You have full text access to this OnlineOpen article

Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns

  1. E. Bosch1,
  2. F. Calafell1,
  3. A. González-Neira1,†,
  4. C. Flaiz1,2,
  5. E. Mateu1,
  6. H.-G. Scheil3,
  7. W. Huckenbeck4,
  8. L. Efremovska5,
  9. I. Mikerezi6,
  10. N. Xirotiris7,
  11. C. Grasa8,
  12. H. Schmidt2,
  13. D. Comas1,*

Article first published online: 31 MAY 2006

DOI: 10.1111/j.1469-1809.2005.00251.x

Issue

Annals of Human Genetics

Annals of Human Genetics

Volume 70, Issue 4, pages 459–487, July 2006

Additional Information

How to Cite

Bosch, E., Calafell, F., González-Neira, A., Flaiz, C., Mateu, E., Scheil, H.-G., Huckenbeck, W., Efremovska, L., Mikerezi, I., Xirotiris, N., Grasa, C., Schmidt, H. and Comas, D. (2006), Paternal and maternal lineages in the Balkans show a homogeneous landscape over linguistic barriers, except for the isolated Aromuns. Annals of Human Genetics, 70: 459–487. doi: 10.1111/j.1469-1809.2005.00251.x

Author Information

  1. 1

    Unitat de Biologia Evolutiva, Universitat Pompeu Fabra, Barcelona, Spain

  2. 2

    Institute of Human Genetics and Anthropology, University of Ulm, Germany

  3. 3

    Institute of Human Genetics and Anthropology, Heinrich-Heine-University Düsseldorf, Germany

  4. 4

    Institute of Legal Medicine, Heinrich-Heine-University Düsseldorf, Germany

  5. 5

    Institute of Physiology, Medical Faculty Skopje, Republic of Macedonia

  6. 6

    Faculty of Natural Science, University Tirana, Albania

  7. 7

    Laboratory of Anthropology, Democritus University of Thrace, Komotini, Greece

  8. 8

    University Ovidius, Constanta, Romania

  1. †

    Current address: Departamento de Genética Humana, Centro Nacional de Investigaciones Oncológicas, Madrid, Spain.

* †Correspondence author: David Comas, Unitat de Biologia Evolutiva, Universitat Pompeu Fabra, Doctor Aiguader 80, 08003 Barcelona, Spain. Tel: +34 93 5422844; Fax: +34 93 5422802; E-mail: david.comas@upf.edu

Publication History

  1. Issue published online: 31 MAY 2006
  2. Article first published online: 31 MAY 2006
  3. Received: 22 July 2005 Accepted: 3 October 2005

SEARCH

SEARCH BY CITATION

ARTICLE TOOLS

Get PDF (715K)

Keywords:

  • Balkan Peninsula;
  • mitochondrial DNA;
  • Y chromosome;
  • genetic variation;
  • population genetics

Summary

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices

The Balkan Peninsula is a complex cultural mosaic comprising populations speaking languages from several branches of the Indo-European family and Altaic, as well as culturally-defined minorities such as the Aromuns who speak a Romance language. The current cultural and linguistic landscape is a palimpsest in which different peoples have contributed their cultures in a historical succession. We have sought to find any evidence of genetic stratification related to those cultural layers by typing both mtDNA and Y chromosomes, in Albanians, Romanians, Macedonians, Greeks, and five Aromun populations. We have paid special attention to the Aromuns, and sought to test genetically various hypotheses on their origins.

MtDNA and Y-chromosome haplogroup frequencies in the Balkans were found to be similar to those elsewhere in Europe. MtDNA sequences and Y-chromosome STR haplotypes revealed decreased variation in some Aromun populations. Variation within Aromun populations was the primary source of genetic differentiation. Y-chromosome haplotypes tended to be shared across Aromuns, but not across non-Aromun populations. These results point to a possible common origin of the Aromuns, with drift acting to differentiate the separate Aromun communities. The homogeneity of Balkan populations prevented testing for the origin of the Aromuns, although a significant Roman contribution can be ruled out.

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices

The cultural and linguistic landscape in the Balkan region is complex. The Peninsula is inhabited by peoples who speak languages from several branches of the Indo-European family, such as Greek, Albanian, Slavic (Croats, Serbians, Bulgarians and Macedonians) and Romance (Romanians and Aromuns), in addition to the Altaic Turk spoken since the Ottoman conquest of the 15th century. The Balkans have been inhabited since the Paleolithic, and the Neolithic entered Europe from Anatolia through the Balkan peninsula. The Bronze and Iron Ages were fully developed by Greeks, who controlled the eastern part of the Mediterranean until Roman rule. Romance languages spread into the Balkans with the military conquest of the Roman Empire, replacing other Indo-European languages except for the ancestors of modern Albanian and Greek. From the 6th century Slavic tribes spread over the Balkan provinces of the Byzantine Empire. It is well established that their languages replaced most Romance languages during the 9th and 10th centuries, except for Romanian that endured despite isolation from Western Romance languages, and Aromun (also known as Aromanian or Vlach), a linguistic isolate with unclear origins, scattered through the central Balkans. The Aromuns represent a small and almost unknown population that live scattered throughout the Balkans. They were previously semi-nomadic shepherds in the Balkan mountains, who settled only recently. Therefore, reliable statistical data about their size and dispersion are not available (Schmidt et al. 2001). Several hypotheses about the ethnogenesis of the Aromuns have been proposed (Schmidt et al. 2000): the Aromuns may be Latinised Greeks with some degree of Roman admixture, or the descendants of local populations living north (Dacians) or south (Thracians and Illyrians) of the Danube. However, the Aromuns represent a group defined by cultural traits such as lifestyle and language, and it remains to be proved whether they constitute a genetic unit.

Several genetic studies have provided a large amount of data on the Balkan populations, not only based on classical markers (Cavalli-Sforza et al. 1994) but also on autosomal STRs (Huckenbeck et al. 2001), Alu insertion polymorphisms (Comas et al. 2004), mitochondrial DNA (Calafell et al. 1996; Belledi et al. 2000; Richards et al. 2000; Malyarchuk et al. 2003) and the Y chromosome (Caglia et al. 1998; Rosser et al. 2000; Semino et al. 2000; Parreira et al. 2002; Di Giacomo et al. 2003; Robino et al. 2004). Most of these studies have focused on the impact of different human expansions in Europe, basically comparing the Paleolithic versus the Neolithic genetic contributions (Chikhi et al. 1998; Rosser et al. 2000; Semino et al. 2004), and/or looking at the existence of genetic structure in the extant populations of the continent (Comas et al. 1997; Simoni et al. 2000). Briefly, these studies have shown that the genetic diversity found in the Balkans fits with what is known about the European genetic landscape. However, these analyses are either European-wide or centered on one or a few Balkan populations, rather than on the Peninsula as a whole. An analysis of several Alu insertion polymorphisms in the Balkans, including Aromuns (Comas et al. 2004), has shown that Balkan populations share a common ancestry with no major genetic barriers and a lack of correlation between genetic differentiation and language or ethnicity. Nonetheless, the analysis of Alu insertion polymorphisms has its limitations, since they do not present a well-defined phylogeographic structure of the variation. In this sense other genetic markers, such as mitochondrial DNA (mtDNA) and the Y chromosome, may provide a more detailed view of the Balkan genetic landscape.

The aim of the present study was to analyse the genetic diversity of the two uniparental markers of our genome, the mtDNA and the Y chromosome, and take advantage of their well-defined phylogenies in order to unravel the population structure of the Balkans. Moreover, for both genome regions we analysed both stable and fast-mutating polymorphisms, which respond differently to different demographic events at different time scales. Around 400 bp of mtDNA sequence and seven SNPs in the coding region were typed, as well as 19 Y chromosome STRs and 22 binary polymorphisms. MtDNA and Y-chromosome results were also compared to other published available data, to describe the overall genetic picture of the Balkans, and we attempted to test the genetic effects of the different hypotheses suggested for the ethnogenesis of the Aromuns.

Material and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices

Subjects and Populations

Individuals from several Balkan groups were analysed for mtDNA and the Y chromosome. The sample set analyzed included: Albanians from Tirana, Greeks from Thrace, Macedonians from Skopje, Romanians from Constanta and from Ploiesti, Aromuns from Andon Poci and from Dukasi in Albania; Aromuns from Kogalniceanu in Romania, and Aromuns from Stip and from Krusevo in the Republic of Macedonia (Figure 1). Samples were taken from unrelated healthy blood donors and appropriate informed consent was obtained from all individuals participating in the study. DNA was extracted from fresh blood by either standard phenol-chloroform protocols or through the blood prep protocol recommended for extraction in the ABI PRISM™ 6700 Automated Nucleic Acid Workstation.

Figure 1. Geographic location of the samples analysed. Symbols represent the linguistic classification of the samples: Italic (stars), Slavic (circles), Greek (triangles), Albanian (square).

Download figure to PowerPoint

image

MtDNA Genotyping

MtDNA hypervariable region I was amplified using primers L15996 and H16401 (Vigilant et al. 1989) and the amplification products were subsequently purified with Exo-SAP. The sequence reaction was performed for each strand, using primers L15996 and H16401 with the ABI PRISM BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems) according to supplier's recommendations. Sequences from positions 16024 to 16391 are available in Appendix I, although for most of the analyses and comparisons only the DNA stretch from positions 16024 to 16383 was considered.

