Molecular detection of Rickettsia massiliae, Rickettsia sibirica mongolitimonae and Rickettsia conorii israelensis in ticks from Israel

Authors


Corresponding author and reprint requests: S. Harrus, School of Veterinary Medicine, The Hebrew University of Jerusalem, PO Box 12, Rehovot 76100, Israel
E-mail: harrus@agri.huji.ac.il

Abstract

Clin Microbiol Infect 2011; 17: 176–180

Abstract

Rickettsioses are recognized as important emerging vector-borne infections of humans worldwide. Previous reports documented the presence of two spotted fever group rickettsiae in Israel, Rickettsia conorii israelensis and Rickettsia felis. The aim of this study was to characterize the diversity of rickettsiae in ticks collected from vegetation and the ground, from different parts of Israel. Non-engorged questing adult ticks were collected from 13 localities. A total of 131 tick pools, 83 of Rhipicephalus turanicus and 48 of Rhipicephalus sanguineus (each with 2–10 ticks per pool), were included in this study. In addition, 13 Hyalomma sp. ticks were collected. The ticks were molecularly screened for rickettsiae, targeting the citrate synthase (gltA) and the outer membrane protein A (ompA) gene loci. Rickettsia massiliae ompA DNA (100% sequence identity; 180 bp) was detected in 32 Rh. turanicus and 12 Rh. sanguineus tick pools. R. conorii israelensis was detected in three Rh. sanguineus pools. Rickettsia sibirica mongolitimonae ompA DNA (100% sequence identity; 182 bp) was found in one Hyalomma tick. This study reports the first detection of R. massiliae and R. sibirica mongolitimonae in ticks from Israel. This is the first report describing the presence of these human pathogens in the Middle East.

Introduction

Rickettsioses are recognized as important emerging vector-borne infections of humans worldwide. They are caused by obligate intracellular Gram-negative bacteria of the genus Rickettsia (family Rickettsiacea). Spotted fever group rickettsioses are characterized by fever, headache, rash and potential eschar formation at the bite site [1,2]. Two spotted fever group rickettsiae have been detected and characterized in Israel to date, Rickettsia conorii israelensis, the aetiological agent of Israeli spotted fever (ISF), and Rickettsia felis, the aetiological agent of flea-borne spotted fever. Israel is considered to be an endemic region for ISF, and clinical cases are commonly presented. In contrast, clinical cases attributed to R. felis in Israeli patients have not been reported to date [3–5].

Arthropod vectors have been screened extensively for the diversity of the pathogens that they carry. The introduction of molecular techniques in the last two decades has resulted in increased detection of emerging and re-emerging vector-borne pathogens in different parts of the world [6]. The aim of this study was to characterize the diversity of rickettsiae in ticks collected from vegetation and the ground in different parts of Israel.

Materials and Methods

Tick collection

Non-engorged questing adult ticks were collected from 13 localities in the vicinity of human habitations in three different geographical regions in Israel (Caesarea, Pardes Hana, Michmoret and Alexander valley in the north; Tel Aviv, Bet Arif, Mazkeret Batia, Kibbutz Hulda and Kibbutz Harel in the centre; and Or Haner, Bror Hail, Reim and Tzeelim in the south). Ticks were collected from vegetation of up to 30 cm in height with the flagging technique. In addition, some ticks were collected directly from the vegetation or while moving on the ground. The ticks were identified morphologically by an experienced entomologist. A total of 1196 non-engorged adult ticks identified as Rhipicephalus sanguineus (Latreille, 1806), Rhipicephalus turanicus (Pomerantsev, 1936) and Hyalomma sp. were collected during 2002–2003 and 2007–2008. Ticks of the same species collected on the same date and from the same location were pooled together in one vial. Ticks collected during the years 2002–2003 were kept in a medium containing 10% fetal bovine serum and 10% antibiotics/antimycotics (10 mg/mL streptomycin sulphate, 10 000 U/mL, penicillin G sodium, and 25 mg/L amphotericin B), and ticks collected during the years 2007–2008 were kept in 70% ethanol. All ticks were frozen at −70°C until DNA extraction.

