and surgical protocols were approved by the University Council on Animal Care and Animal Use Subcommittee at the University of Western Ontario.

SURGICAL PROCEDURE AND POSTOPERATIVE MONITORING OF RATS

Syngeneic Lewis rats were transplanted to eliminate any confounding effects of immunosuppression. Rats were anaesthetized with isofluorane and using aseptic techniques, kidneys were exposed through a midline incision. Donor kidneys were obtained as per the following: the descending aorta was exposed and cannulated with a 28-G Angiocath Becton-Dickinson, the inferior vena cava (IVC) and aorta were clamped above the renal hilum and the descending IVC was cut at the pelvic bifurcation level. By convention, left kidneys were always used for donation. The donor kidneys were then flushed through the cannula with 25 mL of either cold (4 °C) standard University of Wisconsin (UW) preservation solution (UW group, n = 6) or cold UW plus H2S donor molecule (150 µM NaHS [Sigma, St Louis, MO, USA]) solution (H2S group, n = 8) until effluent from the cut portion of the IVC was clear, then placed in 50 mL of the same perfusion solution and stored at 4 °C for 24 h. Sham-operated rats, where only a midline incision was made, were also followed to establish a baseline for the measured variables (n = 4). A 24-h cold storage period was chosen as this has previously been shown to result in massive ATN, apoptosis and inflammation that lead to graft loss and only 5% survival at 3 days in rats treated with UW solution alone [17]. Our aim was to assess the possibility that H2S treatment could improve the function and survival of donor kidneys after extreme cold storage in a survival model where the recipient rat was entirely dependent upon the transplanted graft for renal function. After undergoing bilateral nephrectomy, recipient rats underwent RTx with donor kidneys removed from cold storage and transplanted orthotopically into the left renal fossa using 10-0 prolene suture as previously described [27]. After RTx, rats were monitored in metabolic cages to assess urine output, water intake, and urine and serum creatinine concentrations until time of death or until 14 days had passed. At various time points (1–3 days, 4–6 days, 7–9 days, 10–12 days and 13–14 days) rats were removed from their metabolic cages and the previous 24-h worth of water intake and urine output were measured and collected for analysis of urine physiology and GFR calculations. During this time, 200 µL of blood was taken from the tail vein of the rat, spun at 16 000g for 5 min to separate the serum and stored at −20 °C until analysed for creatinine concentration. The length of surgery for the recipient (including nephrectomy and kidney transplantation) was ∼2–3 h. There was no difference in operating times between the UW and H2S treatment groups. At the time of death/killing, all anastomoses were checked for any surgical complications that may have resulted in variations in the results: none were found.

CREATININE AND URINE ASSAYS

Creatinine concentrations of serum obtained from RTx and Sham-operated rats were determined using the Creatinine-S system (Genzyme Diagnostics, Mississauga, Canada) in conjunction with a DU® 800 spectrophotometer (Beckman Coulter, Mississauga, Canada). Experimental creatinine concentrations were determined using a standard curve method. Urine samples were analysed at the London Health Sciences Center (London, ON, Canada). Urine protein and creatinine levels were determined using the turbidimetric and enzymatic methods, respectively, performed on the Roche Modular P instrument (Roche Diagnostics, Laval, QC, Canada). GFR (mL/min) was calculated using the formula (UxV/Px), where Ux= Urine (creatinine), V = Volume of urine, and Px= Plasma (creatinine), and finally dividing by 1440 (number of min in 24 h).

HISTOLOGICAL STAINING

Renal grafts were removed from UW-treated rats at time of death (postoperative days 3–5) and H2S-treated rats were either killed between days 3 and 5 or on day 14. Half of the sagitally bivalved kidney was then placed in formalin for paraffin embedding and sectioning, while the other half was flash-frozen in liquid nitrogen and stored at −80 °C for subsequent quantitative PCR (qPCR) analysis. Histological sections were stained with haematoxylin and eosin to assess the degree of glomerular and renal tubular necrosis. Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay was used to assess the degree of apoptosis present in renal allograft sections. Sections were scored on a scale of 0–2 for necrosis and apoptosis as follows: 0, normal; 0.5, minimum necrosis/apoptosis; 1, mild necrosis/apoptosis; 1.5, moderate necrosis/apoptosis; and 2, marked necrosis/apoptosis, by a blinded transplant pathologist. Histological sections also underwent immunohistochemical staining, with n = 5 for each treatment group. Sections were incubated with antibodies against neutrophil-specific enzyme myeloperoxidase (MPO), macrophage surface marker CD68 and T-cell surface marker CD3 (Abcam®, Toronto, Canada) and visualized with secondary antibodies and DAB substrate chromogen using the Dako Envision System (Dako, Glostrup, Denmark) as per manufacturer protocol.