Seven positions in the mtDNA coding region (7028, 10400, 10873, 11151, 11719, 12308 and 12705) were also analysed by using the SNaPshot™ ddNTP Primer Extension Kit (Applied Biosystems), which consists of a single-base primer extension that uses labelled ddNTPs to interrogate SNPs. Two mtDNA regions containing the SNPs were amplified in a multiplex reaction using primers L10373, H12744, L7008 and H7896 (see Appendix II), with the following cycling conditions: 94°C for 5 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final elongation step of 72°C for 5 min. The amplification products were purified using the QIAquick™ PCR Purification Kit (QIAGEN). The single-base primer extension was performed following supplier's recommendations, using oligonucleotides L7028X, H10400X, L10873X, L11251X, L11719X, L12308X and L12705X in the same reaction (Appendix II). Unincorporated-labelled ddNTPs were removed by adding one unit of CIP to the primer extension products for one hour at 37°C, followed by an incubation of 15 min at 72°C to inactivate the enzyme. Products were run in an ABI PRISM377 and GeneScan Analysis Software v.3.7. was used to measure fragment sizes.

Each mtDNA molecule was assigned to one haplogroup according to the following strategy. Firstly, the combination of the seven SNPs in the coding region was taken into account to classify the mtDNA molecules into one of the eight major groups determined in the present analysis: L, M, N, R, U, HV, H, JT. Subsequently, the information yielded by the control region sequence was added, in order to refine the classification into haplogroups (Macaulay et al. 1999; Kivisild et al. 2002; Kong et al. 2003).

Published mtDNA sequences from several populations were used for comparison: Albanians (Belledi et al. 2000); Bulgarians, Greeks, Romanians from Maramures and Vrancea, Sarakatsani, Italians and Turks (Richards et al. 2000); Bosnians, Croatians and Serbians (Owens et al. 2002); and Bosnians and Slovenians (Malyarchuk et al. 2003).

Y-chromosome Genotyping

Y-chromosome binary polymorphisms were typed hierarchically using three different multiplex reactions. All samples were analyzed for markers M89, M172, M69, M201, M170, M9, 12f2 and M145 (multiplex I); those chromosomes assigned to clade K (M9 derived) according to the Y Chromosome Consortium (2002) were further characterised for markers M173, M45, SRY831, M207, M17 and PN25 (multiplex II), whereas those chromosomes belonging to clade DE (YAP derived branch) were further characterised for markers M96, P2, M123, M75, M78, M81, M33 and M35 (multiplex III). Amplification in multiplex was carried out in a two step PCR, using locus-specific amplification primers with a common 5´-end universal sequence at very low concentration, and adding a high concentration of universal zip code primers ZipALg1 and ZipBLg2 after 15 cycles (Appendix II). Conditions and amplification primer sequences were slightly modified from Paracchini et al. (2002), except for polymorphisms 12f2 and SRY10831 whose primer sequences were modified from Blanco et al. (2000) and Whitfield et al. (1995), respectively, by adding universal code sequences at the 5′ end. New amplification primers were designed for M69, M201, P2, M207, PN25 and M75 (Appendix II). PCR products were purified using SAP (Shrimp Alkaline Phosphatase) and Exo I (USB) to remove dNTPs and primers. The above-mentioned SNPs and the 12f2 indel were screened from the PCR generated templates by single base extension analysis, using the SNaPshot Multiplex Kit according to the manufacturer's instructions. For each set of multiplexed polymorphisms genotyping primers were designed with 4bp differing lengths (Appendix II). Unincorporated ddNTPs were removed, and the purified fragments separated and detected on a capillary electrophoresis platform as stated above.

RPS4Y711 was typed by sequencing using primers described in Kayser et al. (2001) in the two chromosomes carrying ancestral states for all markers in Multiplex I.

Amplification of 19 Y STRs was performed within three multiplex reactions (MS1: DYS19, DYS388, DYS390, DYS391, DYS392 and DYS393; EBF: DYS385, DYS389 I and II, DYS460, DYS461, DYS462 and amelogenin; and CTS: DYS434, DYS435, DYS436, DYS437, DYS438 and DYS439) slightly modified from Bosch et al. (2002). PCR products were mixed with 400HD ROX standard and run on a ABI3100. Allele analysis and designation was carried out using haplotyped reference controls and the GeneScan Analysis Software v.3.7. Allele designation followed the nomenclature used in the Y-Chromosome Haplotype Reference Database (YHRD, http://www.ystr.org/index.html).

Since some of the published data on paternal lineages based on binary markers (Semino et al. 2000; Di Giacomo et al. 2003; Cinnioglu et al. 2004) have different phylogenetic resolution, data were homogenised in order to allow population comparisons. Data on nine Y-specific microsatellites (DYS19, DYS389 I and II, DYS390, DYS391, DYS392, DYS393, DYS385) were available for Greeks (Parreira et al. 2002; Robino et al. 2004), Albanians (Robino et al. 2004), Russians (Ploski et al. 2002), Bulgarians (Zaharova et al. 2001), Hungarians from Budapest (Furedi et al. 1999), Italians from Rome (Caglia et al. 1998), Romanians (Barbarii et al. 2003) and Anatolian Turks (Nasidze et al. 2003).

Statistical Analyses

In order to detect possible genetic structure among populations, an analysis of the molecular variance (AMOVA, Excoffier et al. 1992) was performed using the Arlequin package ver 2.000 (Schneider, 1996; http://anthropologie.unige.ch/arlequin/). A correspondence analysis based on haplogroup frequencies was performed using SPSS 11.0.1 to establish the relationships between populations. This analysis provides a method for representing frequency data in Euclidian space, so that the results can be visually examined for structure (Greenacre, 1992). For data in a typical two-way contingency table, both the row variables (populations) and the column variables (haplogroups) are represented in the same space, allowing the gathering of the relationships not only from within row or column variables but also between row and column variables.

Pairwise distances for the mtDNA sequences and RST distance matrices for the Y-chromosome STRs were computed using Arlequin 2.000. The relationship between populations was also assessed through a multidimensional scaling (MDS) analysis, based on genetic distances among lineages and performed with the STATISTICA program. Haplogroup specific median joining networks (Bandelt et al. 1999) linking 19 STR haplotypes were constructed using the program Network 4.1 (http://www.fluxus-technology.com/). When constructing networks for each haplogroup, each STR was given a specific weight according to its variance within that haplogroup: the weight of the ith STR was calculated as 10Vm/Vi, where Vm is the mean variance of all STRs and Vi is the variance of the ith STR. DYS385 was included in the networks as two separate loci, even if our detection procedure could not discriminate the two repeated loci; however, since the networks were built within haplogroups, it may be less likely that apparently identical DYS385 configurations were, in fact, two different genotypes. DYS385 was also included in the diversity calculations, which may have caused slight underestimates.

Results and Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices

Mitochondrial DNA Lineages in the Balkans

The mtDNA haplogroup distribution found in the Balkans was similar to that found in other European populations (Belledi et al. 2000; Richards et al. 2000; Owens et al. 2002; Malyarchuk et al. 2003). The Balkan populations presented the characteristic European haplogroups (Table 1) with very little influence of Asian or African sequences (a maximum of 5% in Romanian Aromuns, comprising one C and one D Asian lineage). As previously described in European samples (Richards et al. 2000; Achilli et al. 2004), sequences belonging to the H haplogroup were the most prevalent in the Balkans, with frequencies around 40–50%; and with higher frequencies in Aromuns from Stip (66%). Haplogroup T1 was found at higher frequencies in Aromuns (7–14%) compared to other Balkan populations (under 7%), except for Romanians from Maramures and Vrancea (Richards et al. 2000) who presented similar values to those found in Aromuns. Haplogroup T1, jointly with haplogroups J and U3, have been suggested as founder Neolithic haplogroups in Europe (Richards et al. 2002); nonetheless, lineages belonging to the J and U3 haplogroups were found at similar levels in Aromun and non-Aromun populations.

