• Open Access

Identification and characterization of candidate Rlm4 blackleg resistance genes in Brassica napus using next-generation sequencing

Authors

  • Reece Tollenaere,

    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Alice Hayward,

    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Jessica Dalton-Morgan,

    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Emma Campbell,

    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Joanne R.M. Lee,

    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Michal T. Lorenc,

    1. Australian Centre for Plant Functional Genomics, School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Sahana Manoli,

    1. Australian Centre for Plant Functional Genomics, School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Jiri Stiller,

    1. Australian Centre for Plant Functional Genomics, School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Rosy Raman,

    1. NSW Department of Primary Industries, Wagga Wagga Agricultural Institute, Wagga Wagga, NSW, Australia
    Search for more papers by this author
  • Harsh Raman,

    1. NSW Department of Primary Industries, Wagga Wagga Agricultural Institute, Wagga Wagga, NSW, Australia
    Search for more papers by this author
  • David Edwards,

    1. Australian Centre for Plant Functional Genomics, School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
    Search for more papers by this author
  • Jacqueline Batley

    Corresponding author
    1. Centre for Integrative Legume Research and School of Agriculture and Food Sciences, University of Queensland, Brisbane, Qld, Australia
      (Tel +61 (0)7 334 69534; fax +61 (0)7 336 51188;
      email j.batley@uq.edu.au)
    Search for more papers by this author

(Tel +61 (0)7 334 69534; fax +61 (0)7 336 51188;
email j.batley@uq.edu.au)

Summary

A thorough understanding of the relationships between plants and pathogens is essential if we are to continue to meet the agricultural needs of the world’s growing population. The identification of genes underlying important quantitative trait loci is extremely challenging in complex genomes such as Brassica napus (canola, oilseed rape or rapeseed). However, recent advances in next-generation sequencing (NGS) enable much quicker identification of candidate genes for traits of interest. Here, we demonstrate this with the identification of candidate disease resistance genes from B. napus for its most devastating fungal pathogen, Leptosphaeria maculans (blackleg fungus). These two species are locked in an evolutionary arms race whereby a gene-for-gene interaction confers either resistance or susceptibility in the plant depending on the genotype of the plant and pathogen. Preliminary analysis of the complete genome sequence of Brassica rapa, the diploid progenitor of B. napus, identified numerous candidate genes with disease resistance characteristics, several of which were clustered around a region syntenic with a major locus (Rlm4) for blackleg resistance on A7 of B. napus. Molecular analyses of the candidate genes using B. napus NGS data are presented, and the difficulties associated with identifying functional gene copies within the highly duplicated Brassica genome are discussed.

Introduction

Brassica napus is a member of the large and agronomically important Brassicaceae family, which consists of approximately 340 genera and 3350 species. The Brassica genus includes many important vegetable and oilseed crops, with six cultivated Brassica species: B. napus (canola/rapeseed/oilseed rape), Brassica rapa (Chinese cabbage/turnip rape), Brassica oleracea (including broccoli, cabbage and cauliflower), Brassica juncea (Indian mustard), Brassica nigra (black mustard) and Brassica carinata (Ethiopian mustard). Brassica napus is the evolutionary result of an interspecific hybridization between B. rapa (AA genome, 2= 20) and B. oleracea (CC genome, 2= 18), generating an amphidiploid genome AACC (2= 4x = 38).

As of 2009, canola was the third largest source of vegetable oil and oil extraction meal worldwide, with 12.1 million metric tonnes of oil produced (Freidt and Snowdon, 2009). However, canola production is often devastated by blackleg disease, caused by the virulent fungal pathogen, Leptosphaeria maculans (Hayward et al., 2012). Blackleg is the most serious fungal disease of oilseed Brassicas, in particular B. napus and B. rapa (Howlett et al., 2001), and canola production in Australia was virtually eliminated by this fungal pathogen in the early 1970s (Howlett, 2004). Today, blackleg remains a major cause of crop loss in Australia and internationally, and is estimated to be responsible for an average of 15% crop losses per annum worldwide, valued at US$900M (Fitt et al., 2008).

