SEARCH

SEARCH BY CITATION

Keywords:

  • Arabidopsis thaliana;
  • CDC25;
  • cell cycle;
  • cell size;
  • fission yeast

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  • • 
    The putative mitotic inducer gene, Arath;CDC25 cloned in Arabidopsis thaliana, was screened for cell cycle function by overexpressing it in Schizosaccharomyces pombe (fission yeast). The expression pattern of Arath;CDC25 was also examined in different tissues of A. thaliana.
  • • 
    Fission yeast was transformed with plasmids pREP1 and pREP81 with the Arath;CDC25 gene under the control of the thiamine-repressible nmt promoter. Using reverse transcription-polymerase chain reaction (RT-PCR), the expression of Arath;CDC25 was examined in seedlings, flower buds, mature leaves and stems of A. thaliana; actin (ACT2) was used as a control.
  • • 
    In three independent transformants of fission yeast, cultured in the absence of thiamine (T), pREP1::Arath;CDC25 induced a highly significant reduction in mitotic cell length compared with wild type, pREP::Arath;CDC25 +T, and empty vector (pREP1 ± T). The extent of cell shortening was greater using the stronger pREP1 compared with the weaker pREP81. However, Arath;CDC25 was expressed at low levels in all tissues examined.
  • • 
    The data indicate that Arath;CDC25 can function as a mitotic accelerator in fission yeast. However, unlike other plant cell cycle genes, expression of Arath;CDC25 was not enhanced in rapidly dividing compared with non-proliferative Arabidopsis tissues.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

During the cell cycle, cyclin-dependent protein kinases (CDKs) regulate two major transitions: G1/S-phase and G2/M, which in fission yeast (Schizosaccharomyces pombe) are regulated by a single CDK, Cdc2 (Nurse, 1990). Protein kinase activity is acquired through binding of the CDK with a regulatory cyclin (Nurse, 1990). Before G2/M, Cdc2 is phosphorylated at its Y15 residue by SpWee1 and SpMik1 kinases; this represses Cdc2 kinase activity (Russell & Nurse, 1987; Lundgren et al., 1991). At G2/M, dephosphorylation at the same amino acid residue, by SpCdc25 phosphatase, drives cells into mitosis (Nurse, 1990). In animals, the G2/M transition is primarily regulated by CDC2 (CDK1), which, in turn, is dephosphorylated by CDC25C, a dual-site (T14 Y15) protein phosphatase (Strausfeld et al., 1994). As in fission yeast, the WEE1 protein kinases are negative cell cycle regulators that prevent the CDK from exhibiting kinase activity until the cell develops mitotic competence when the CDC25 phosphatase removes phosphate groups from the T and Y residues activating the CDK.

Plant CDKs also function at the G1/S and G2/M transitions and contain the conserved Y15 residue. In contrast to yeast and animals, two distinct types of CDK show high kinase activities at G2/M and are therefore most likely regulate entry into mitosis. These are CDKAs, which are closely related to CDC2/CDK1, and the less closely related CDKB1s, which are unique to plants (DeWitte & Murray, 2003). Homologues to Spwee1 have been identified in maize (Sun et al., 1999) and in Arabidopsis (AtWEE1; Sorrell et al. 2002). Until now, the biggest enigma of plant cell cycle control has been the absence of a functional homologue to the yeast and animal cdc25 genes. To identify putative Arabidopsis CDC25-like genes, our group and that of Landrieu et al. (2004) used the C-terminal amino acid sequences of various animal and yeast cdc25s as a query sequence to search the Arabidopsis genome. These searches revealed a putative open reading frame (ORF) of a small CDC25-like gene (Arath;CDC25) on chromosome 5 (NCBI protein ID # CAB83305/DNA accession # AL162751) and both groups have cloned a cDNA fragment corresponding to the predicted ORF from Arabidopsis seedling cDNA. The Arath;CDC25 protein can dephosphorylate phosphothreonine-14 and phosphotyrosine-15 of plant CDKs and activate Arabidopsis CDK kinase activity (Landrieu et al., 2004). However, the predicted plant protein is completely devoid of an N-terminal regulatory domain that is present in yeast and animal CDC25 proteins.

Overexpression (oe) of SpWee1 and Spcdc25 in fission yeast results in long and short cell length phenotypes, respectively (Russell & Nurse, 1986, 1987), and hence both genes play an important role in regulating cell size. Functional evidence for the role of animal WEE1/CDC25 homologues was initially assessed by their ability to alter cell size in fission yeast. Here, we report on the effect of overexpressing Arath;CDC25 in fission yeast using pREP expression vectors (Maundrell, 1993). In addition, Arath;CDC25′s expression profile in Arabidopsis was established to test whether it is more highly expressed in rapidly dividing tissues as was found for AtWEE1 (Sorrell et al., 2002). This work shows that Arath;CDC25oe can indeed induce a short cell length in fission yeast, but unlike other cell cycle regulatory genes Arath;CDC25 is not up-regulated in rapidly dividing tissues.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Yeast strains, cultural conditions and transformation method

The Schizosaccharomyces pombe wild-type strain leu1-32 h was obtained from Paul Nurse (Cancer UK, London, UK) and were grown in YEPD medium (yeast extract (1%, w/v), bacteriological peptone (2%, w/v), glucose (2%, w/v), adenibe (0.01%, w/v) and uracil (0.01%)) at 25°C.