QUANTITATIVE PCR ANALYSIS

Homogenized renal graft tissue was analysed using qPCR, with n = 5 for each treatment group. Samples from three rats per treatment group were analysed in triplicate to determine the relative expression levels of pro-inflammatory genes interferon (IFN)-γ, TNF-α and intracellular adhesion molecule-1 (ICAM-1), pro-apoptotic gene BH3 interacting domain (BID) and anti-apoptotic gene extracellular signal kinase-1 (ERK-1). The target gene signals were normalized against the hypoxanthine-guanine phosphoribosyltransferase-1 (HPRT-1) (Table 1). Renal graft tissue stored at −80 °C was thawed immediately before use and homogenized with a mechanical homogenizer. Total RNA was isolated from homogenized tissue using TriZOL® (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using Super Script II® Reverse Transcriptase (Invitrogen) in conjunction with Oligo(dT)12–18 primers as per manufacturer protocol. Isolated RNA and cDNA were analysed via nanodrop before use, with A260/280 ratings consistently >1.95 and >1.8, respectively. The reaction mixture of each qPCR sample had a volume of 20 µL and was composed as per SYBR® Green PCR Master Mix (Quanta Biosciences, Gaithersburg, MD, USA) protocol. All qPCR assays were performed and analyzed using StepOnePlusTM Real-Time PCR thermal cycler and software package (Applied Biosystems, Foster City, CA, USA).

Table 1. List of qPCR primer sequences
PrimerSequence (5′[RIGHTWARDS ARROW] 3′)
IFN-γ ForwardAGTTCGAGGTGAACAACCCACAG
IFN-γ ReverseATCAGCACCGACTCCTTTTCCG
TNF-α ForwardTTCGGGGTGATCGGTCCCAAC
TNF-α ReverseTGGTGGTTTGCTACGACGTGG
ICAM-1 ForwardACTGTGTATTCGTTCCCAGAGCG
ICAM-1 ReverseTCATTCCCACGGAGCAGCAC
BID ForwardTGTCGGTCGGCAAACCTCTG
BID ReverseGCCATTGCTGACCTCAGAGTCC
ERK-1 ForwardTACGGCATGGTCAGCTCAGC
ERK-1 ReverseTCTCATGGCGGAATCCGAGC
HPRT-1 ForwardCCCTCAGTCCCAGCGTCGTGATTA
HPRT-1 ReverseCCCCTTCAGCACACAGAGGGC

STATISTICAL ANALYSIS

Survival data were analysed using Kaplan–Meier survival analysis and all other data were analysed using anova, performed using the GraphPad Prism statistical software package, version 3.0 (GraphPad Software Inc. 1994–1999). Statistical significance was accepted at the 95% CI. All values represented in figures and tables are mean (sd).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

After RTx, we observed a significant increase in recipient survival rates in the H2S-treated group compared with the UW-treated group (P = 0.0003). While no rats in the UW group survived past day 5 (all but one died on post-transplant day 3), the H2S-treated group exhibited nearly 80% survival after 14 days (Fig. 1).

image

Figure 1. H2S improves survival of renal transplant recipients after prolonged cold storage of renal grafts. Survival rates of renal transplant recipients receiving donor kidneys perfused and stored in UW solution only (UW: red dashed line) or UW solution plus 150 µM NaHS (H2S: green line) as well as sham-operated rats (Sham: blue dashed line). UW (n = 6), H2S (n = 8), Sham (n = 4). ***P < 0.001 vs UW.

