HSP65-PRA identification of non-tuberculosis mycobacteria from 4892 samples suspicious for mycobacterial infections

Authors


Corresponding author: E. Jabbarzadeh, Department of Mycobacteriology, Pasteur Institute of Iran, No. 69, 12 Farvardin Avenue, Tehran, Iran
E-mail:e.jabbarzadeh@yahoo.com

Abstract

Various molecular methods have been used for the rapid identification of mycobacterial species. In this survey, evaluation of antibiotic resistance and PCR-restriction fragment length polymorphism analysis (PRA) of the hsp65 gene was carried out for identification of non-tuberculosis mycobacteria (NTM) isolates from different clinical specimens. Forty-eight different mycobacterial isolates were selected and followed by the conventional and PRA of hsp65 for species identification. The antibiotic susceptibility test was carried out according to standard methods. A 439 bp PCR product of hsp65 in all selected isolates was amplified and digested with the BstEII and HaeIII restriction enzymes. The restriction fragment length polymorphism (RFLP) patterns were analyzed for species identification. Using PRA for 48 mycobacterial selected isolates, including 15 M. tuberculosis, one M. bovis and all 32 isolates of NTM, revealed 11 different species among the NTM isolates. The most frequent NTM isolates were M. kansasii, M. gordonae III, M. marinum, M. chelonae, M. scrofluaceum and M. gastri. In most cases, the PRA results were perfectly in accordance with the classical biochemical method. Combination of resistance to rifampin and isoniazid was present among M. kansasi, M. gordoniae III, M. scrofluaceum, M. chelonae, M. marinum, M. gastri, M. gordoniae II and M. trivale isolates. A high incidence of co-resistance to six, five, four and three anti-TB drugs was observed in 18.5%, 9.1%, 6.6% and 11.7% of all NTM isolates, respectively. Our results showed that PRA, in comparison with classical methods, is rapid and accurate enough for the identification of mycobacterial species from LJ medium. Additionally, we found that in Iran we have a highly diverse population of NTM isolates among patients suspected of having TB.

Introduction

The genus Mycobacterium comprises more than 70 species, some of which are pathogenic to humans and animals and some of which are saprophytes. The Mycobacterium tuberculosis complex (MTBC) includes M. tuberculosis, M. bovis, M. microti, M. africanum and M. canetti. M. tuberculosis and M. bovis are the most common isolates in human tuberculosis and can be differentiated by biochemical tests, growth phenotypes and several genetic markers. Because of the AIDS pandemic, there has been a dramatic increase in the number of diseases caused by the Mycobacterium tuberculosis complex and non-tuberculosis mycobacteria (NTM) [1].

Identification of mycobacteria to species level is essential and provides useful information on epidemiology and facilitates successful treatment of patients. Classical identification of Mycobacteria based on cultural and biochemical tests is tedious and time-consuming and sometimes fails to report a correct identification. The variety of molecular techniques such as PCR and other nucleic acid amplification methods are widely used and overcome these disadvantages. Among these different methods, PCR-restriction fragment length polymorphism analysis (PRA) is preferred because it offers an easy, rapid and inexpensive method of identifying mycobacteria species in a single experiment. Moreover, the technique has been applied to several genes, for example 16S ribosomal DNA (rDNA), hsp65, dnaJ, groES and rpoB genes. The hsp65 gene coding for a 65 KDa protein is present in all the species of mycobacteria and contains epitopes that are unique as well as common to various species of mycobacteria [1–5].

Our aim was to evaluate the PRA method for differentiation of NTM isolates using the hsp65 gene PCR amplification. We have applied PRA followed by computer analysis to both reference and clinical isolates. Furthermore, to study the utility of PRA in identification of different mycobacteria species, we also characterized them by biochemical tests.

Material and Methods

Reference strains

The reference culture strains of M. tuberculosis (CRBIP7.11), M. chelonae (CIP104535), M. kansasii (CRBIP7.98), M. scrofluaceum (CRBIP7.163) and M. fortuitum (CRBIP17.99) were used as comparison controls in order to categorize the mycobacteria patterns in species identification grouping with the PRA method.

Mycobacterial strains

All the 4892 clinical samples, including sputum, synovial fluid, urine, tissue biopsy and bronchial fluid, collected from patients suspected of having tuberculosis, referred to the Mycobacteriology Department of the Pasteur Institute of Iran during January 2010 to May 2011, were investigated. Demographic and clinical details of each patient were collected during sampling. Direct microscopic examination and processing of cultures were carried out for presence of acid-fast bacilli according to the standard guidelines [6,7] The standard strains were also included as controls.