DNA extraction, real-time PCR amplification and sequencing

After elimination of the ethanol and medium remains from each vial containing ticks, 50 mL of phosphate-buffered saline was added. Each sample was manually homogenized with plastic microtube pestles for 1 min, and then centrifuged for 10 s at 2000 g. The upper fraction was collected from each vial, and DNA was extracted with a DNA extraction kit (Illustra Tissue Mini Spin kit; GE Healthcare, Little Chalfont, UK), according to the manufacturer’s instructions. Initial detection of Rickettsia species was performed by screening all DNA samples by a real-time PCR assay targeting a 133-bp fragment of the citrate synthase gene (gltA), using primers rico173F (CGACCCGGGTTTTATGTCTA) and rico173R (ACTGCTCGCCACTTGGTAGT), designed for this study. Real-time PCR was carried out with an initial hold for 15 min at 95°C, followed by 50 cycles of 5 s at 95°C, 30 s at 57°C (fluorescence acquisition on the HRM channel) and 1 s at 72°C. The melting phase started at 60°C, each step rising by 1°C (fluorescence acquisition on the HRM channel), and finished at 90°C with a hold for 90 s at the first step and 5 s at the subsequent steps. Hybridization started at 90°C and fell to 50°C, by 1°C at each step. The positive samples were further analysed by targeting a 178–189-bp fragment of the outer membrane protein A gene (ompA), using primers 107F (GCTTTATTCACCACCTCAAC) and 299R (TRATCACCACCGTAAGTAAAT) [7], with an initial hold for 15 min at 95°C, followed by 50 cycles of 10 s at 95°C, 30 s at 56°C (fluorescence acquisition on the HRM channel) and 6 s at 72°C. The melting phase started at 60°C, each step rising by 1°C (fluorescence acquisition on the HRM channel), and finished at 95°C with a hold for 90 s at the first step and 1 s at the subsequent steps. Hybridization started at 90°C and fell to 50°C, by 1°C at each step. Both real-time PCR reactions were carried out using the Rotor Gene 6000 cycler (Corbett Research, Sydney, Australia). PCR was performed in 20-μL reaction volumes containing 4 μL of DNA, 1.5 μL of each primer, 0.6 μL of cyto9, 2.4 μL of double-distilled water, and 10 μL of Thermo-Start PCR Master Mix (Thermo Scientific, Loughborough, UK). DNA extracted from cultured R. conorii israelensis was used as a positive control, and two negative control samples containing all the ingredients of the reaction except DNA were used for all trials.

PCR products were purified using a PCR purification kit (ExoSAP-IT; USB, Cleveland, OH, USA) and sequenced. DNA sequencing was carried out by utilizing the BigDye terminator cycle sequencing chemistry from an Applied Biosystems ABI 3700 DNA Analyzer (Foster City, CA, USA), and the ABIs data collection and sequence analysis software. Further analysis was performed with Sequencher software, version 4.8 (Gene Codes Corporation, Ann Arbor, MI, USA).

Results

Ticks

A total of 131 pools, 83 of Rh. turanicus and 48 of Rh. sanguineus, each with 2–10 adult ticks per pool, were included in this study. In addition, 13 adult ticks of Hyalomma spp. were placed in single tubes and analysed separately.

Rickettsiae

The rickettsial gltA gene fragment was detected and sequenced in 23 of the 48 (48%) Rh. sanguineus tick pools, in 51 of the 83 (61%) Rh. turanicus tick pools, and in five of the 13 (38%) Hyalomma sp. ticks. Sequences of the gltA fragment were identical in most of the tested samples (99–100% sequence identity to a large number of rickettsial species and strains), and could not assist in species identification. Therefore, the ompA gene was further targeted. Table 1 shows the ompA gene sequence similarities observed with respect to those deposited in GenBank.