A cDNA clone of Arath;CDC25 was obtained by reverse transcription-polymerase chain reaction (RT-PCR) from seedling RNA using primers P29: GCGCCATATGGCGATGGCGAGAAG and P63: ACTCGGATCCTTAGGCGCAATCGCC, the PCR product was digested with BamHI and NdeI and cloned into the pREP1 and pREP81 vectors digested with the same restriction enzymes. Inserts were fully sequenced to confirm that PCR errors had not been introduced.

Yeast cells were grown in YEPD medium and transformed with plasmids pREP1 and pREP81 (Basi et al., 1993; Maundrell, 1993) with the Arath;CDC25 gene under the control of the thiamine-repressible nmt promoter using the protocol as described by Moreno et al. (1991). ‘Empty vector’ controls were transformed with empty pREP plasmids. Transformants were identified by their ability to grow on Edinburgh minimal medium (EMM; Mitchison, 1970) lacking leucine because the Saccharomyces cerevisiae LEU2 gene in plasmids pREP1 and pREP81 complements the S. pombe leu1–32 mutation. Individual transformants were replated on fresh EMM lacking leucine for 5 d at 25° and were then grown in liquid minimal medium either plus or minus thiamine (10 µm) with moderate agitation for 18 h at 30°C so that the cells were in late exponential phase. Twenty µl aliquots were pipetted onto microscope slides and cover slips were applied gently. Mitotic cell length was measured at ×60 magnification using an Olympus BH2 microscope (Olympus UK Ltd, London, UK) interfaced with an analogue monitor. Care was taken to limit cell length measurements to cells that had just formed or were about to form a transverse cross-wall. Cells that were separating were excluded. Experiments were performed with three independent transformants, each providing very similar results.

Semi-quantitative RT-PCR

Primers P29 and P63 as described above were used to amplify a 393 bp fragment from the ORF of Arath;CDC25. PCR cycles were optimised (32 cycles) to ensure that the reactions remained within the exponential phase. Actin primers (Sorrell et al., 2002) were used to amplify a portion of the ACT2 actin gene which was used as a loading control for the RT-PCR reactions. PCR products were quantified from agarose gels using the GeneGenius (Syngene, Cambridge, UK). PCR reactions were repeated at least twice with similar results.

Results and discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

We overexpressed Arath;CDC25 in wild-type fission yeast using the thiamine (T)-repressible nmt promoter in the plasmids, pREP1 and pREP81 (Maundrell, 1993). Arath;CDC25 overexpression (on culture medium −T) in three independent transformants induced a significant (50%) reduction in mitotic cell length compared with wild type and compared with pREP1::Arath;CDC25 +T (P < 0.001); a slightly greater reduction was evident with the stronger pREP1 compared with the weaker pREP81 (Fig. 1a–b). These data are the first to provide functional evidence of a higher plant gene capable of inducing a cdc25-like effect in fission yeast. However, empty vector data reveal a smaller cell length –T compared with +T. This differential effect of thiamine on cell size was also reported in previous work using pREP plasmids (Sorrell et al., 2002). Nevertheless, mean cell length in pREP::Arath;CDC25–T was significantly shorter compared with pREP1–T (P < 0.001, Fig. 1b).

image

Figure 1. Overexpression of Arath;CDC25 induces a small cell size in fission yeast but its expression in Arabidopsis is not confined to proliferative tissues. (a) Wild-type fission yeast (WT) cells together with cells transformed with the thiamine-repressible pREP::Arath;CDC25 and cultured with thiamine (+T, transgene off) or without thiamine (–T, transgene on) (bars, 10 µm). (b) Mean mitotic cell length (µm) in (i) wild-type fission yeast (x ± se = 14.1 ± 0.12), and representative data from three independent transformants: (ii) pREP1::Arath;CDC25–T (x ± se = 7.39 ± 0.21); (iii) pREP81::Arath;CDC25–T (x ± se = 8.46 ± 0.21); (iv) pREP1::Arath;CDC25 +T (x ± se = 13.4 ± 0.38); (v) pREP –T (x ± se = 9.89 ± 0.29); (vi) pREP1 +T (x ± se = 12.28 ± 0.23); (n ≥ 50). (ii) < (i), (ii) < (iv), (ii) < (v), by students t-test (P < 0.001). Mean mitotic cell length data are also given for fission yeast cells exhibiting Spcdc25oe in a pSX-179 integrant (Russell & Nurse, 1986), Arath;WEE1oe (Sorrell et al., 2002) and Wee1+ (7x) (Russell & Nurse, 1987). (c) Semi-quantitative RT-PCR analysis of Arath;CDC25 expression in different tissues of Arabidopsis thaliana. ACT2 was used as a loading control. Band intensity was quantitated and compared with the strongest signal (100%).