Many practices are employed in an attempt to reduce the devastating effect of L. maculans on rapeseed production. Improvements in agronomic practices, for example sowing a new crop at least 500 m from previous years’ stubble, have mitigated crop losses for Australian growers. However, the most effective and sustainable approach to the treatment of blackleg disease is to identify resistance genes in Brassica species and apply these in breeding resistant varieties (Hayward et al., 2012).

There are both qualitative and quantitative types of resistance to L. maculans (Balesdent et al., 2001, 2002). Qualitative resistance is race-specific and depends on the presence of a single resistance (R) gene in the plant corresponding to an avirulence (Avr) gene in the pathogen (Ansan-Melayah et al., 1998). Qualitative resistance is expressed from seedlings to adults in cotyledons and leaves (Delourme et al., 2006). In contrast, quantitative resistance is generally thought to be race nonspecific, mediated by many genes and expressed at the adult plant stage, conferring only partial resistance to the pathogen (Delourme et al., 2006; Rimmer, 2006).

Most proteins encoded by R genes in plant genomes belong to the nucleotide binding site and leucine-rich repeat (NBS-LRR) domain-containing class of proteins (Baumgarten et al., 2003; Persson et al., 2009). NBS-LRR proteins have a variable N-terminus, which commonly contains a domain with similarity to the Drosophila Toll and mammalian Interleukin-1 receptor (TIR) or a coiled-coil (CC) sequence (Persson et al., 2009). NBS-LRR proteins are located intracellularly and may interact directly with pathogen Avr proteins, known as effectors, or with host factor proteins that enable the indirect identification of pathogen effectors.

Little information is available on the genetic control of quantitative resistance to L. maculans. Numerous quantitative trait loci (QTL) studies have identified many regions on both the A and C genomes involved in quantitative resistance (Balesdent et al., 2002; Delourme et al., 2004, 2008; Ferreira et al., 1995; Kaur et al., 2009; Pilet et al., 2001; Raman et al., 2012). Nevertheless, the different QTLs cannot be easily compared because of different marker systems being used, along with differences in the blackleg isolates and innoculum concentrations present at each location. Fifteen specific resistance genes have been genetically mapped in the cultivated Brassica species to date. BLMR1 on A10 has been fine-mapped to within 0.13 cM (Long et al., 2011); however, no B. napus blackleg resistance gene has been cloned to date.

Despite the extensive efforts in genetic mapping, the use of map-based cloning to identify genes underlying important traits is very difficult in complex genomes, such as B. napus. There are also problems with candidate gene approaches, which employ homology searches with genes identified from closely related, well-characterized model organisms, such as Arabidopsis. This is because multiple homologues and paralogues of any given gene of interest can complicate their identification and role in the polyploid species. Next-generation sequencing (NGS) technologies have advanced rapidly in the past few years, providing the ability to sequence reference genomes as well as re-sequence cultivars of interest at relatively low cost (Duran et al., 2010; Edwards and Batley, 2010; Imelfort and Edwards, 2009; Malory et al., 2011; Varshney et al., 2009). Illumina’s HiSeq 2000 currently produces more than 600 billion nucleotides per run with a read length of >100 bp (http://www.illumina.com), and the sequence volumes and lengths for this technology are under continuous improvement. With advances in genome sequencing technologies (Edwards and Wang, 2012), single nucleotide polymorphism (SNP) discovery from NGS data is now routine (Allen et al., 2011; Duran et al., 2009a,b; Kharabian-Masouleh et al., 2011; Subbaiyan et al., 2012). Re-sequencing is used to identify genetic variation between individuals, which can provide molecular genetic markers and insights into gene function (Imelfort et al., 2009). The process of whole-genome re-sequencing using short-read technologies involves aligning a set of millions of reads to a reference genome sequence (Batley and Edwards, 2009). Once this has been achieved, it is possible to determine variation in nucleotide sequence between the individuals.