Table 1.   Similarities of outer membrane protein A (ompA) gene sequences, detected in ticks from Israel, with GenBank-deposited sequences
TickRickettsial ompA (% identity; number of base pairs)
Number of pools/ticks
Rhipicephalus sanguineusRickettsia massiliae (100%EU448165; 180 bp)
12 pools
Rickettsia conorii israelensis (100%EF177482.1; 180 bp)
three pools
Rickettsia africae, Rickettsia conorii caspia (99%CP001612.1; 178 bp)
one pool
Rhipicephalus turanicusR. massiliae (100%EU448165; 180 bp)
32 pools
R. conorii caspia (99%U43791.1; 182 bp)
five pools
R. africae, R. conorii caspia (99%CP001612.1; 178 bp)
one pool
Hyalomma sp.Rickettsia sibirica mongolitimonae (100%DQ423367.1; 182 bp)
one tick
R. conorii caspia (99%U43791.1; 182 bp)
one tick

Rickettsial ompA DNA was found in 16 of the 23 gltA-positive Rh. sanguineus pools (Table 1), 12 of which were positive for Rickettsia massiliae. All of these sequences were identical and were deposited in GenBank (new accession number GU212859); ompA DNA from three Rh. sanguineus pools was identical to that from R. conorii israelensis. The three sequences were also identical to each other and were deposited in GenBank (accession number GU212863). One Rh. sanguineus pool contained a DNA fragment that was 99% similar to fragments from Rickettsia africae and Rickettsia conorii caspia. Its sequence was deposited in GenBank (accession number GU212860).

Rickettsial ompA DNA was found in 38 of the 51 gltA-positive Rh. turanicus pools (Table 1): 32 Rh. turanicus pools were found to be positive for R. massiliae (sequence deposited under GenBank accession number GU212859); ompA DNA from five Rh. turanicus pools was found to be 99% similar to that of R. conorii caspia (deposited under GenBank accession number GU212861). The gltA fragment of three of these five pools was 100% similar to that of R. conorii israelensis (ISTT CDC1, accession number U59727), as well as to those of other rickettsiae, with one base change (adenine instead of guanine at position 58) as compared with the other two pools, which were 99% similar to this R. conorii israelensis. One Rh. turanicus pool contained a DNA fragment that was 99% similar to those of R. africae and R. conorii caspia (deposited under GenBank accession number GU212860).

Rickettsial ompA DNA was found in two Hyalomma sp. ticks. DNA of a Rickettsia sibirica mongolitimonae strain (new GenBank accession number GU212862) was found in one Hyalomma sp. tick (from Or Haner in the south). An ompA fragment was identified in an additional Hyalomma sp. tick (from Bror Hail in the south). The sequence of the latter fragment was 99% similar to that of R. conorii caspia. It was deposited in GenBank (accession number GU212861). R. massiliae and R. conorii israelensis DNA were detected in ticks from all three geographical regions.

Discussion

This study reports the first molecular detection of R. massiliae and R. sibirica mongolitimonae in ticks from Israel. This is the first report describing the molecular detection of these human pathogens in the Middle East.

R. massiliae was described and isolated in 1992 from Rh. sanguineus ticks in Marseilles [8]. Actually, it was isolated initially in 1985 from a patient in Palermo, Italy, who suffered from fever, an eschar and a maculopapular rash [9]. But this isolate was stored for 20 years and identified only in 2005 as R. massiliae. A second human case was recently reported in France [10]. Clinical signs included fever, night sweats, headache, skin necrotic lesions and a maculopapular rash. To date, R. massiliae has been detected and reported in Rhipicephalus sp. ticks in Europe, Africa and America (Argentina, and recently in Arizona, USA) [1,11]. In fact, R. massiliae is the sole pathogenic tick-borne rickettsia reported to occur on all three continents [1]. This study indicates, for the first time, that R. massiliae is prevalent in ticks from Israel, both in Rh. sanguineous and in Rh. turanicus. To the best of our knowledge, this is the first report of R. massiliae detection in Asia.

ISF is widely distributed throughout the Mediterranean basin and the Middle East [12]. R. conorii israelensis has been identified in Israel, Italy and Portugal [13–15]. The predominant symptoms of ISF include fever, headache, rash, myositis, myalgia, and arthralgia [12,16]. Appearance of an eschar at the tick bite site is also a common finding in ISF [12]. The manifestation of the disease, which may be fatal, varies from mild to severe [15]. Previous reports have documented that R. conorii israelensis is prevalent in Israel mainly in two foci, one in the northern Hadera-Caesarea region, and the other in the southern Reim-Tzeelim region [3,17]. This study indicates that this rickettsial pathogen is prevalent in Rh. sanguineus ticks from many geographical regions in Israel, from Caesarea in the north to Kibbutz Tzeelim in the south.