Table 1.  MtDNA and Y-chromosome haplogroups frequencies in the Balkan populations analysed. Abbreviations: N, number of individuals; ALB, Albanians; GRE, Greeks; MAC, Macedonians; ROMC, Romanians from Constanta; ROMP, Romanians from Ploiesti; AAD, Aromuns from Dukasi in Albania; AAA, Aromuns from Andon Poci in Albania; AMK, Aromuns from Krusevo in Macedonia; AMS, Aromuns from the Stip region in Macedonia and ARO, Aromuns from Romania.
 ALBGREMACROMCROMPAADAAAAMKAMSARO
MtDNA (N)42253759463329333842
PreHV---0.068------
HV0.048-0.0270.034--0.034--0.048
V0.024-0.027-0.0430.061-0.0610.0260.024
H0.5000.4800.4590.4240.3910.3940.3790.3640.6580.405
J*0.048-0.0540.0510.1090.091---0.048
J1-0.008-0.0170.0650.0610.103-0.026-
J2---0.0170.022-----
T*-0.008--0.0220.0610.069---
T10.0240.0040.0540.0340.0430.1210.0690.1210.0790.143
T2-0.0040.0810.0170.022--0.061--
T30.024-0.027-----0.0260.024
T40.024---0.043-----
T5---0.017---0.061--
K0.048-0.0540.1190.0220.0300.0340.0610.0790.071
U*--0.0540.0340.022-----
U10.024-0.027-----0.053-
U2---0.0170.022-----
U3----0.022--0.0300.026-
U40.048-0.0540.017--0.0340.030-0.048
U5*-----0.091----
U5a0.0710.0040.0270.0510.0220.0610.0690.152-0.048
U5b-----0.0300.069--0.048
U7----------
R---0.034--0.034--0.024
N0.0950.0040.0270.0170.022-----
I-0.004--0.022-0.034---
W0.0240.0040.027-0.022-0.0340.030--
X-0.008-0.0340.065-0.0340.0300.0260.024
Other-0.008-------0.048
Y-chromosome (N)30415231363919436542
C-RPS4Y711---------0.048
E1-M33---0.032------
E3b1-M780.2330.1710.2120.0970.1390.1790.1580.1860.1850.071
E3b2-M81-------0.023--
E3b3-M123-0.0240.019-0.028-----
G-M2010.0330.0490.0380.1290.0830.103-0.070--
H-M690.067---0.028-----
I-M1700.1670.1950.2880.4190.3890.1790.4210.2090.1690.190
J(x2)-12f20.033---0.0280.026----
J2-M1720.1670.1950.1150.0650.1670.4620.0530.1160.2000.333
K(xP)-M90.0330.0240.038------0.095
R1*-M173×(R1a,R1b)--0.019-------
R1a1-M170.1330.2200.1350.0970.0560.026-0.1160.2150.024
R1b-PN250.1330.1220.1350.1610.0830.0260.3680.2790.2310.238

Not only the haplogroup composition, but also haplogroup and sequence diversities and the pairwise differences, were similar in the Balkan populations compared to other European samples (Table 2). Haplogroup diversity was similar across the Balkans, except for the Aromuns from Stip who presented a reduced number of haplogroups. Nevertheless, the sequence (haplotype) diversity and the mean pairwise difference values were not significantly different between populations. These values of diversity might not properly reflect demographic processes, such as founder effects, if several distantly-related lineages are present in the founder population. In order to test whether diversity within haplogroups was substantially different among populations, the weighted mean intralineage mean pairwise difference (WIMP; Hurles et al. 2002), which is a measure of the diversity found within haplogroups, was calculated. Again, similar values were found, although the Aromuns from Albania (Dukasi and Andon Poci) are the populations with the lowest WIMP values. Besides this fact, the Aromun populations presented similar mtDNA diversity values compared to the rest of the Balkan samples.

Table 2.  Haplogroup and haplotype diversity values in the Balkan populations analysed for mtDNA. Abbreviations: N, number of individuals; D, diversity; MPW, mean number of pairwise differences; WIMP, the weighted intralineage mean pairwise difference.
Mitochondrial DNANHaplogroupsD (haplogroups)SequencesD (sequences)MPWWIMP
Albanians42130.741 ± 0.070300.968 ± 0.0183.839 ± 1.9691.906
Greeks25110.770 ± 0.087200.963 ± 0.0295.360 ± 2.6752.205
Macedonians37140.784 ± 0.069280.978 ± 0.0143.934 ± 2.0171.500
Romanians Constanta59170.803 ± 0.049370.976 ± 0.0094.259 ± 2.1421.750
Romanians Ploiesti46180.834 ± 0.050340.979 ± 0.0124.837 ± 2.4042.047
Aromuns
Albania Dukasi33100.822 ± 0.056190.964 ± 0.0153.773 ± 1.9511.495
Albania Andon Poci29130.847 ± 0.060180.966 ± 0.0174.345 ± 2.2121.091
Macedonia Krusevo33110.837 ± 0.050240.972 ± 0.0165.447 ± 2.6912.466
Macedonia Stip3890.563 ± 0.094180.933 ± 0.0224.366 ± 2.2062.187
Romania Kogalniceanu42130.814 ± 0.053330.988 ± 0.0084.639 ± 2.3212.005

Paternal Lineages in the Balkans

The binary polymorphisms analysed split the Balkan Y chromosomes into fourteen paternal lineages (Figure 2; Table 1). Five of them were present in nearly all populations, and comprised 90% of the Y chromosomes analysed. These five haplogroups were found to characterize paternal lineages in southeastern Europe in a number of previous studies, where the geographical distribution that they encompass is also very well defined (Rosser et al. 2000; Semino et al. 2000, 2004; Wells et al. 2001; Barac et al. 2003; Cruciani et al. 2004).

Figure 2. Phylogeny of the Y-chromosome haplogroups found in Balkan populations. Binary markers analysed and haplogroups found are indicated on the phylogeny based on that published by the Y Chromosome Consortium (2002). To the right, representation of the haplogroup frequencies found in the Balkan populations analysed here: areas of circles are proportional to the number of chromosomes they contain. Population name abbreviations as in Table 1.

Download figure to PowerPoint

image

In contrast to the most frequent haplogroups, uncommon haplogroups in the Balkans appeared in only a fraction of the populations analysed (see Figure 2). Although the most predominant paternal lineages expected in the Balkans were present in all populations analysed, their differential contributions plus the presence of some uncommon haplogroups will further characterise each population's paternal diversity patterns. When Nei's estimator of diversity was applied to haplogroup frequencies, it revealed apparent high haplogroup diversity, with only Aromuns from Albania (Dukasi and Andon Poci) presenting a slightly lower diversity (Table 3).

Table 3.  Haplogroup and haplotype diversity values in the Balkan populations analysed for the Y chromosome. Abbreviations: N, number of individuals; D, diversity; MPW, mean number of pairwise differences; WIMP, the weighted intralineage mean pairwise difference
Y chromosomeNHaplogroupsD (haplogroups)Haplotypes% Individuals with private haplotypesD (haplotypes)MPWWIMP
Albanians3090.876 ± 0.2762793.330.993 ± 0.0119.901 ± 4.6604.133
Greeks4180.849 ± 0.0213882.930.995 ± 0.00710.220 ± 4.7635.351
Macedonians5290.835 ± 0.0264984.610.998 ± 0.00410.305 ± 4.7795.386
Romanians Constanta3170.783 ± 0.0583080.650.998 ± 0.00910.060 ± 4.7265.866
Romanians Ploiesti3690.805 ± 0.0503591.670.998 ± 0.0079.910 ± 4.6415.200
Aromuns
Albania Dukasi3970.729 ± 0.0551635.900.823 ± 0.0588.625 ± 4.0711.761
Albania Andon Poci1940.696 ± 0.062652.630.743 ± 0.0728.216 ± 3.9860.421
Macedonia Krusevo4370.831 ± 0.0253974.420.995 ± 0.00710.076 ± 4.6965.496
Macedonia Stip6550.810 ± 0.0102429.230.925 ± 0.0179.911 ± 4.5933.324
Romania Kogalniceanu4270.798 ± 0.0343166.670.982 ± 0.01010.943 ± 5.0765.632

The analysis of 19 rapidly evolving STR loci revealed 263 STR haplotypes, among which 223 (84.79%) were found only once (see Appendix III). Haplotype diversity was ≥0.990 in all non-Aromun populations and Aromuns from Krusevo, in contrast to the rest of the Aromun populations (Table 3). When the WIMP measure was applied Aromuns from Albania were much less diverse, indicating a strong drift effect on their paternal lineages, as was found for their maternal lineages. Aromuns from the Stip region of Macedonia showed intermediate diversities, while other Aromun groups were indistinguishable from non-Aromuns. No Y-STR haplotypes were shared between haplogroups. However, in order to avoid other confounding effects of the phylogeny, when quantifying the haplotype differentiation among populations we also explored Y-STR haplotype variation within each population, and within the most common paternal lineages, by means of median joining networks (Figure 3).

Figure 3. Median joining networks constructed using 19-locus STR haplotypes within haplogroups E3b1-M78, J2-M172, I-M170, R1a1-M17 and R1b-PN25. Circles represent haplotypes, with areas proportional to the number of individuals they contain. Reddish and yellowish colour circles represent Aromun populations, while bluish colour circles indicate non-Aromun populations.

Download figure to PowerPoint

image

E3b1-M78 chromosomes displayed a star-like network with two Y-STR haplotypes, ht17 and ht28 (Appendix III), in its centre, separated by just one repeat difference at DYS391. DYS460 displayed a nine-repeat allele in all but six (91%) of the E3b1-M78 chromosomes analysed here. With the possible exception of these six chromosomes, most of our E3b1-M78 chromosomes probably belong to the α cluster (Cruciani et al. 2004) within the E3b1-M78 lineage, characterised by the nine-repeat allele at DYS461, which has been reported as very common in the Balkans and the Aegean region. Two clusters could be distinguished in the J2-M172 network, probably reflecting the STR differentiation between any of its subclades and/or its unresolved paragroup J2-M172*. While the non-Aromun populations did not appear to display differences in distribution among these two clusters, the Y STR differentiation of J2-M172 chromosomes between Albanian Aromuns and the Aromun population from the Stip region in Macedonia was significant. Most of the haplotypes in the I-M170 network fell in a cluster, while the remaining were found in two main branches comprising both Aromuns and non-Aromuns. The R1a1-M17 network of haplotypes showed little structure, while R1b-PN25 was centered around a haplotype found only in Aromuns with non-Aromun haplotypes scattered all over the network. Again, the most frequent haplotypes were shared only among Aromuns.