Biochemical tests

Identification of mycobacteria to species level was based on their growth rate, pigmentation and biochemical tests according to the CDC guidelines [7].

Antimicrobial susceptibility test

Susceptibility testing was performed by the proportional method using the critical concentrations of 40 μg/mL for rifampin, 0.2 μg/mL for isoniazid, 4 μg/mL for streptomycin, 2 μg/mL for ethambutol and 100 μg/mL for ethionamide. Interpretation of the results was performed according to the CDC guidelines [7].

DNA extraction

Two or three loops of freshly grown mycobacterial cultures from LJ medium were harvested and chromosomal DNA was purified using a silica gel column system (High pure DNA Extraction Kit, Roche Diagnostics, Manheim, Germany) and kept at −20°C until use.

PCR of hsp65

A set of primers including Tb11 (5′– CAACGATGGTGTGTCCCAT) and Tb12 (5′– CTTGTCGAACCGCATACCCT) were used. The PCR was carried out in a final volume of 25 μL, consisting of 5 μL of DNA, 200 μM of each of the deoxynucleoside triphosphates (dNTPs), 25 pmol of each primer, 1.5 mM MgCl2, 1.25 U Taq DNA polymerase and 2.5 μL of 10× PCR buffer. The reaction mixture was subjected to initial denaturation at 94°C for 5 min followed by 35 amplification cycles (60 s at 94°C, 60 s at 60°C and 60 s at 72°C). Final extension was carried out at 72°C for 10 min (Model 22331 Thermocycler; Eppendorf, Hamburg, Germany) [8]. Amplification of the 439 bp product of the hsp65 gene was detected by 1.5% agarose gel electrophoresis.

Restriction fragment length polymorphism

RFLP was carried out with the BstEII and HaeIII on all the standard strains first and then applied to isolates. PCR product (12.5 μL) was digested by 5 U of BstEII (Roche Diagnostics) or HaeIII (Roche Diagnostics) for 2 h at 37°C. The digested products were loaded on 3% agarose gel electrophoresis at 100 V for 2 h [8]. To interpret the PRA profiles generated by each species, a 50 bp ladder DNA size marker (MBI Fermentans, Bois-Noir, Germany) was used. The fragments were detected with ethidium bromide staining and UV transilluminator. The species identification according to the size of restriction fragments generated was estimated with the help of GelcomparII version 4.0 (Applied Maths, Sint-Matens-Latem, Belgium) and using an algorithm of PRA patterns of Telenti et al. [9] and Taylor et al. [10].

Results

According to the biochemical tests amongst studied isolates, 229 positive cultures were obtained, which included 183 M. tuberculosis, 14 Mbovis and 32 NTM strains. According to our patient’s questionnaire, 32 NTM isolated cases included 17 (53.1%) men and 15 (46.9%) women. Signs of TB, including coughing up sputum, weight loss, fatigue, fever and chills, hemoptysis and night sweats, were observed in 48.2%, 37.5%, 37.5%, 25%, 18.7% and 15.6%, respectively. We had five (15.6%) HIV cases among our studied population.

All M. tuberculosis isolates were non-pigmented, nitrate positive, niacin positive, resistant to Thiophen-2-Carboxylic Hydrazine (TCH), negative semi-quantitative (sq) catalase and stability of catalase activity at 68°C. Direct microscopic examination among M. tuberculosis culture-positive samples was negative in 37.5%, whereas 62.5% were positive.

Twenty-seven (84.3%) of 32 NTM isolates had negative results of direct microscopy smear. Susceptibilities were performed on all studied isolates. Eight of ten (80%) M. kansasi isolates, two of seven (27.8%) M. gordoniae III isolates and the only M. trivale isolate were resistant to all six tested anti-TB drugs (Fig. 1). A combination of resistance to rifampin and isoniazid was present among M. kansasi, M. gordoniae III, M. scrofluaceum, M. chelonae, M. marinum, M. gastri, M. gordoniae II and M. trivale isolates. A high incidence of co-resistance to six, five, four and three anti-TB drugs was observed in 18.5%, 9.1%, 6.6% and 11.7% of all NTM isolates, respectively (Fig. 1).

Figure 1.