Download figure to PowerPoint

Immediately after RTx, serum creatinine levels in the UW group were significantly higher (501.9 µmol/L) vs Sham-operated rats (57.5 µmol/L, P < 0.05) (Fig. 2). UW-treated rats died in an anuric state with increasing creatinine, whereas H2S-treated rats showed a marked decreased in serum creatinine levels, from 333.8 µmol/L towards baseline (Sham-operated rats), by the second collection period and remained there until sacrifice. Notably, one UW-treated rat survived until day 5, whereupon its serum creatinine was measured to be 353.6 mg/dL. One H2S-treated rat was maintained to establish long-term survival (creatinine 106.1 µmol/L at day 60).

image

Figure 2. H2S improves renal graft function after prolonged cold storage of renal grafts. Serum creatinine levels of renal transplant recipients after receiving donor kidneys perfused and stored in UW solution only (UW: green squares) or UW solution plus 150 µM NaHS (H2S; green circles) as well as sham-operated rats (Sham: red triangles). Note: one control rat survived until day 5 and serum creatinine was measured at 4 mg/dL. Values are mean (sd). *P < 0.05 vs Sham days 1–3. **P < 0.05 vs H2S days 1–3.

Download figure to PowerPoint

H2S-treated rats experienced significant diuresis (P < 0.05) during the first two collection periods (29.9 mL/24 h and 15.8 mL/24 h, respectively) compared with Sham-operated rats (5.3 mL/24 h and 3.5 mL/24 h, respectively) (Fig. 3). Urine [Na+] and [K+] levels of H2S-treated rats were significantly lower (32.9 mmol/L and 79.3 mmol/L, respectively) than those of Sham-operated rats (163.0 mmol/L and 371.3 mmol/L, respectively) during the first collection period (P < 0.05) but increased toward Sham-operated rat levels during the later collection periods (Table 2). Urinary protein levels and GFR were not significantly different between the H2S-treated and Sham-operated groups.

image

Figure 3. H2S supplementation induces diuresis after renal transplantation. Urine output levels of renal transplant recipients after receiving donor kidneys perfused and stored in UW solution plus 150 µM NaHS (H2S: green circles) and sham-operated rats (Sham: red triangles). Urine outputs were measured through use of metabolic cages. Note: UW rats did not produce any urine. Values are mean (sd). *P < 0.05 vs Sham.

Download figure to PowerPoint

Table 2. Effect of H2S supplementation on various urinary markers of renal function in renal grafts perfused and stored in UW + H2S-treated and Sham-operated rats
 Urine [Na+], mmol/LUrine [K+], mmol/LUrine [Protein], g/LGFR, mL/min
  1. All values are mean (sd) *P < 0.05 vs Sham-operated rats.

  2. Note: Control (UW only) rats did not produce any urine.

H2S-treated rats     
Postoperative days    
 4–6 *32.9 (25.7) *79.3 (70.0)0.7 (0.7)0.17 (0.15)
 7–969.1 (55.3)176.1 (144.3)1.2 (1.0)0.14 (0.13)
 10–12107.2 (57.4)297.4 (209.2)2.8 (2.0)0.11 (0.06)
 13–14106.4 (119.0)339.2 (356.8)3.0 (3.3)0.20 (0.08)
Sham-operated rats     
 Postoperative days    
  4–6163.0 (119.0)371.3 (175.8)1.3 (0.9)0.20 (0.08)
   7–9179.7 (35.4)523.3 (88.2)2.1 (0.9)0.12 (0.03)
  10–12162.5 (52.7)448.0 (136.5)1.6 (0.5)0.13 (0.03)
  13–14181.7 (72.1)460.0 (136.0)1.9 (0.6)0.16 (0.10)

Renal grafts underwent haematoxylin and eosin and TUNEL staining to assess glomerular and tubular necrosis and cellular apoptosis, respectively. H2S-treated kidneys showed significantly decreased (P < 0.05) glomerular coagulative necrosis and tubular necrosis compared with UW-treated kidneys on both gross appearance and pathological scoring (Figs 4A and 5). In addition, H2S-treated renal grafts exhibited markedly less DNA fragmentation upon TUNEL staining (Fig. 4B,C) and significantly lower (P < 0.05) apoptosis scores upon pathological scoring (Fig. 5) compared with UW-treated grafts.

image

Figure 4. H2S mitigates cellular necrosis and apoptosis in renal grafts. Representative micrographs of renal grafts perfused and stored in UW solution only (UW) or UW solution plus 150 µM NaHS (H2S) as well as sham-operated rats (Sham) obtained at time of death or after 14 days. A, Haematoxylin and eosin staining of renal grafts for glomerular and tubular necrosis; 40X magnification. B, and C, TUNEL staining of renal grafts showing staining of fragmented DNA, a sign of cellular apoptosis; 10X and 40X magnification, respectively.