A pattern shared by Y chromosomes in different haplogroups emerged: haplotype sharing was extensive within and between Aromun populations, but not among other Balkan populations, whose haplotypes clearly appeared scattered through the networks and separated by longer branches. This was also reflected by the fact that Aromun populations contained fewer individuals with private (population-specific) haplotypes (Table 3). Both observations could agree with a recent and common origin of Aromun paternal lineages.

Population Relationships and Genetic Structure in the Balkans

In order to visualise the relationships among the Balkan populations analysed and their surrounding neighbours, two approaches were followed: correspondence analyses based on haplogroup frequencies, and genetic distances represented in multidimensional scaling (MDS) plots.

The correspondence analysis based on mtDNA haplogroup frequencies (Figure 4a) showed a clear differentiation of the Turkish sample at one edge, characterised by haplogroups frequent in the Middle East. The rest of samples were clustered in the centre of the plot, with the exception of two Aromun samples from Dukasi in Albania and Krusevo in Macedonia, which were detached from the rest of samples. When the correspondence analysis based on Y-chromosome haplogroup frequencies was performed with the whole set of populations for comparison (Figure 4b), all the Balkan populations analysed in the present study, plus the additional Macedonians, Albanians, Italians, Greeks and the two Turkish samples clustered more or less together, separated from other Slavic populations (Croatians, Polish, Ukrainians and Czech-Slovakians) and the Hungarian sample that formed a more differentiated group.

Figure 4. Plot of the first two dimensions in the correspondence analysis from mtDNA (a) and Y-chromosome (b) haplogroup frequencies. Symbols represent the linguistic classification of the samples: Italic (stars), Slavic (full circles), Greek (triangles), Albanian (squares), Uralic (open circles), Turk (crosses). Abbreviations for populations typed in this study as in Table 1. Abbreviations for populations used for comparison: A) mtDNA: ALB1, Albanians (Belledi et al. 2000); GRE1, Greeks (Richards et al. 2000); ROMM and ROMV, Romanians from Maramures and Vrancea, respectively (Richards et al. 2000); BOS1 (Owens et al. 2002) and BOS2 (Malyarchuk et al. 2003), Bosnians; SLO, Slovenians (Malyarchuk et al. 2003); CRO, Croatians (Owens et al. 2002); SER, Serbians (Owens et al. 2002); TUR, Turks (Richards et al. 2000); ITA, Italians (Richards et al. 2000); SAR, Sarakatsani (Richards et al. 2000). B) Y-chromosome: ALB1, Albanians; CRO, Croatians; CZE-SLO, Czechs and Slovakians; HUN1, Hungarians; MAC1, Macedonians; POL, Polish; TUR1, Turks; and UKR, Ukranians (all from Semino et al. 2000); TUR2, Anatolian Turks (Cinnioglu et al. 2004); NITA, CITA, SITA, North, Central and South Italians respectively (Di Giacomo et al. 2003); GRE1, Continental Greeks (Di Giacomo et al. 2003); GRE2, Cretean Greeks (Di Giacomo et al. 2003) and GRE3, Greeks (Semino et al. 2000).

Download figure to PowerPoint

image

In order to represent the genetic distances between samples, an MDS was performed with the full data from mtDNA sequences. The plot of the first two dimensions of the MDS clustered most of the populations analysed, whereas the Aromun samples, especially the Aromuns from Dukasi, Stip and Krusevo, remained in the periphery of the plot (Figure 5a). On the other hand, the MDS plot based on RST distances, constructed from 9 STRs haplotypes in the Y chromosome, showed that Turks from Anatolia were highly differentiated from the Balkan region while Albanian Aromuns (from Andon Poci and Dukasi) were distinctly separated from the remaining Balkan populations (Figure 5b). This fact was also observed in an MDS plot based on the RST distances between 19 STR haplotypes (data not shown), considering only the samples typed in the present study. It is worth noting the central location of the Romanian Aromuns in all plots. This group was constituted two generations ago by Aromun immigrants from different Balkan origins (Schmidt et al. 2001), which explains their short genetic distances to other Aromun groups.

Figure 5. Multidimensional scaling analysis from distance matrices a: Pairwise distances between mtDNA sequences. b: Rst distances between Y-chromosome STR haplotypes. Abbreviations as in Figure 4. Stress values were 0.132 for mtDNA and 0.096 for the Y chromosome. Other samples: RUS, Russians (Ploski et al. 2002); GRE4 (Parreira et al. 2002) and GRE5 (Robino et al. 2004), Greeks; ALB2, Albanians (Robino et al. 2004); BUL, Bulgarians (Zaharova et al. 2001); HUN2, Hungarians from Budapest (Furedi et al. 1999); ITA, Italians from Rome (Caglia et al. 1998); ROM, Romanians (Barbarii et al. 2003), and TUR3, Anatolian Turks (Nasidze et al. 2003).

Download figure to PowerPoint

image

The analyses of population relationships based on stable and fast polymorphisms both in mtDNA and in the Y-chromosome showed that most of the Balkan populations form a homogeneous set, and are similar to surrounding populations. However, the faster evolving loci showed that some particular Aromun groups are differentiated from this common background. It should be noted that this is a descriptive analysis lacking any formal testing. In order to test the genetic structure in the Balkans, analyses of the molecular variance (AMOVA) were performed, considering the haplogroups or haplotypes of the mtDNA and the Y chromosome.

No significant differences were found considering mtDNA haplogroups in the AMOVA, neither considering all populations as a single group nor grouping populations according to Aromun affiliation, language or country (Table 4). When the same analysis was performed on the mtDNA sequences, significant differences were found between Aromuns and non-Aromuns, as well as significant heterogeneity found within Aromun samples. Again, the genetic sequence diversity apportioned by grouping Balkan samples by language or country was not significant. The AMOVA for the Y chromosome showed significant differences in haplogroup and 19-STR haplotype composition between populations in the Balkan region. These differences were mainly the result of the heterogeneity found in the Aromun populations, given that non-Aromun populations alone did not show significant differentiation among themselves (Table 4). No significant differences (p > 0.05) were found either between Aromuns and non-Aromun populations or between different groupings based on country or language affiliation.

Table 4.  Analysis of Molecular Variance (AMOVA) in the Balkan populations analysed using mtDNA and Y-chromosome data. Language: all populations grouped by language. Country: populations grouped by country. HG: haplogroups, HT: haplotypes, ns not significant, *p < 0.05, **p < 0.01, ***p < 0.001
AMOVA Among groupsAmong populationsWithin populations
MtDNA (HG)Balkans 0.51 ns99.49
Non-Aromun −0.31 ns100.31
Aromun 1.40 ns98.60
Aromuns vs non-Aromun0.08 ns0.47 ns99.45
Aromuns vs Romanians−0.09 ns0.97 ns99.11
Aromuns vs Greeks−1.26 ns1.42 ns99.84
Language−0.90 ns0.96 ns99.94
Country−0.30 ns0.75 ns99.55
MtDNA (HT)Balkans 1.16 ***98.84
Non-Aromun 0.63 ns99.37
Aromun 1.17 *98.83
Aromuns vs non-Aromun0.49 *0.88 ***98.63
Aromuns vs Romanians0.16 ns1.25 *98.60
Aromuns vs Greeks0.48 ns1.07 *98.45
Language−0.50 ns1.41 *99.09
Country−0.17 ns1.29 ns98.88
Y-chr. (HG)Balkans 2.95***97.05
Non-Aromun 0.26 ns99.74
Aromun 4.78***95.22
Aromuns vs non-Aromun0.65 ns2.58***96.77
Aromuns vs Romanians2.05 ns3.69***94.26
Aromuns vs Greeks−2.74 ns4.82***97.92
Language−2.96 ns4.61**98.35
Country−0.51 ns3.35**97.15
Y-chr. (HT) 19 STRsBalkans 5.52***94.48
Non-Aromun 0.23 ns99.77
Aromun 9.54***90.46
Aromuns vs non-Aromun0.34 ns5.31***94.34
Aromuns vs Romanians−0.36 ns8.45***91.91
Aromuns vs Greeks−6.06 ns10.21***95.86
Language−5.14 ns8.46**96.67
Country−0.23 ns5.70***94.53

This set of analyses, in agreement with the graphical description presented above (i.e. correspondence analysis and MDS), shows that the main source of genetic differentiation in the Balkans is due to some, but not all, Aromun groups. This pattern is more evident in the fast evolving sites.

Drift in the Aromuns

All the Balkan populations analysed here were genetically homogeneous with the exception of some Aromun samples. This was particularly evident with the Y chromosome, as both haplogroup and 19 STR haplotype based data showed significant differences (p < 0.001) among the Aromun groups. Therefore, it seems that the Aromun populations do not constitute a homogenous group separated from the rest of the Balkan populations, but that they present relative heterogeneity, especially for paternal lineage composition, between themselves. The non-significance of the paternal differentiation of Aromun populations versus non-Aromuns is probably due to this high Aromun heterogeneity, meaning that most genetic distances between any Aromun group pair are greater than those between any non-Aromun population pair. In spite of their possible historical common origin, the geographical isolation between the Aromun populations analysed, plus the cultural isolation from their neighbours, may have favoured the action of genetic drift on their paternal lineage composition even at the level of binary markers. The reduction in both haplogroup and haplotype internal diversity values in some Aromun populations also agrees with the action of drift. Moreover, each Y chromosome haplogroup can be taken as an independent view of the evolutionary process, and does not have to display exactly the same pattern given the randomness of the evolutionary process. However, the repeated pattern in all the paternal lineages found in shared haplotypes between Aromun populations, and the low fraction of individuals with private haplotypes among the Aromuns, provides further evidence of the effect of genetic drift in these populations.