 Dendrogram generated by the Gelcompar II software (Applied Maths) showing the relationship of mycobacterial isolates. The analysis of the bands generated was performed using the Dice coefficient and unweighted pair group method with arithmetic averages (UPGMA). TB, TB complex; A, atypical mycobacteria; Sp, sputum; S.F, synovial fluid; BAL, bronchio alveolar lavage; U, urine; N, negative; P, positive; R, resistant; S, sensitive; ETH, ethionamid; K, kanamycin; EMB, ethambutol; Rif, rifampin; St, streptomycin; INH, isoniazide. *HIV positive.

A 439 bp PCR product among all 48 mycobacterial studied isolates was detectable (Fig. 2).

Figure 2.

 Lane 1: 439 bp PCR product of hsp65 gene. Lanes 2, 3, 5 and 6: RFLP patterns of TB complex strains with BstEII. Lanes 4,7 and 8: RFLP patterns of NTM strain with BstEII. Lane 9: molecular weight marker.

Having performed RFLP on the PCR product of hsp65 and using the restriction profiles, the 48 selected clinical mycobacteria isolates were identified to species level. All M. tuberculosis clinical isolates were identified and produced a similar pattern to M. bovis and M. tuberculosis H37Rv strains. Among complex isolates of mycobacterium tuberculosis, during the BstEII digestion experiment, three fragments of 245, 120 and 80 bp were detected (Fig. 2),while during HaeIII digestion, three different fragments, including 160, 140 and 70 bp, were observed (Fig. 3). Restriction fragments shorter than 60 bp were not analysed for increase in the accuracy of strain detection.

Figure 3.

 Lanes 1 and 2: RFLP patterns of M. tuberculosis strains with HaeIII. Lane 3: RFLP patterns of M. bovis strain. Lane 4: RFLP patterns of NTM strain. Lane 5: molecular weight marker.

Among all different NTM isolates, the most frequent species were M. kansasii, M. gordonae III, M. marinum, M. chelonae, M. scrofluaceum and M. gastri, in ten, seven, three, three, three and two isolates, respectively (Table 1).

Table 1.   Summary of PRA results for the NTM isolates
PRA patternsBands with BstEIIBands with HaeIIINo. of isolates (%)
M. kansasii I 245/220140/105/809 (28.2)
M. gordonae III 245/120/100140/1207 (21.9)
M. marinum 245/220160/115/803 (9.4)
M. chelonae II 325/120140/65/603 (9.4)
M. scrofluaceum 245/220155/135/953 (9.4)
M. gastri 245/110/80140/105/702 (6.3)
M. gordonae II 245/120/80235/1151 (3.1)
M. gordonae IV 325/120140/115/70 or 601 (3.1)
M. trivale 180/1401 (3.1)
M. simiae I 245/220200/1351 (3.1)
M. flavescens II 245/220150/1001 (3.1)

The PRA results were perfectly in accordance with those of the classical biochemical method, except for one isolate, which was identified as M. flavescens II using the PRA method but reported as M. tuberculosis with biochemical tests (Table 2). We did not have any unknown NTM mycobacteria in our study.

Table 2.   Differentiation of mycobacterial strains into species level with the PRA and classical biochemical methods
SpeciesNo. of isolates
Classical biochemical method
 M. tuberculosis 15
 M. bovis 1
 Non-tuberculosis mycobacteria32
Total48
hsp65 RFLP
 M. tuberculosis complex15
 Non-tuberculosis mycobacteria33
Total48

Discussion

This study aims to give a broader view of the identification of NTM infections in humans using the PRA method, which is more accurate and rapid. Identification of species among mycobacteria is valuable because it provides useful information regarding patient management and proper treatment [11–13]. Outbreaks of NTM infections related to contaminated instruments in hospitals have been described all over the world. NTM can easily affect the skin and in immune-suppressed patients spread towards the pulmonary or lymph node system or even reproduce a systematic illness [14–16]. NTM disease patterns and epidemiology have changed since the 1980s and gradually emerged in unrecognized populations [17]. NTM are being increasingly recognized as significant human pathogens and the prevalence of disease caused by NTM is rising and species diversifying because of AIDS and other immune deficient conditions [11,16]. The infections caused by opportunistic mycobacteria entities are distinct from infections caused by M. tuberculosis. Environmental mycobacteria exhibit great variation in growth rates, colony morphologies and virulence and antibiotic sensitivities [17]. There is no general agreement about the treatment of patients with NTM infections [13,16,18]. In spite of high species diversity we found similar patterns of drug resistance between different NTM species.