Download figure to PowerPoint

image

Figure 5. H2S is associated with decreased histological scores of renal graft necrosis and apoptosis. Pathological necrosis and apoptosis scores of renal grafts perfused and stored in UW solution only (UW: red box) or UW solution plus 150 µM NaHS (H2S: green box) as well as sham-operated rats (Sham: light red box) obtained at time of death (UW) or after 14 days (H2S). Values are mean (sd). *P < 0.05 vs UW.

Download figure to PowerPoint

Post-mortem grafts were immunohistochemically stained with antibodies against neutrophil marker MPO and macrophage marker CD68 (Fig. 6). UW-treated grafts exhibited significantly increased (P < 0.05) numbers of both MPO-positive and CD68-positive cells compared with Sham-operated rats, while H2S-treated grafts showed significantly fewer (P < 0.05) numbers of MPO-positive cells at 3–5 days and CD68-positive cells at 14 days post-RTx, compared with UW-treated grafts (Fig. 7). Grafts were also stained with antibodies against T-cell marker CD3, but no differences in T-cell numbers were observed between treatment groups (data not shown). In addition, expression of pro-inflammatory genes IFN-γ, TNF-α and ICAM-1, pro-apoptotic gene BID and anti-apoptotic gene ERK-1 was analysed for each treatment group. Expression of IFN-γ, TNF-α, ICAM-1 and BID were markedly decreased in H2S-treated grafts, with IFN-γ and ICAM-1 expression being significantly decreased compared with UW-treated grafts (P < 0.05, Fig. 8). Relative expression of ERK-1 was markedly increased in the H2S group compared with that in the UW group, although this increase did not reach statistical significance (Fig. 8).

image

Figure 6. H2S decreases inflammatory infiltrate in renal grafts on postoperative days 3–5 compared with UW. Immunohistochemical staining of renal grafts perfused and stored in UW solution only (UW) or UW solution plus 150 µM NaHS (H2S) as well as sham-operated rats (Sham) obtained at time of death, after 3 to 5 days or after 14 days. Images representative pictures of A, negative staining control, lacking primary antibody incubation and grafts stained with primary antibodies against B, neutrophil marker MPO, and C, macrophage marker CD68. Grafts were also stained with antibodies against T-cell marker CD3, but no differences were found between groups. Magnification for each image is 200X.

Download figure to PowerPoint

image

Figure 7. Quantification of immunohistochemical staining of renal grafts. Median cell counts per field of view (FOV) (100X) of positively stained cells in renal grafts stained with antibodies against MPO and CD68. Sham-operated rats: light red box; UW days 3–5: red box; H2S days 3–5: light green box; H2S day 14: green box. Values are mean (sd). *P < 0.05 vs Sham, †P < 0.05 vs. UW days 3–5.

Download figure to PowerPoint

image

Figure 8. H2S modulates renal graft expression of inflammatory and apoptotic genes. qPCR analysis of renal graft homogenates for expression levels of pro-inflammatory genes IFN-γ, TNF-α and ICAM-1, pro-apoptotic gene BID and anti-apoptotic gene ERK-1. Genes were normalized against HPRT-1 and fold changes of gene expression were compared with Sham-operated rats. Renal grafts were perfused and stored in UW solution only (UW: light red box) or UW solution plus 150 µM NaHS (H2S: light green box) and obtained at post-operative days 3 to 5. Values are mean log2 fold change (sd). *P < 0.05 vs UW days 3–5.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