Recently, a qualitative (race-specific) trait locus controlling blackleg resistance was identified in a doubled-haploid (DH) population derived from the Australian canola cultivars Skipton and Ag-Spectrum (Raman et al., 2012). This major locus, designated RlmSkipton, was genetically mapped within BRMS075-CB10439 marker interval to B. napus chromosome A7, within 0.8 cM of the SSR marker Xbrms075, and corresponds to Rlm4 (Resistance to L. maculans 4) based on recognition of an AvrLm4-containing L. maculans isolate (Raman et al., 2012). The avirulence gene AvrLm4-7 leads to the dual recognition by two Resistance genes, Rlm4 and Rlm7, and elicits the appropriate defence response (Parlange et al., 2009). Therefore, loci mapping to Rlm4 remain candidates for both Rlm4 and Rlm7. In this study, the alignment of this QTL region with the newly available reference genome sequence of B. rapa (Wang et al., 2011), using sequence-based molecular markers, permitted the physical mapping of the Rlm4 region and the identification of candidate disease resistance genes. Subsequent mapping of Illumina paired sequence reads from the two parents Skipton and Ag-spectrum to the reference genome, and comparing polymorphisms in and around the candidate genes of interest, allowed the molecular characterization of the candidate genes and potential localization of the causative polymorphism.

This study provides a molecular characterization of two Rlm4 gene candidates using next-generation DNA sequencing. This approach can be applied to any trait and population of interest for the rapid identification and characterization of candidate genes.

Results and discussion

Previous methods to identify Rlm candidate genes in our laboratory used a simple gene homology–based approach, whereby Resistance genes to L. maculans from the model organism Arabidopsis were compared with the available Brassica sequence databases (Lim et al., 2007; Love et al., 2006). However, this proved problematic in that either no gene candidates were identified, or multiple homologous gene candidates were identified that did not map to the known resistance loci on the reference genome. With the advancements and accessibility of NGS, and the recent release of the B. rapa genome sequence (Wang et al., 2011), the approach taken in this study was to sequence the parents of a mapping population that shows segregation for the Rlm4 locus to rapidly identify candidate genes.

Identification of candidate genes for Rlm4

A 2.75-Mbp region of Brassica chromosome A7 corresponding to a major locus for Rlm4 was identified by genetic mapping in a B. napus cv. Skipton × Ag-Spectrum DH population. Flanking markers for Rlm4 (Raman et al., 2012) were physically mapped on the B. rapa A genome sequence (Wang et al., 2011). Selection of this sequence region and comparison with known Arabidopsis disease resistance genes identified eighteen candidate genes, from over 2000 predicted genes, with disease resistance characteristics (here designated BLR1 (Brassica Leptosphaeria Resistance 1) to BLR18). These candidate genes were then characterized in the Skipton and Ag-Spectrum parental lines that differ in Rlm4-based resistance following Illumina paired-end sequencing of these parents and alignment to the reference genome.

The average depth of Illumina sequence read coverage across the reference A genome was ∼10× for both Skipton and Ag-Spectrum; though, read coverage varied from 0% to 100%, with an average of 67%, across the candidate gene regions (genic region plus 1 kb either side; Table 1, Figure 1). Sequence read coverage is determined by sequencing data volumes and also sequence conservation between the reads and the reference, and with an average of 10× read depth, reference regions with zero coverage are likely to be due to significant sequence variation or loss between the sequenced parent and the reference. Given this, the NGS data revealed BLR2 as a priority candidate for Rlm4, as none of the Ag-Spectrum reads mapped to the gene, whilst 100% coverage was observed with reads from the resistant parent Skipton (Table 1).

Table 1.   Coverage and single nucleotide polymorphism (SNP) analysis of 18 candidate genes underlying the Rlm4 quantitative trait loci
Gene nameCultivarShort read coverage (%)Gene region SNP numberGene region SNP density/kbSNP type
1 kb 5′Genic1 kb 3′
  1. Genes chosen as best candidates for further analysis are highlighted.