The in vitro drug sensitivity tests are empirically applied to treat NTM infections. During these infections the failure of chemotherapy is often attributed to drug resistance. Variable results if in vitro drug sensitivity tests against NTM, causes the long duration of chemotherapy in NTM diseases [16,17].

It is therefore important to develop methods that provide precise and rapid results for identification of NTM from complex TB strains. These methods should be cost-effective and could be used in a wide variety of laboratories around world. Several molecular techniques have been used for identification of mycobacterial species, and among these methods PRA has advantages due to its ease and rapidity. This method targets conserved genes among all mycobacteria and shows sufficient sequence variation to differentiate them to the species level, such as hsp65 [2,3,8,11,14].

As species differentiation by the HaeIII restriction enzyme needs to detect polymorphisms of fragments smaller than 100 bp, this method requires special software analysis for interpretation of RFLP patterns and reduction of the gel to gel variations. We analysed the RFLP patterns with the aid of GelcomparII software because the virtual interpretations would be difficult due to the fact that one of the restricted bands differed by only 5–10 bp.

During the present study, out of the total number of isolates, 11 different mycobacterial species other than tuberculosis were identified. According to our results, NTM infections in Iran could be caused by 11 species, including M. simiae, M. gordonae II, M. trivale, M. gordonae IV, M. marinum, M. scrofluaceum, M. kansasii, M. chelonae, M. gordonae III, M. gastri and M. flavescens II, using the two restriction enzymes, Hae III and BstEII. These results indicate a high variation of species among NTM in clinical isolates in Iran. Three important factors that could increase the clinical cases of environmental mycobacteria are defects in disinfection of drinking water, disinfection in medical and industrial settings and an increasing percentage of our population with predisposing conditions, such as age and immunosuppressive regimens [14].

On the other hand, increases in the frequency of NTM infections throughout the world may have been due to a higher awareness of NTM disease among clinicians, which resulted in more requests for species identification of NTM infections.

Differentiations between four species of M. chelonae, M. fortuitum, M. kansasii and M. scrofluaceum, which are the most clinically important NTM, were possible using this method. PRA is useful for identifying clinical isolates giving mixed biochemical results, a situation that would require choosing between two or three closely related species. During the present study two isolates that were biochemically identified as M. tuberculosis were detected as NTM with the PRA method. These strains were contaminated with M. tuberculosis colonies. We used separate rooms for DNA extraction, PCR mix preparation and amplification to prevent PCR-related contamination and false identification. The inability of hsp65-RFLP to differentiate between M. tuberculosis and M. bovis depends on high DNA homology between these species.

M. kansasii had the most frequent cluster with ten isolates. In 1994 in Iran, among 82 NTM isolates, the percentages of atypical mycobacterial strains were M. fortuitum 26.8%, M. gastri 23.1% and M. terrae complex 18.3% [19]. According to the Shojaii et al. [11] report in 2011 in Iran, the three most prevalent NTM isolates were M. fortuitum, M. kansasii and M. gordoniae.

The different reports of mycobacterial species might be related to different geographical conditions and study populations [20].

According to statistical reports, the isolation of NTM increased significantly from 248 (19%) in 2003 to 407 (30%) in 2006, with the top five frequently isolated strains being the M. chelonae group, the M. avium-M. intracellulare complex, M. gordonae, the M. fortuitum group and M. kansasii [3].

NTM are distinguished from the members of the M. tuberculosis complex by the fact that they are not obligate pathogens. In endemic NTM regions such as Iran the PRA method has valuable potential because of its precise clinical results, which aid in patient management and prevention strategies. In developing countries with endemic TB such as Iran, because of the inadequacy of laboratory services, NTM infections have developed.

In spite of the recent profusion of new mycobacterial species, recent reports document that 30% of mycobacterial isolates from water, soil, air and patients do not belong to any of the identified species and there are a number of species yet to be discovered [12].

In summary, we found an increasing incidence and species diversity of NTM isolates from patients at our centre. The RFLP analysis of the 439 bp PCR product of the hsp65 gene after BstEII and HaeIII digestions is effective enough for differentiating mycobacteria at the species level. During the present study PRA was used on culture-positive cases and it is suggested that it should be used directly for clinical samples.

Transparency Declaration

The authors declare no conflict of interest.

Ancillary