Although mtDNA haplogroup composition was not significantly different among the Aromun groups, we observed certain haplogroup and haplotype diversity reduction for those Aromuns from Stip in Macedonia, plus significant differences (p < 0.05) in mtDNA haplotype composition among the Aromun populations (Table 4). Particular Aromun groups, such as those from Andon Poci and Dukasi in Albania showed lower haplogroup and haplotype diversities with the Y chromosome, while their mtDNA diversities were similar to those of other Aromun groups and Balkan populations. Ethnological observations for those localities evidenced a pattern of patrilocality, with an inflow of Aromun women from other regions and villages. This process would replenish mtDNA diversities while maintaining high levels of Y-chomosome drift.

Origins of the Aromuns

Several hypotheses have been proposed for the origin of the Aromuns (Schmidt, 2000; Comas et al. 2004): i) Aromuns are Latinised Greeks; ii) Aromuns (and present Romanians) are descendants of Dacians (who lived north of the Danube), or iii) Aromuns are descendants of Thracians (who lived south of the Danube). Moreover, all three scenarios could have introduced different degrees of Roman admixture. All three scenarios might have produced different genetic outcomes, with being Aromuns being genetically closer to Greeks, Romanians, or other populations from the south of the Balkans, respectively. However, the possibility of testing these hypotheses depends on these populations being genetically differentiated. While Y chromosome variation has been previously reported as being very well structured geographically (Rosser et al. 2000; Semino et al. 2000), mtDNA lineages are believed to be much more homogeneous between geographically close populations (Simoni et al. 2000). Besides, our ability to discern the possible genetic origin of the Aromuns also depends on the action of drift, as this may have erased such traces or their origins.

As shown in the AMOVAs (Table 4), Aromuns as a group were not significantly different either from Romanians or from Greeks, considering both haplotypes and haplogroups for both uniparental markers. The comparison of genetic distances among the different Aromun groups and their surrounding neighbours, when using mtDNA sequences, revealed great genetic homogeneity in the Balkan peninsula and in particular no significant differences (P < 0.05) among Greeks, Italians, Romanians and Bulgarians or Macedonians (the last two being taken as proxies for other southern Balkan populations). This result implies that the power to test the proposed hypotheses is not sufficient, at least for the maternal lineages. The Balkan region also appears relatively homogenous when using both Y chromosome STRs or haplogroup frequency data. The comparison of RST distances when using Y chromosome 9-STR haplotypes displayed no significant differences (P > 0.05) among Greeks, Romanians, Macedonians or Bulgarians implying that we cannot distinguish between the second and third hypotheses. However, we did have enough statistical power to test a Roman (Italian) paternal contribution in the Aromun populations. Therefore, we could only distinguish the first hypothesis if “Latinised Greeks” implied a major Roman (Italian) contribution to the Aromuns.

Y STR based RST distances between most Aromun groups and Italians were shorter than those between Italians and Greeks, although all Aromuns groups are much closer to Greeks than to Italians. Visual inspection revealed that the only Y chromosome lineage that had frequencies in the Aromuns that were closer to those in Italians than in the rest of the Balkans was P*(×R1a). These frequencies were between 0.057-0.279 in the Aromuns, 0.083–0.161 in the rest of the Balkans and 0.240-0.630 in Italy. This situation could indicate paternal gene flow mediated by the Romans, as foreseen by the first hypothesis. However, when the YHRD database was queried for the nine-locus “minimal haplotype” (DYS19, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS385I/II) corresponding to the P*(×R1a) Y chromosomes found in the Aromuns, it showed few instances of matches in Italians but not in the Balkans. On the contrary, nine P*(×R1a) Aromun minimal haplotypes, belonging to a total 18 individuals, had no matches in the YHRD. This indicates that the increased frequencies of P*(×R1a) Y chromosomes in the Aromuns seem to be due to drift rather than to external gene flow.

The present study provides an insight into understanding the genetic structure of the Balkans. Although the linguistic and cultural diversity found in the region could have acted as an important genetic barrier, Balkan populations have been shown to be genetically homogenous, and in concordance with the European genetic continuum, using both autosomal and uniparental markers even with the deep levels of resolution conferred by the large set of markers we typed. Linguistic and other cultural differences were probably introduced into genetically homogeneous groups and/or these cultural barriers were not strong enough to prevent genetic flow between populations. However, genetic evidence shows an exception to this pattern: in some particular cases cultural isolation seems to have given rise to small population groups that have become different through drift from the common genetic substrate. This may be the case for some, but not all, Aromun populations.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices

We thank Mònica Vallés, Anna Pérez-Lezaun, Roger Anglada and Stéphanie Plaza, Universitat Pompeu Fabra, Barcelona, for technical support and advice. We especially acknowledge Mary-Claire King, University of Washington; and Vincent Macaulay, University of Glasgow, for details of some published Balkan mtDNA sequences. Funding was provided by project B0S 2001-0794 granted by the Spanish Ministry of Science and Technology.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices
  • Achilli, A., Rengo, C., Magri, C., Battaglia, V., Olivieri, A., Scozzari, R., Cruciani, F., Zeviani, M., Briem, E., Carelli, V., Moral, P., Dugoujon, J. M., Roostalu, U., Loogvali, E. L., Kivisild, T., Bandelt, H. J., Richards, M., Villems, R., Santachiara-Benerecetti, A. S., Semino, O. & Torroni, A. (2004) The molecular dissection of mtDNA haplogroup H confirms that the Franco-Cantabrian glacial refuge was a major source for the European gene pool. Am J Hum Genet 75, 910–918.
  • Bandelt, H. J., Forster, P. & Rohl, A. (1999) Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16, 37–48.
  • Barac, L., Pericic, M., Klaric, I. M., Janicijevic, B., Parik, J., Rootsi, S. & Rudan, P. (2003) Y chromosome STRs in Croatians. Forensic Sci Int 138, 127–133.
  • Barbarii, L. E., Rolf, B. & Dermengiu, D. (2003) Y-chromosomal STR haplotypes in a Romanian population sample. Int J Legal Med 117, 312–315.
  • Belledi, M., Poloni, E. S., Casalotti, R., Conterio, F., Mikerezi, I., Tagliavini, J. & Excoffier, L. (2000) Maternal and paternal lineages in Albania and the genetic structure of Indo-European populations. Eur J Hum Genet 8, 480–486.
  • Blanco, P., Shlumukova, M., Sargent, C. A., Jobling, M. A., Affara, N. & Hurles, M. E. (2000) Divergent outcomes of intrachromosomal recombination on the human Y chromosome: male infertility and recurrent polymorphism. J Med Genet 37, 752–758.
  • Bosch, E., Lee, A. C., Calafell, F., Arroyo, E., Henneman, P., De Knijff, P. & Jobling, M. A. (2002) High resolution Y chromosome typing: 19 STRs amplified in three multiplex reactions. Forensic Sci Int 125, 42–51.
  • Caglia, A., Dobosz, M., Boschi, I., D'Aloja, E. & Pascali, V. L. (1998) Increased forensic efficiency of a STR-based Y-specific haplotype by addition of the highly polymorphic DYS385 locus. Int J Legal Med 111, 142–146.
  • Calafell, F., Underhill, P., Tolun, A., Angelicheva, D. & Kalaydjieva, L. (1996) From Asia to Europe: mitochondrial DNA sequence variability in Bulgarians and Turks. Ann Hum Genet 60, 35–49.
    Direct Link:
  • Cavalli-Sforza, L. L., Menozzi, P. & Piazza, A. (1994) The history and geography of human genes. Princeton University Press, Princeton , N.J.
  • Chikhi, L., Destro-Bisol, G., Bertorelle, G., Pascali, V. & Barbujani, G. (1998) Clines of nuclear DNA markers suggest a largely neolithic ancestry of the European gene pool. Proc Natl Acad Sci U S A 95, 9053–9058.
  • Cinnioglu, C., King, R., Kivisild, T., Kalfoglu, E., Atasoy, S., Cavalleri, G. L., Lillie, A. S., Roseman, C. C., Lin, A. A., Prince, K., Oefner, P. J., Shen, P., Semino, O., Cavalli-Sforza, L. L. & Underhill, P. A. (2004) Excavating Y-chromosome haplotype strata in Anatolia. Hum Genet 114, 127–148.
  • Comas, D., Calafell, F., Mateu, E., Pérez-Lezaun, A., Bosch, E. & Bertranpetit, J. (1997) Mitochondrial DNA variation and the origin of the Europeans. Hum Genet 99, 443–449.
  • Comas, D., Schmid, H., Braeuer, S., Flaiz, C., Busquets, A., Calafell, F., Bertranpetit, J., Scheil, H. G., Huckenbeck, W., Efremovska, L. & Schmidt, H. (2004) Alu insertion polymorphisms in the Balkans and the origins of the Aromuns. Ann Hum Genet 68, 120–127.
    Direct Link:
  • Cruciani, F., La Fratta, R., Santolamazza, P., Sellitto, D., Pascone, R., Moral, P., Watson, E., Guida, V., Colomb, E. B., Zaharova, B., Lavinha, J., Vona, G., Aman, R., Cali, F., Akar, N., Richards, M., Torroni, A., Novelletto, A. & Scozzari, R. (2004) Phylogeographic analysis of haplogroup E3b (E-M215) y chromosomes reveals multiple migratory events within and out of Africa. Am J Hum Genet 74, 1014–1022.
  • Di Giacomo, F., Luca, F., Anagnou, N., Ciavarella, G., Corbo, R. M., Cresta, M., Cucci, F., Di Stasi, L., Agostiano, V., Giparaki, M., Loutradis, A., Mammi, C., Michalodimitrakis, E. N., Papola, F., Pedicini, G., Plata, E., Terrenato, L., Tofanelli, S., Malaspina, P. & Novelletto, A. (2003) Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects. Mol Phylogenet Evol 28, 387–395.
  • Excoffier, L., Smouse, P. E. & Quattro, J. M. (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, 479–491.
  • Furedi, S., Woller, J., Padar, Z. & Angyal, M. (1999) Y-STR haplotyping in two Hungarian populations. Int J Legal Med 113, 38–42.
  • Greenacre, M. (1992) Correspondence analysis in medical research. Stat Methods Med Res 1, 97–117.
  • Huckenbeck, W., Scheil, H. G., Schmidt, H. D., Efremovska, L. & Xirotiris, N. (2001) Population genetic studies in the Balkans. II. DNA-STR-systems. Anthropol Anz 59, 213–225.
  • Hurles, M. E., Nicholson, J., Bosch, E., Renfrew, C., Sykes, B. C. & Jobling, M. A. (2002) Y chromosomal evidence for the origins of oceanic-speaking peoples. Genetics 160, 289–303.
  • Kayser, M., Brauer, S., Weiss, G., Schiefenhovel, W., Underhill, P. A. & Stoneking, M. (2001) Independent histories of human Y chromosomes from Melanesia and Australia. Am J Hum Genet 68, 173–190.
  • Kivisild, T., Tolk, H. V., Parik, J., Wang, Y., Papiha, S. S., Bandelt, H. J. & Villems, R. (2002) The emerging limbs and twigs of the East Asian mtDNA tree. Mol Biol Evol 19, 1737–1751.
  • Kong, Q. P., Yao, Y. G., Sun, C., Bandelt, H. J., Zhu, C. L. & Zhang, Y. P. (2003) Phylogeny of east Asian mitochondrial DNA lineages inferred from complete sequences. Am J Hum Genet 73, 671–676.
  • Macaulay, V., Richards, M., Hickey, E., Vega, E., Cruciani, F., Guida, V., Scozzari, R., Bonne-Tamir, B., Sykes, B. & Torroni, A. (1999) The emerging tree of West Eurasian mtDNAs: a synthesis of control-region sequences and RFLPs. Am J Hum Genet 64, 232–249.
  • Malyarchuk, B. A., Grzybowski, T., Derenko, M. V., Czarny, J., Drobnic, K. & Miscicka-Sliwka, D. (2003) Mitochondrial DNA variability in Bosnians and Slovenians. Ann Hum Genet 67, 412–425.
    Direct Link:
  • Nasidze, I., Schadlich, H. & Stoneking, M. (2003) Haplotypes from the Caucasus, Turkey and Iran for nine Y-STR loci. Forensic Sci Int 137, 85–93.
  • Owens, K. N., Harvey-Blankenship, M. & King, M. C. (2002) Genomic sequencing in the service of human rights. Int J Epidemiol 31, 53–58.
  • Paracchini, S., Arredi, B., Chalk, R. & Tyler-Smith, C. (2002) Hierarchical high-throughput SNP genotyping of the human Y chromosome using MALDI-TOF mass spectrometry. Nucleic Acids Res 30, e27.
  • Parreira, K. S., Lareu, M. V., Sanchez-Diz, P., Skitsa, I. & Carracedo, A. (2002) DNA typing of short tandem repeat loci on Y-chromosome of Greek population. Forensic Sci Int 126, 261–264.
  • Ploski, R., Wozniak, M., Pawlowski, R., Monies, D. M., Branicki, W., Kupiec, T., Kloosterman, A., Dobosz, T., Bosch, E., Nowak, M., Lessig, R., Jobling, M. A., Roewer, L. & Kayser, M. (2002) Homogeneity and distinctiveness of Polish paternal lineages revealed by Y chromosome microsatellite haplotype analysis. Hum Genet 110, 592–600.
  • Richards, M., Macaulay, V., Hickey, E., Vega, E., Sykes, B., Guida, V., Rengo, C., Sellitto, D., Cruciani, F., Kivisild, T., Villems, R., Thomas, M., Rychkov, S., Rychkov, O., Rychkov, Y., Golge, M., Dimitrov, D., Hill, E., Bradley, D., Romano, V., Cali, F., Vona, G., Demaine, A., Papiha, S., Triantaphyllidis, C., Stefanescu, G., Hatina, J., Belledi, M., Di Rienzo, A., Novelletto, A., Oppenheim, A., Norby, S., Al-Zaheri, N., Santachiara-Benerecetti, S., Scozari, R., Torroni, A. & Bandelt, H. J. (2000) Tracing European founder lineages in the Near Eastern mtDNA pool. Am J Hum Genet 67, 1251–1276.
  • Richards, M., Macaulay, V., Torroni, A. & Bandelt, H. J. (2002) In search of geographical patterns in European mitochondrial DNA. Am J Hum Genet 71, 1168–1174.
  • Robino, C., Varacalli, S., Gino, S., Chatzikyriakidou, A., Kouvatsi, A., Triantaphyllidis, C., Di Gaetano, C., Crobu, F., Matullo, G., Piazza, A. & Torre, C. (2004) Y-chromosomal STR haplotypes in a population sample from continental Greece, and the islands of Crete and Chios. Forensic Sci Int 145, 61–64.
  • Rosser, Z. H., Zerjal, T., Hurles, M. E., Adojaan, M., Alavantic, D., Amorim, A., Amos, W., Armenteros, M., Arroyo, E., Barbujani, G., Beckman, G., Beckman, L., Bertranpetit, J., Bosch, E., Bradley, D. G., Brede, G., Cooper, G., Corte-Real, H. B., De Knijff, P., Decorte, R., Dubrova, Y. E., Evgrafov, O., Gilissen, A., Glisic, S., Golge, M., Hill, E. W., Jeziorowska, A., Kalaydjieva, L., Kayser, M., Kivisild, T., Kravchenko, S. A., Krumina, A., Kucinskas, V., Lavinha, J., Livshits, L. A., Malaspina, P., Maria, S., McElreavey, K., Meitinger, T. A., Mikelsaar, A. V., Mitchell, R. J., Nafa, K., Nicholson, J., Norby, S., Pandya, A., Parik, J., Patsalis, P. C., Pereira, L., Peterlin, P., Pielberg, G., Prata, M. J., Previdere, C., Roewer, L., Rootsi, S., Rubinsztein, D. C., Saillard, J., Santos, F. R., Stefanescu, G., Sykes, B. C., Tolun, A., Villems, R., Tyler-Smith, C. & Jobling, M. A. (2000) Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Am J Hum Genet 67, 1526–1543.
  • Schmidt, H. S., Scheil, H.-G. & Scheffrahn, W. (2000) The History and Genetics of the Aromun Populations. Biennial Books of EAA 2000 1, 29–37.
  • Schmidt, H., Efremovska, L. & Handziski, Z. (2001) Isonymy, consanguinity and repeated pairs of surnames in Aromun populations. Anthropol Anz 59, 193–202.
  • Schneider, S. K., Roessli, D. & Excoffier, L. (1996) Arlequin (ver.1.0): a software enviroment for the analysis of population genetics data. University of Geneva , Geneva , Switzerland .
  • Semino, O., Magri, C., Benuzzi, G., Lin, A. A., Al-Zahery, N., Battaglia, V., Maccioni, L., Triantaphyllidis, C., Shen, P., Oefner, P. J., Zhivotovsky, L. A., King, R., Torroni, A., Cavalli-Sforza, L. L., Underhill, P. A. & Santachiara-Benerecetti, A. S. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Am J Hum Genet 74, 1023–1034.
  • Semino, O., Passarino, G., Oefner, P. J., Lin, A. A., Arbuzova, S., Beckman, L. E., De Benedictis, G., Francalacci, P., Kouvatsi, A., Limborska, S., Marcikiae, M., Mika, A., Mika, B., Primorac, D., Santachiara-Benerecetti, A. S., Cavalli-Sforza, L. L. & Underhill, P. A. (2000) The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Science 290, 1155–1159.
  • Simoni, L., Calafell, F., Pettener, D., Bertranpetit, J. & Barbujani, G. (2000) Geographic patterns of mtDNA diversity in Europe. Am J Hum Genet 66, 262–278.
  • Vigilant, L., Pennington, R., Harpending, H., Kocher, T. & Wilson, A. (1989) Mitochondrial DNA sequences in single hairs from a southern African population. Am J Hum Genet 86, 9350–9354.
  • Wells, R. S., Yuldasheva, N., Ruzibakiev, R., Underhill, P. A., Evseeva, I., Blue-Smith, J., Jin, L., Su, B., Pitchappan, R., Shanmugalakshmi, S., Balakrishnan, K., Read, M., Pearson, N. M., Zerjal, T., Webster, M. T., Zholoshvili, I., Jamarjashvili, E., Gambarov, S., Nikbin, B., Dostiev, A., Aknazarov, O., Zalloua, P., Tsoy, I., Kitaev, M., Mirrakhimov, M., Chariev, A. & Bodmer, W. F. (2001) The Eurasian heartland: a continental perspective on Y-chromosome diversity. Proc Natl Acad Sci U S A 98, 10244–10249.
  • Whitfield, L. S., Sulston, J. E. & Goodfellow, P. N. (1995) Sequence variation of the human Y chromosome. Nature 378, 379–380.
  • Y Chromosome Consortium (2002) A nomenclature system for the tree of human Y-chromosomal binary haplogroups. Genome Res 12, 339–348.
  • Zaharova, B., Andonova, S., Gilissen, A., Cassiman, J. J., Decorte, R. & Kremensky, I. (2001) Y-chromosomal STR haplotypes in three major population groups in Bulgaria. Forensic Sci Int 124, 182–186.