BLR1 Skipton5301 CDS00.251 non-synonymous
Ag-Spectrum45
BLR2 Skipton100N/AN/AN/AN/AN/A
Ag-Spectrum0
BLR3 Skipton8308 (2 CDS, 6 intronic)22.312 synonymous
Ag-Spectrum47
BLR4 Skipton507002.72N/A
Ag-Spectrum42
BLR5 Skipton69513 (9 CDS, 4 intronic)03.935 non-synonymous 4 synonymous
Ag-Spectrum83
BLR6 Skipton7106 CDS12.162 non-synonymous 4 synonymous
Ag-Spectrum71
BLR7 Skipton620000.00N/A
Ag-Spectrum77
BLR8 Skipton9102 CDS00.791 non-synonymous 1 synonymous
Ag-Spectrum73
BLR9 Skipton802 CDS00.751 non-synonymous 1 synonymous
Ag-Spectrum62
BLRIO Skipton600000.00N/A
Ag-Spectrum10
BLR11 Skipton 9176 CDS14.124 non-synonymous 2 synonymous
Ag-Spectrum 82
BLR12 Skipton920000.00N/A
Ag-Spectrum83
BLR13 Skipton1001000.40N/A
Ag-Spectrum64
BLR14 Skipton4213 CDS00.971 non-synonymous 2 synonymous
Ag-Spectrum35
BLR15 Skipton9401 intronic00.35N/A
Ag-Spectrum82
BLR16 Skipton880000.00N/A
Ag-Spectrum88
BLR17 Skipton500000.00N/A
Ag-Spectrum60
BLR18 Skipton960020.61N/A
Ag-Spectrum100
Average 66.81.22.5 (1.9 CDS)0.41.2 
Figure 1.

 Read coverage and single nucleotide polymorphism (SNP) locations for eight selected SNAP predicted genes. Green boxes represent read coverage in that area of the gene; white represents lack of coverage. SNPs between the Skipton and Ag-Spectrum cultivars are circled in blue. S, Skipton, A, Ag-Spectrum.

The number of SNPs in each candidate gene region ranged from 0-18 based solely on the short-read data, with an average density of 1.2 SNPs per kilobase across the 18 gene regions. On average, a similar number of SNPs between the parent cultivars was found within the 1 kb upstream regions as for the coding regions of each predicted gene, with fewer SNPs noted in the 1 kb downstream. Where coverage was present for both cultivars, SNP density was not directly related to coverage but rather was gene-specific, providing a good basis for narrowing the candidate gene selection (Table 1). Those genes that contained no predicted SNPs or SNPs which were synonymous were thought to be low-priority candidates. Following SNP analysis, a second gene, BLR11, was prioritized along with BLR2 as a potential Rlm4 candidate based on the good gene coverage and high SNP density. Therefore, sequence comparison using the NGS data was effective for rapidly narrowing the list of Rlm4 QTL candidates.

On the basis of the NGS reads that mapped to the gene regions of interest, PCR primers were designed for amplification of the candidate genes in both parents to validate the results of the Illumina read mapping and to assess complete sequence divergence between the parents. For those genes where no reads mapped to coding regions in Ag-Spectrum, such as BLR2, primers were designed to amplify this region based on the nearest mapping genomic read pairs.

BLR2

The complete absence of Ag-Spectrum Illumina reads mapping to the BLR2 region (Figure 1) gave an early indication that there may be substantial sequence variation between the Ag-Spectrum and Skipton DNA in this region. Successful amplification of the BLR2 gene region, including some predicted 5′ and 3′ sequence, in Skipton and Ag-Spectrum with the F3/R3 primer pair (Table 2) revealed an obvious difference in amplicon lengths.

Table 2.   Details of primers used in this project
SNAP genePrimer pairPrimer sequence 5′–3′Annealing temperature (°C)Product size (bp)
SkiptonAg Spectrum
  1. Primer pairs, annealing temperatures and amplicon lengths are also shown.

  2. F, forward primer; R, reverse primer.

BLR2 F3 R3TCATAAACTGCTTTTCATGG TGCCTTACGTAACCAAACC6024022839
BLR11 Fl RlGTTCCCCCGTCCATAGG CTAAATCGTTACGGGCAAGG6020192012
Other primers:M13 F primer (universal)GTTTTCCCAGTCACGACGTT50  
M13 R primer (universal)GACCATGATTACGCCAAGCTA

Sequencing these amplicons revealed a 437 nucleotide (-nt) difference in size between Skipton and Ag-Spectrum. This difference included insertions of 405-nt and 6-nt within 1 kb downstream of the Ag-Spectrum gene relative to Skipton, as well as a 26-nt insertion and 4-nt deletion in the Ag-Spectrum 5′ region (positions-530 and-105, respectively) and a 4-nt and 3-nt deletion in the Ag-Spectrum coding region. All amplicons sequenced per cultivar were identical.