There has recently been a surge in evidence supporting the notion that H2S has many important physiological functions. While H2S has been found to be protective against IRI in several models of warm tissue ischaemia, no work has yet been carried out to investigate the effects of H2S in a model of transplantation-associated cold renal IRI. The present study used the supplementation of organ preservation solution with H2S in an attempt to characterize any potential protective effects of H2S against renal graft injury incurred by transplantation-associated IRI. We demonstrate, for the first time, that H2S plays a cytoprotective role against IRI in the context of RTx, resulting in increased graft function, shown by decreased serum creatinine levels, and recipient survival compared with standard preservation solution-treated kidneys at extremes of cold storage. In addition, H2S protected renal grafts against the necrosis, apoptosis and inflammation normally incurred during prolonged cold IRI. The present model of RTx-associated IRI incorporated an extreme (24-h) period of cold (4 °C) organ storage, which has been shown to be associated with a survival rate of ∼5% when stored in UW solution alone and is evidenced by the observation that no UW rat in the present study survived past postoperative day 5 [17]. A previous study by Biguzas et al.[28], describing the protective effects of UW solution during murine renal graft preservation, showed that rats receiving kidneys stored in only UW solution for extreme periods of cold storage similar to those in the present study had much greater survival than is reported for the UW-treated group in the present study. The main reason for this discrepancy is that the initial study was not a survival model, as recipient rats were allowed to keep their contralateral native kidney for 4–5 days post-autotransplantation. This method probably allowed the contralateral kidney to compensate for any initial loss of function in the cold-stored autograft to sustain the life of the rat during the critical early recovery period of the transplanted kidney. Our objective was not to cast doubt on the protective capabilities of UW solution, but rather to suggest novel methods of optimizing the beneficial effect of UW in cold renal preservation in the hope that the supplementation of standard preservation solutions with H2S may improve their overall protective effects, allowing use of donor kidneys previously thought to be too damaged for transplantation.

Previous studies have indicated that gasotransmitters can improve early renal function and survival in animals subjected to warm renal IRI. Topical application of H2S and the NO-donor molsidomine have independently been shown to ameliorate serum creatinine levels in animals exposed to warm renal IRI induced by clamping of renal pedicles for 45 min and 60 min, respectively [26,29]. In addition, a number of studies have shown that CO inhalation as well as application of CO-releasing molecules can increase animal and graft survival after renal grafts have been subjected to transplantation-associated IRI [16,17,29]. Interestingly, the induction of a hibernation-like hypometabolic state in non-hibernating animals by inhalation of H2S gas has been shown to improve survival of animals subjected to whole-body and warm renal ischaemia [19,30]. Hosgood and Nicholson [31] previously showed that H2S improves porcine renal graft function and mitigates IRI-associated oxidative renal damage, but their study involved an ex vivo DCD model of RTx, which is not as physiologically representative as the actual organ transplantation performed in the present study, nor does it take into account any possible immunological factors on graft function and survival. No studies to our knowledge have yet shown a positive association between H2S treatment and early renal graft function and recipient survival using a clinically applicable model of actual organ transplantation.

A clinically important observation from the present study is that H2S increases renal graft and animal survival even after an extreme period of cold ischaemia, when UW solution alone was not sufficient to preserve the graft organ. Rates of delayed graft function are proportional to length of cold IRI and translate to decreased long-term graft survival [5,6]. This issue may be increasingly important when transporting zero-human leukocyte antigen (HLA) mismatched kidneys between distant geographical regions. In fact, zero-HLA mismatched kidneys are more likely to be exposed to longer cold-storage times which often negate any positive immunological benefits to the recipient [32]. Also, considering that 27.5% of all deceased donor kidneys transplanted experience >22 h of cold ischaemia [7], the negative effects of prolonged cold ischaemia on renal graft function and survival are a real clinical concern; the potential future benefit of adding H2S to preservation solutions may, one day, present a potential solution to this ongoing issue.

To our knowledge, the present study is the first to elucidate the effects of supplemental H2S on renal physiology after RTx. We observed that H2S-treated renal grafts experienced significant early diuresis, and diminished natriuresis and kaliuresis, all of which normalized toward baseline, while UW-treated grafts did not produce urine at all during this period owing to severe IRI-induced tissue damage. H2S treatment has been shown to decrease intrarenal resistance and increase renal blood flow in kidneys after IRI [31,33]; however, it is unlikely that the vasodilatory properties of H2S are the mechanism by which H2S causes initial diuresis in renal grafts, as we previously determined that H2S has a ∼12-h half-life in UW solution (data not shown) and diuresis continues long after all exogenous H2S is probably dissipated from the kidney. The decrease in urine [Na+] and [K+] levels in H2S-treated rats during the first collection period corresponds with the observed initial diuresis, suggesting that the increased excreted urine is more dilute and that the re-absorption mechanisms in the proximal convoluted tubule and loop of Henle are functioning correctly in these renal grafts. Urine protein levels did not differ significantly between H2S-treated and Sham-operated rats, suggesting that the glomerular basement membrane remains intact in H2S-treated rats, as confirmed on pathological analysis. GFR was also not significantly different between the H2S and Sham groups, which, in conjunction with the observed rapid normalization of serum creatinine levels toward baseline in H2S-treated rats, suggests that H2S preserves the glomerular architecture after prolonged cold IRI. Since the medullary concentration gradient appears to remain intact in H2S-treated renal grafts, it is also plausible that H2S has an inhibitory effect on anti-diuretic hormone, causing diuresis attributable to loss of free water via decreased water re-absorption in the distal convoluted tubule.