Download figure to PowerPoint

Whilst AtWEE1oe induces a long cell length, Arath;CDC25oe induces a short cell length (Fig. 1b; Sorrell et al., 2002). Indeed, the effect of overexpression of these plant genes was remarkably similar to Spwee1oe and Spcdc25oe (Fig. 1b; Russell & Nurse, 1986, 1987). Hence the data reported here coupled with structural and biochemical data (Landrieu et al., 2004) provide powerful evidence for the existence of a functional plant CDC25, which according to Landrieu et al. (2004) is a member of the CDC25 superfamily. Landrieu et al. (2004) did not find faster cell growth rates as a result of Arath;CDC25oe in fission yeast, but neither did Spcdc25oe result in a faster cellular growth rate compared with wild type (Russell & Nurse, 1986).

In Arabidopsis, Arath;CDC25 expression was more or less constant regardless of whether the tissue examined contained proliferative cells (Fig. 1c). This is in contrast to the expression patterns of AtWEE1, and another regulatory gene, AtGF14ω, which are up-regulated in proliferative regions of the plant (Sorrell et al., 2002, 2003). This suggests a different regulation of Arath;CDC25 expression compared with other plant cell cycle genes examined to date.

As mentioned above, Arath;CDC25 is predicted to encode a protein which is equivalent to the catalytic domain of all other published CDC25s, which probably explains why Arath;CDC25 could not complement the temperature sensitive Spcdc25–22 mutant (Landrieu et al., 2004). This is not unprecedented because neither AtWEE1 nor B-type Arath;CDKs could complement the fission yeast mutants wee1 or cdc2, respectively. (De Veylder et al., 1998; Sorrell et al., 2002). However, functional data for Arath;CDC25, presented here and by Landrieu et al. (2004) clearly warrants much more work on the regulation of Arath;CDC25 during the plant cell cycle.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

We thank the BBSRC for funding this work (ref:72/P10942), and Prof P. Nurse (Rockefeller Institute, NY) and Prof A Carr (University Sussex) for providing fission yeast strains and the pREP vectors.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  • Basi G, Schmid E, Maundrell K. 1993. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not transcription start point or thiamine repressibility. Gene 123: 131136.
  • De Veylder L, Van Montague M, Inze D. 1998. Cell cycle control in Arabidopsis. In: Francis, D, Dudits, D, Inze, D, eds. Plant Cell Division. Colcheser, UK: Porland Press, 119.
  • DeWitte W, Murray JAH. 2003. The plant cell cycle. Annual Review of Plant Biology 54: 235264.
  • Landrieu I, Da Costa M, De Veylder L, Dewitte F, Vandepoele K, Hassan S, Wieruszeski J-M, Faure J-D, Van Montague M, Inze D, Lippens G. 2004. A small CDC25 dual-specificity tyrosine-phosphatase isoform in Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 101: 1338013385.
  • Lundgren K, Walworth N, Booher R, Dembski M, Kirschner M, Beach D. 1991. mik1 and wee1 cooperate in the tyrosine phosphorylation of cdc2. Cell 4: 11111122.
  • Maundrell K. 1993. Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123: 127130.
  • Mitchison JM. 1970. Physiological and cytological methods for Schizosaccharomyces pombe. Methods in Cell Physiology 4: 131165.
  • Moreno S, Klar A, Nurse P. 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology 194: 795823.
  • Nurse P. 1990. Universal control mechanism regulating onset of M-phase. Nature 256: 547551.
  • Russell P, Nurse P. 1986. cdc25+ functions as an inducer of mitotic control of fission yeast. Cell 45: 145153.
  • Russell P, Nurse P. 1987. Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homologue. Cell 49: 559567.
  • Sorrell DA, Marchbank A, Chrimes DA, Dickinson JR, Rogers HJ, Francis D, Grierson CS, Halford NG. 2003. The Arabidopsis 14–3−3 protein, GF14 ù, binds to the Schizosaccharomyces pombe Cdc25 phosphatase and rescues defects in the rad24 mutant. Planta 218: 5057.
  • Sorrell DA, Marchbank A, McMahon K, Dickinson JR, Rogers HJ, Francis D. 2002. A WEE1 homologue from Arabidopsis thaliana. Planta 215: 518522.
  • Strausfeld U, Fernandez A, Capony J-P, Girard F, Lautredou N, Deracourt J, Labbe J-C, Lamb NJC. 1994. Activation of p34cdc2 protein kinase by microinjection of human cdc25C into mammalian cells. Journal of Biological Chemistry 269: 59896000.
  • Sun Y, Dilkes BP, Zhang C, Dante RA, Carneiro NP, Lowe KS, Jug R, Gordon-Kamm WJ, Larkins BA. 1999. Characterization of maize (Zea mays L.) Wee1 and its activity in developing endosperm. Proceedings of the National Academy of Sciences. U.S.A. 96: 41804185.