Within the amplified genomic region, Skipton showed 98% DNA sequence identity to the B. rapa reference genome whilst Ag-Spectrum shared just 79.4% identity. Given the necessary stringency in whole-genome NGS read mapping from polyploid genomes, this degree of divergence from the reference sequence in Ag-Spectrum explains the lack of read coverage for this gene region (Table 1). Within the putative coding sequence of the BLR2 gene, Skipton and Ag-Spectrum shared 99.8% and 90.3% identity with B. rapa, respectively.

The predicted amino acid sequence for Skipton BLR2 was found to be almost identical to that for the reference B. rapa protein (99.5%). In contrast, the predicted Ag-Spectrum sequence shared 83.7% amino acid identity with B. rapa from position 1 to 44, at which point a stop codon truncates the putative protein. These results suggest that the genomic environment of BLR2 is substantially different between Skipton and Ag-Spectrum, and that the Ag-Spectrum BLR2 protein is likely to be severely truncated and thus non-functional relative to the conserved Skipton protein.

Genetic mapping of this gene in the Skipton/Ag-Spectrum population (Raman et al., 2012), further supports it as a candidate. The gene was located within the QTL region, and the mapping showed a clear and strong association between resistance phenotype and the flanking SSR and SNP markers known to reside on chromosome A7.

BLR11

BLR11 was selected for further analysis because of the high read coverage and presence of numerous SNPs between Skipton and Ag-Spectrum identified from the short-read mapping data (Table 1, Figure 1). A total of six SNPs were identified within the predicted gene, with a further eight SNPs identified 1 kb up- and downstream. These SNPs were predicted to have four non-synonymous effects on the putative protein creating further interest in this candidate.

Amplification of the BLR11 candidate gene using the F1/R1 primer pair for both Skipton and Ag-Spectrum resulted in similar-sized amplicons, encompassing the predicted coding region and 100–200 nt up- and downstream. The Ag-Spectrum product, however, contained an 11-nt deletion in the predicted 5′ region upstream of the gene and a 4-nt insertion at position 605 of the putative coding region, giving 98.4% CDS identity to Skipton.

The predicted amino acid sequence for Skipton BLR11 was found to share 99.3% identity with B. rapa and 100% identity with Ag-Spectrum until residue 201, at which point the 4-nt insertion in Ag-Spectrum resulted in a frameshift mutation and subsequent stop codon at position 203. Therefore, the predicted protein product of BLR11 is truncated in Ag-Spectrum and may be non-functional. Thus, BLR11 also remains a promising candidate for Rlm4-mediated resistance in Skipton.

In all, predictions of SNPs and indel polymorphisms between NGS reads for the B. napus parents of a QTL mapping population segregating for Rlm4 resistance has enabled the prioritization of candidate genes for further analysis. This approach allows the rapid identification of candidate genes for traits of interest, without the requirement for high-resolution map-based cloning. Whilst the success of the method has been demonstrated using whole-genome shotgun data, other sources of sequence data, such as RNA-seq, could also be utilised if data were available; however, this would limit the identification of genes to those expressed in the tissues sequenced and may have complications in distinguishing between paralogues.

Experimental procedures

Genetic and physical mapping of the Rlm4 QTL

The genetic map position for Rlm4 was determined in a Skipton cv. × Ag-Spectrum cv. mapping population, segregating for blackleg resistance (Raman et al., 2012). The 12 SSR markers underlying the QTL on chromosome A7 were compared with the public B. rapa A genome (Wang et al., 2011) reference sequence using BLAST (Altschul et al., 1990). This physical region was annotated with predicted genes using SNAP gene prediction software (Korf, 2004) tailored to Brassica. Genes with homology to known resistance genes were selected.

Identification of B. napus orthologues of the B. rapa candidate genes

Whole-genome, paired-end short-sequence reads (>10× coverage) for cv. Skipton and Ag-Spectrum were generated using the Illumina Genome Analyser IIx (GAIIx) according to manufacturer’s instructions (Illumina, San Diego, CA). These were mapped to assembled B. rapa and B. oleracea genome sequences using SOAP2 (Li et al., 2009). SNPs were identified as sequence differences between the two varieties supported by at least two reads from each variety. Sequence reads matching the genomic regions can be downloaded from http://www.brassicagenome.net/downloads/R_XA_0003.zip.