In this study, an ompA gene fragment (GenBank accession number GU212861), which was 99% similar to that of R. conorii caspia, was identified in five Rh. turanicus pools and in one Hyalomma sp. tick. This rickettsia, previously designated as Rickettsia sp. Chad, is endemic in the Caspian Sea area. It was isolated for the first time from a soldier in Chad. The patient had fever, chills, headache, a generalized purpuric cutaneous rash, an inoculation eschar and dyspnoea resulting from interstitial pneumonia [18]. The ompA fragment identified in the current study was 98% similar to that of R. conorii israelensis. The gltA fragment from three of the five Rh. turanicus pools in this study was 100% similar to the counterpart of R. conorii israelensis, whereas the fragments from the remaining two pools were 99% similar, with only a single nucleotide difference. As these DNA fragments were identified in tick pools and the sequences could be obtained from different individual ticks, infection of individual ticks with different rickettsiae is possible. Co-infection with both R. conorii caspia and R. conorii israelensis is also a possibility. Another option is that the gltA and ompA fragments amplified were retrieved from the same strain, and the rickettsia detected in the five Rh. turanicus pools was a strain of R. conorii israelensis and not R. conorii caspia. In the case of any of these options, to the best of the authors’ knowledge, this is the first molecular evidence of R. conorii israelensis infection in Rh. turanicus ticks. Further molecular analysis is needed to definitely ascertain the identity of this rickettsial strain.

R. sibirica mongolitimonae DNA was found in one Hyalomma sp. tick. This rickettsia was first detected in Hyalomma asiaticum ticks from Mongolia [19]. Since then, it has been detected in Hyalomma truncatum from Niger [20], and has been associated with human infections in Greece, France, Spain, Portugal and South Africa [21–25]. The disease caused by this rickettsia is manifested by headache, fever, eschar formation, lymphangitis and lymphadenopathy [23]. To the best of our knowledge, this is the first report on the presence of R. sibirica mongolitimonae in Israel and the Middle East.

The presence of rickettsiae in free, questing adult ticks collected from the vegetation indicated that the ticks included in this study were subject to the rickettsial infestation at an earlier stage of their development. In the case of Rh. sanguineus, it has been shown that R. conorii is transmitted transovarially and transstadially [26,27]. To the best of our knowledge, the mode of transmission of the other rickettsiae detected in the corresponding ticks in this study, whether transovarial and/or transstadial, is not known. The current findings suggest transstadial transmission of the latter rickettsiae from the nymphal to the adult stage.

The molecular findings of this study suggest an increased variety and distribution of rickettsial organisms in novel geographical niches. The possibility that these pathogens existed in the region for many years but were erroneously diagnosed as R. conorii israelensis, a prevalent species in this region, cannot be ruled out; however, this is less likely. Reasons for the possible increased variety and widespread distribution of rickettsiae in this region may be associated with climate and other global changes [6]. Global warming has been suggested to increase the distribution regions of arthropod vectors and the effectiveness of pathogen transmission within them, and it has been associated with the emergence of severe rickettsioses [10,28]. Another possible mode of distribution is the introduction of infected ticks by migrating birds. Rickettsia aeschilimannii, Rickettsia helvetica and R. massiliae were identified in Hyalomma marginatum, Ixodes ventalloi and Rh. turanicus, respectively, which were collected from migrating wild birds [29]. As Israel is located on the main route of migrating birds from Europe and Asia to Africa, this mode of transmission is plausible.

In conclusion, this study reports the first detection of R. massiliae and R. sibirica mongolitimonae in ticks from Israel. Physicians should be aware of the emergence of these human pathogens in the eastern Mediterranean region.

Transparency Declaration

The authors declare no dual or conflicting interests.

Ancillary