Appendices

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. Results and Discussion
  6. Acknowledgments
  7. References
  8. Appendices
Table Appendix I.  Mitochondrial DNA sequences in the Balkans Thumbnail image of Thumbnail image of Thumbnail image of Thumbnail image of Thumbnail image of
Table Appendix II.  Primers (5′ to 3′) used in the SNaPshot protocol
Mitochondrial DNA Typing primers
 Amplification primers  Multiplex I
  L7008: ACTAGACATCGTACTACACG  M89: A4GGCAAAGTGAGAGAT
  H7896: GTACTCGTACCTTCAGTACC  M172: A7TAATTGAAGACCTTTTAAGT
  L10373: CCCTAAGTCTGGCCTATGAG  M69: A11GGCTGTTTACACTCCTGAAA
  H12744: CGATGAACAGTTGGAATAGG  M201: A5TCATCCAACACTAAGTACCTATTACGAAAA
 Typing primers  M170: A13TGAGACACAACCCACACTGAAAAAAA
  L7028X: CACGTACTACGTTGTAGC  M9: A13CTGCAAAGAAACGGCCTAAGATGGTTGAAT
  H10400X: TGTTTAAACTATATACCAATTC  12f2: A21TCCCTTCCTTACACCTTATACAAAAA
  L10873X: T9CCACAGCCTAATTATTAGCATCATCCC  M145: A28TCCTAGACACCAGAAAGAAAGGC
  L11251X: T18GGCTCCCTTCCCCTACTCATCGCACT  Multiplex II
  L11719X: T15CAGTCATTCTCATAATCGCCCACGG  M173: A2TCAAGGGCATTTAGAAC
  L12308X: CAGCTATCCATTGGTCTTAGGCCCCAA  M45: A6GTGAAAAATTATAGATA
  L12705X: AACATTAATCAGTTCTTCAAATATCTACTCAT  SRY10831: A9TGAACCTTGAAAATGTTA
Y chromosome  M207: A11TAAGTCAAGCAAGAAATTTA
 Zip code primers  M17: A14GTGGTTGCTGGTTGTTACGGG
  ZipALg1: GGAGCACGCTATCCCGTTAGAC  PN25: A13TGAATTATCTGCCTGAAACCTGCCTG
  ZipBLg2: CGCTGCCAACTACCGCACATG  Multiplex III
 Amplification primers  M96: A3CAGGTCTCTCATAATA
  M69F: ZipALg1-TGAAGGAATCAGCCATTT CA  P2: A6TGCCCCTAGGAGGAGAA
  M69R: ZipBLg2-TGGCATGAAGCATGTAAGGA  M123: A9CTAGGTATTCAGGCGATG
  M201F: ZipALg1-TTGTGTGTGTATGCATTTGTTGA  M75: A10GACAATTATCAAACCACATCC
  M201R: ZipBLg2-ACATCATGGTGTGACGAACG  M78: A17TGAAATATTTGGAAGGGC
  P2F: ZipALg1-GAGAATCAGCTCCAGCCATC  M81: A19GTGTGAGTATACTCTATGAC
  P2R: ZipBLg2-TTCTCTCATGAGGGTTTTGGA  M33: A25TCTCATAAGTTACTGTTA
  M207F: ZipALg1-GGGGCAAATGTAAGTCAAGC  M35: A28CGGAGTCTCTGCCTGTGTC
  M207R: ZipBLg2-TCCTCTCTGAAATGCCGAAT 
  PN25F: ZipALg1-AACCTGGAGCATGATCACAC 
  PN25R: ZipBLg2-GGACCATCACCTGGGTAAAGT 
  M75F: ZipALg1-GACCAAGAATTTTTCAGAAGTGG 
  M75R: ZipBLg2-GGGTGACAGCGTGAATCTCT 
Table Appendix III.  Y-STR haplotypes by haplogroup in the Balkans
HGHTDYS19DYS389IDYS389IIDYS390DYS391DYS392DYS393DYS385DYS388DYS434DYS435DYS436DYS437DYS438DYS439DYS460DYS461DYS462AAAAADAMKAMSAROGREALBMACROMPROMCTOTAL
C11514312410111313-1713121111141114101311 1 1
21514312410111313-1713121112141114101311 1 1
E131612302210111314-151210111216101291213 11
E3b141311272410111316-191211111214101291212 1 1
51312292410111316-171211111214101291212 1 1
61312292410111416-181211111214101291212 1 1
71312312310111316-181211111214101191212 1 1
8131329249111316-191211111214101291212 1 1
91313292410111316-181211111214101291212 1 1
101313292410111316-191211111214101291212 3 3 6
111313302410101317-181211111214101291212 11
121313302410111315-181211111214101291212 11
131313302410111315-201211111214101291212 1 1
141313302410111316-171211111214101291212 11
151313302410111316-18121111121410991212 1 1
161313302410111316-181211111214101191212 1 1
171313302410111316-181211111214101291212 1 3111 7
181313302410111316-181211111214101291312 1 1
191313302410111316-181211111214111191212 2 2
201313302410111316-181211111214121291112 1 1
211313302410111316-191211111214101291112 1 1
221313302410111316-191211111214101291212 2 2
231313302410111316-1913111112141012101312 1 1
241313302410111317-171211111214101391212 1 1
251313302410111317-181211111214101291212 1 1
261313302410111416-1612111112141012101212 1 1
271313302410111416-181211111214101291312 1 1
281313302411111316-181211111214101291212 62 8
291313302411111316-181211111214101391212 1 1
301313302510111315-1812111112141011912121 1
311313302511111317-171211111214101191112 1 1
321313312410111316-161111111214101291312 1 1
331313312410111317-181210111214101291212 1 1
341313312411111316-181211111214101291212 1 1
351313312510111315-181211111214101191212 1 1
361314302410111316-191211111214101291212 2 2
371314312410111316-181211111214101291212 1 1
381314312410111317-1812111112141011912122 2
391314312410121317-201211111214101291212 2 2
401413302410111317-171211111214101191112 1 1
411413302410111417-1812111112141011111212 1 1
421413302411111317-1912111112141011111212 2 2
431413312410111316-171211111214101291212 1 1
441413312410111316-181211111214101191212 1 1
451413312410111417-1812111112141011111212 1 1
E3b246131329249111314-1412111112141010111312 1 1
E3b347131331249111417-1712111112141013101112 1 1
481314322510111316-1612111112141111101112 1 1
49131433249111316-1812111112141011101112 1 1
G501412302310111313-1412111112161011111212 1 1
511512282210111412-1512111112161012121112 1 1
521512282210111414-1412111112161111111112 1 1
531512292111111414-161211111216101291112 1 1
541512292210101415-1712111112161013101212 11
551512292210111413-1413111112161011111212 1 1
561512292211111414-1513111112161011101112 1 1
571512292310111313-1412111112161011111312 1 1
581512292311111314-1512111112161011101212 1 1
591512312210111412-1512111112161012121112 1 1
601513292210111413-1413111112161011101112 11
611513302111111413-161211111216101291112 11
621513302310121315-1512111112161011111211 1 1
631514302210111413-1412101112161012111312 1 1
641514302410121414-1412111112151010101011 1 1
651514302410121414-1412111112151010101211 3 3
661612292310111413-1412111112161011111112 11
H671513292210111215-171211111214911101211 2 2
681514302210111215-171211111214911111211 1 1
I691412272310111313-1414111112161011101212 1 1
701412282210111314-1414111012161012111212 1 1
711412282211111214-1414111112161011101212 11
721412282310111313-1414111112161011101111 1 1
731412282310111313-1414111112161011101212 2 2 4
741412282310111313-1514111112161011101212 1 1
751412282310111314-1414111112161011101212 1 1
761412282310111413-1414111112161010101212 1 1
771412292210111314-1614111112161012101212 1 1
781413292210111314-1514111112161011111212 11
791512282210121313-1414111112161012101212 1 1
801512282210121314-1414111112161011101212 1 1
811513292210131516-1613111112141011111212 1 1
821513292310121415-1813121112141011101212 1 1
831513302310121414-1813121112141011101212 1 1
841513302310121415-1813121112141011101212 1 1
851513302311111314-15131111121510141012128 4 12
861513302411111414-1513111112151012101212 3 3
871513302412111314-1513111112151013101212 1 1
881513312410111314-1513111112151013101211 1 1
891513312410111414-1513111112151013101211 1 1
901513312411111314-1513111112151012101212 1 1
911513312411111314-1613111112151012101212 1 1
921513322411111314-1513111112151013101212 31 2 6
931514312310121414-1613111112141012111212 2 2
941514332411111314-1513111112141012101212 11
951613292310121415-151312111215812111212 1 1
961613292310121415-1513121112151012111212 1 1
971613292311121415-1513111112151011111212 11
981613302411111314-1513111112151013101212 12 1 4
991613302411111314-1513111112151014101212 1 1
1001613302411111315-1513111112151014101212 1 1
1011613312311111314-1613111112151013101112 1 1
1021613312410111314-1513111112151012101212 1 1
1031613312411111313-1412111112151013111212 1 1
1041613312411111314-1513111112141012101212 1 1
1051613312411111314-1513111112151012111212 1 1
1061613312411111314-1513111112151013101212 1 1 24
1071613312411111314-1513111112151014101212 1 1
1081613312411111314-1513111112151212101212 1 1