Histological staining showed that H2S treatment significantly decreased glomerular and tubular necrosis and apoptosis compared with UW treatment, which is probably a major mechanism by which H2S improves graft function and animal survival. Although the effect of H2S in decreasing apoptosis and necrosis of ischaemic myocardial and renal tissues has been reported, this effect has not been studied in a clinically relevant model of transplantation-induced IRI [26,30,34–36]. The surge in inflammatory cytokines and activation of immune cells after reperfusion is a significant mediator of necrotic and apoptotic tissue injury during IRI [37]. In the present study, we observed decreased numbers of MPO-positive neutrophils and CD68-positive macrophages present in H2S-treated grafts compared with UW-treated grafts, as well as down-regulation of pro-inflammatory genes, especially IFN-γ and ICAM-1. Considering that leukocytes are the major immune cells present in the inflammatory portion of IRI, it is likely that this anti-leukocyte effect of H2S is a major mechanism by which it protects against renal graft necrosis and apoptosis during prolonged cold IRI and preserves renal graft function and survival. While several studies point to the association of higher tissue levels of H2S with increased potency of local and systemic inflammatory responses [38–40], more recent analyses support the notion of an anti-inflammatory role for H2S. The present results are consistent with many previous in vitro studies showing that H2S has anti-inflammatory actions via reduction in activation of pro-inflammatory transcription factor NF-κB and down-regulation of ICAM-1 expression leading to decreased neutrophil activation, adherence and invasion, as well as directly interfering with cytotoxic actions of neutrophils by interacting with neutrophil-derived peroxynitrite (ONOO-) [36,41,42].

We also observed that H2S treatment decreased expression of pro-apoptotic gene BID and somewhat mitigated the down-regulation in renal graft expression of the anti-apoptotic gene ERK-1 associated with prolonged cold IRI, which may explain the decreased levels of apoptosis in H2S renal grafts compared with UW-treated renal grafts observed upon TUNEL staining. This observation also concurs with recent evidence suggesting that H2S may prevent cellular apoptosis through interactions with apoptotic signalling pathways, such as attenuating the reduction in the expression of pro-survival protein Bcl-2, reducing phosphorylation of pro-apoptotic signalling molecules p38 MAPK and JNK1/2 complex and causing cleavage of the major pro-apoptotic signalling protein caspase-3 [36,43]. Taken together, these mechanisms of protection by H2S, involving anti-inflammatory and anti-apoptotic properties, probably occur in concert and may be important drivers behind our findings in vivo.

The present study presents novel and clinically applicable data which show that H2S is protective against cold IRI incurred during RTx and improves both short- and long-term graft and renal tubular function and overall survival after prolonged cold ischaemic insult. Furthermore, these protective effects of H2S appear to be mediated by anti-inflammatory and anti-apoptotic mechanisms. The supplemental nature of the H2S to standard cold renal cryoplegia is highly clinically applicable as it offers a solution for maximizing organ function and survival only by its addition to standard preservation solutions, which would not alter any established institutional protocols and would eliminate possible toxic side effects of systemic H2S treatment to the donor or recipient patient. Although we did not observe any untoward behavioural effects in H2S-treated rats, its toxicity profile demands further work identifying the dose at which H2S provides optimum protection against renal IRI. In addition, considering that 25% of kidney transplants performed in the USA are from ECD kidneys exposed to prolonged cold ischaemic times, developing more effective means of reducing IRI injury during RTx, with the potential to improve both short- and long-term allograft survival using such agents as H2S, is critical to the future of organ transplantation.

FUNDING AND ACKNOWLEDGEMENTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES

This work was supported by grants from the Canadian Urological Association Foundation, American Urological Association Northeastern Section and University of Western Ontario Department of Surgery awarded to A.S. I.L. is supported by the Ontario Graduate Studentship Scholarship Award. We thank Dr. Patrick Luke for his insightful comments and suggestions on this manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. FUNDING AND ACKNOWLEDGEMENTS
  8. CONFLICT OF INTEREST
  9. REFERENCES