Amplification, cloning and sequencing of Rlm4 candidate genes

PCR primers were designed with the program AmplifX version 1.5.4 (Jullien, 2008) using the Skipton and Ag-Spectrum short-read information mapped to the B. rapa reference. Table 1 lists the primers and PCR conditions used. PCR primers were compared with the A and C reference genomes to increase genome specificity of the primers.

Candidate genes were amplified from Skipton and Ag-Spectrum genomic DNA using PCR with the primers listed in Table 2. A total reaction volume of 40 μL consisted of 1 × iTaq PCR buffer (containing 100 mm Tris–HCl (pH 8.3) and 500 mm KCl) (Scientifix), 200 μm each dNTP (Scientifix), 0.5 μm each primer, 1.5 U iTaq DNA polymerase (Scientifix), RNase- and DNase-free water (Gibco) and 50 ng DNA. Thermocycling conditions for the reaction were 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, annealing for 1 min and extension at 72 °C. Final extension was performed at 72 °C for 8 min. Gel electrophoresis on a 1% (w/v) agarose gel in 1 × TAE buffer (Sambrook and Russell, 2001) containing ethidium bromide resolved products of appropriate size, which were excised and purified using a silica method based on Boyle and Lew (1995).

PCR-purified DNA was ligated into the pGEM-T Easy vector (Promega) overnight at 4°C according to the manufacturer’s protocol. Heat shock competent E. coli XL1-Blue cells were transformed with ligated plasmid, then plated onto an LB agar medium containing 100 μg/mL ampicillin, 50 mg/mL X-gal and 50 mg/mL IPTG and grown overnight at 37°C. Positive clones (white colonies) were screened by PCR using the universal M13F and M13R primers (see Table 1). Colonies testing positive for PCR inserts were selected for plasmid purification using the High pure DNA plasmid isolation kit (Roche) according to the manufacturer’s instructions.

Purified plasmid DNA was used as the template for Sanger sequencing reactions performed by the Australian Genome Research Facility (AGRF). Nucleotide and protein alignments and assemblies were performed using Geneious Pro v5.4.6 (Drummond et al., 2012) with a cost matrix of 65%, a gap open penalty of 6 and a gap extension penalty of 3. Protein sequence prediction and alignments were performed using the Geneious alignment tool with default parameters.

Conclusions

This study highlights the applicability of NGS data for rapid and efficient discovery of QTL candidates within physically mapped genome regions. Using whole-genome shotgun reads for parents of a B. napus population segregating for Rlm4 resistance, two strong candidates for Rlm4 in B. napus cv. Skipton were identified. Candidates were selected based on the sequence identity with known resistance genes and sequence divergence in the NGS reads for the susceptible parent. These genes, BLR2 and BLR11, were both found to encode truncated proteins in the susceptible Ag-Spectrum parent, with a particularly severe truncation noted for BLR2. Analyses are now underway to confirm the functional Rlm4 locus in cv. Skipton including expression analyses and transformation into susceptible lines. Furthermore, the NGS data for these two lines has enabled the identification of 400 SNPs within the existing Rlm4 QTL, a subset of which have been included in a custom 6K Illumina Infinium chip for further fine mapping of the Rlm4 QTL. This method of candidate gene identification and applicability to fine mapping through the use of molecular markers flanking a QTL region, which map to specific regions of the assembled genome sequence, overcomes the problems associated with candidate gene approaches based purely on sequence similarity from model species in polyploid genomes. Combining this with PCR amplification, genetic mapping and sequencing validation of single specific gene products further confirms the genes as candidates. Whilst this has been applied for blackleg resistance here, the method is transferable to any trait.

Acknowledgements

The authors would like to acknowledge funding support from the Australian Research Council (Projects LP0882095, LP0883462, LP0989200, LP110100200 and DP0985953). Support from the Australian Genome Research Facility (AGRF), the Queensland Cyber Infrastructure Foundation (QCIF) and the Australian Partnership for Advanced Computing (APAC) is gratefully acknowledged.

Ancillary

Advertisement