1091613312411111314-1613111112141013101212 1 1
1101613312411111314-1613111112151013101212 21 3
1111613312411111415-1513111112151013101212 1 1
1121613312412111314-1513111112151015101212 11
1131613312510111314-1513111112151013101212 1 1
1141613312511111315-1513111112151012101212 1 1
1151613322410111314-1513111112151012101212 1 1
1161613322411111214-1513111112151013101211 1 1
1171613322411111314-1513111112151012101212 1 12
1181613322411111314-1513121112151012101212 1 1
1191613322412111314-1513111112151014101212 11
1201613332411111314-1513111112151014101312 11
1211613342411111314-1513111112151014101212 1 1
1221614332411111314-1513111112141013101212 1 1
1231614332411111314-1513111112151013101212 1 1
1241713302410111314-151311111215914101212 1 1
1251713302410111314-1513111112151013101212 1 1
1261713302410111314-1613111112151013111215 1 1
1271713302411111314-1513121112151013101212 1 1
1281713312410111314-1513111112151013101212 1 1
1291713312411111214-1513111112151012101212 1 1
1301713312411111314-1513111112151012101212 1 1
1311713312411111314-1513111112151013101212 1 2
1321713312411111314-1513111112161013101212 11
1331713312411111414-1613111112151014101212 11
1341713322211111314-1613111112151013101312 1 1
1351713322410111314-1513111112151013101212 11
J(xJ2)1361413282310111212-1813111111141011101213 1 1
1371413292510111312-1816111112141011101111 1 1
1381513302310111213-1816111112141011111211 1 1
J21391411272311111213-171511111215911101311 1 1
1401412282310111213-17141111121591191311 1 1
1411412282410111214-141511111216912111011 1 1
1421412282410111214-171511111216912101011 1 1
1431412282410111214-1815111110161013111011 1 1
1441412292410111214-171711111216912111011 3 3
1451412292410111214-171711111216913111011 161 2 19
1461412292410111214-171711111216913111111 1 1
1471412292410111214-171711111216914111011 1 1
1481412292410111214-171711111217913111011 1 1
1491412292410111214-181711111216912111011 1 1
1501412292411131214-171711111216912111011 1 1
151141329229111213-171511111215911101211 1 1
1521413292310111213-161511111215911101311 1 1
1531413292410111213-161611111214910101211 1 1
1541413292510111214-1514111112151012101211 1 1
1551413302210111212-151711111214911101311 11
1561413302310111213-181511111215911111311 1 1
1571413302310111214-15151111121591191111 1 1
1581413302310111313-171511111214911101211 1 1
1591512272410111214-171511111216911101011 1 1
1601512282410111213-171511111216912101011 1 1
1611512282410111214-161511111216912101011 1 1
1621512282410111214-171511111216912111011 1 1 13
1631512282410111214-171611111216911111011 1 1
1641512282410111215-181511111216912111011 2 2
1651512282411111217-181211111214912111011 1 1
166151329239111213-161611111214911101310 21221 17
1671513292310131213-171511111215912101211 1 1
168151329249111213-161611111214911101310 1 1
1691513292410111213-171611111216912111011 1 1
1701513292510111213-161511111215911111211 1 1
171151330239111213-161611111214911101310 1 1
1721513312210111313-151511111214912101311 1 1
1731514302310111213-16161111121491210138 1 1
1741612282410111214-161511111216912111011 1 1
1751613282410111216-1815111112149121110131 1
1761613302310111212-151511111215911101311 1 1
177171329239111213-161611111214911101410 1 1
K(xP)1781313292310141314-171211111215911111112 1 1
179141230239141214-161211111214912101112 1 1
1801413292310131314-151211111214910111113 1 1
181141330239141214-161211111214912101112 1 1
1821413302310131315-161211111214911101112 1 1
1831513292312141411-1412101112141010111212 2 2
1841513292410131313-161211111214912101113 1 1
R1*1851412282411131311-1412111112151212111211 1 1
R1a11861512292511111411-161211111214911101111 1 1
1871513292611111311-1411111112141110111111 1 1
1881513302511111311-1412111112141010111111 1 1
1891513312510111311-1512111112141110101111 1 1
1901513312511111311-1412111112141110101211 2 2
1911513322610111311-1412111112141110111211 1 1
1921514312511111311-1412111112141110101111 1 12
1931612282510111311-1412111112141111101111 1 1
1941612302511111212-1412111112141111111111 1 1
1951613292410111310-1412111112141111111111 1 1
1961613292411111311-1412111112141111111111 1 1
1971613292510111311-1412111112141111111111 1 1
1981613292511111311-1312111112141111111211 2 2
1991613292511111311-1412111112141110111111 1 1
2001613302510111311-1412111112141110101112 2 2
2011613302510111311-1512111112141112111111 1 1
2021613302511111311-1312111112141111111311 1 1
2031613302511111311-1412111112141111111111 1 1
2041613302511111311-1512111112141110101111 11 2
2051613302511111311-1612111112141110111111 1 1
2061614302510111311-1112111112141111111111 1 1
2071614302510111311-1412111112141111111111 1 1
2081614312510111311-1412111112141111111111 1 1
2091614312511111311-1512111112141110111111 1 1
2101713292511111312-1412111112141110121111 16 7
2111713292512111312-1412111112141110121111 1 1
2121713292611111312-1412111112141110121111 2 2
2131713302410111310-1412111112141110111111 11
2141713302510111310-1412111112141110101111 1 1
2151713302511111311-1312111112141111111211 1 1
2161714302511111312-1412111112141111121111 1 1
2171714302611111312-1412111112141111121111 1 1
2181714312511111311-1412111112141110111111 11
2191714312611111311-1412111112141110111111 1 1
R1b2201313302411131311-1412111112151212111211 1 1
2211412282411131311-1412111112151213111211 1 1
2221412282610141211-1512111112161213101111 1 1
2231413282510141211-1412111113151212111111 11
2241413292310131210-1412111112151213111111 1 1
2251413292310131311-1412111112151212111211 11
2261413292311131311-1412111112151213111311 1 1
2271413292311151311-1412111112151212111211 1 1
2281413292410131211-1312111112151213101211 1 1
2291413292410131211-1413111112151211111211 1 1
2301413292410131211-1413111112151212111211 1 1
2311413292411111211-11121111121512121111116 6
2321413292411111211-11121111121512121211111 1 2
2331413292411131211-1312111112151212101211 1 1
2341413292411131211-1412111112151212111111 101 11
2351413292411131211-1412111112151213111111 1 1
2361413292411131311-1112111112151211111111 1 1
2371413292411131311-1112111112151212121111 1 2 3
2381413292411131311-1412111112151212111211 1 1
2391413292411131411-1112111112151212111111 1 1
2401413292510131211-1412111112151212111111 1 1
2411413292511131211-1412111112151215101111 1 1
2421413292511131311-1112111112151212121111 1 1
2431413292611131311-1512111112161213111111 11
2441413302310131211-1512111212151212111111 1 1
2451413302410111211-1112111112151212121111 1 1
2461413302411131211-1412111112151212111111 1 1
2471413302511141311-1413111112151213121311 1 1
2481413312411131211-1112121112151212121111 1 1
2491413312411131311-1412111112151212111211 1 1
2501414302411131311-131211111215912111211 1 1
2511513292411131312-1614111212151212111211 1 1
2521513292511131212-131211111114121291211 1 1
2531513292511131212-1312111111141212101211 124 7
2541513292611131212-1312111111141212101211 1 1
2551513302410131313-1612111112151312111211 1 12
2561513302410131313-1612111112151313111211 1 1
2571513302411131311-1612111112151312111211 11
2581513302511131212-1312111111141212101211 1 1
2591513302511131212-1312111111141213101311 1 1
2601513312410131311-1612111112151312111211 1 1
2611513312511131212-1312111111141212101211 1 1
2621514302412131311-1412111112151212101211 1 1
2631514302511131210-1512111112151212101111 1 1
Get PDF (715K)