SEARCH

SEARCH BY CITATION

Keywords:

  • colinearity;
  • grain protein content;
  • physical map;
  • quantitative trait loci (QTL);
  • rice;
  • wheat

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • • 
    Grain protein content (GPC) is important for human nutrition and has a strong influence on pasta and bread quality. A quantitative trait locus, derived from a Triticum turgidum ssp. dicoccoides accession (DIC), with an average increase in GPC of 14 g kg−1 was mapped on chromosome 6BS.
  • • 
    Using the wheat–rice colinearity, a high-density map of the wheat region was developed and the quantitative trait locus was mapped as a simple Mendelian locus designated Gpc-B1. A physical map of approx. 250 kb of the Gpc-B1 region was developed using a tetraploid wheat bacterial artificial chromosome library.
  • • 
    The constructed physical map included the two Gpc-B1 flanking markers and one potential candidate gene from the colinear rice region completely linked to Gpc-B1. The relationship between physical and genetic distances and the feasibility of isolating genes by positional cloning in wheat are discussed.
  • • 
    A high-throughput codominant marker, Xuhw89, was developed. A 4-bp deletion present in the DIC allele was absent in a collection of 117 cultivated tetraploid and hexaploid wheat germplasm, suggesting that this marker will be useful to incorporate the high GPC allele from the DIC accession studied here into commercial wheat varieties.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Grain protein content (GPC) affects quality of pasta and bread and is important for human nutrition. A potential approach to increase GPC in wheat is to exploit the high GPC genes from wheat wild relatives. Wild emmer, Triticum turgidum L. ssp. dicoccoides, contains higher GPC (170–273 g kg−1) than most of the bread wheat cultivars (110–170 g kg−1) and therefore, may be a promising source of as yet untapped high GPC genes (Gerechter-Amitai & Grama, 1977; Avivi, 1978; Grama et al., 1983; Levy & Feldman, 1988; Nevo et al., 2002).

A promising source of high GPC was detected in a survey of wild wheat (accession FA−15-3; Avivi, 1978), referred to as dicoccoides or DIC hereafter. Joppa & Cantrell (1990) developed a complete set of disomic substitution lines from each of the chromosomes of this dicoccoides accession into the tetraploid durum cultivar ‘Langdon’ (LDN). These chromosome substitution lines can be used to facilitate the precise mapping of quantitative trait loci (QTL). In these populations, differences between the parental lines are restricted to a single chromosome, decreasing the genetic variability and increasing the sensitivity of the QTL analysis. This strategy has been used for more than half a century to analyze complex characters in wheat (Kuspira & Unrau, 1957; Sears, 1953; Law, 1967).

The substitution of the complete chromosome 6B of DIC into LDN, LDN(DIC-6B), showed the highest protein concentration. This significant increase in GPC was associated with an increase in the quality of the pasta products (Joppa et al., 1991) and was not associated with a significant decrease in grain yield or kernel weight (Cantrell & Joppa, 1991). When introduced into adapted durum germplasm, the DIC allele was also associated with an increase in protein content (15 g kg−1) and nonsignificant effects on protein quality and plant height, although a negative correlation between yield and GPC was observed in one of the three locations tested (Chee et al., 2001). The introgression of the DIC allele into common wheat varieties also resulted in higher amounts of GPC (Mesfin et al., 1999; Khan et al., 2000). In addition, wheat lines carrying the DIC allele exhibit higher levels of soluble proteins and amino acids in flag leaves after anthesis compared with lines carrying the LDN allele (Kade et al., 2005).

Other QTL studies suggested that a major gene affecting GPC in the Triticeae was probably located in the short arms of the chromosomes from homoeologous group 6. Blanco et al. (2002) identified two quantitative trait loci (QTL) in tetraploid wheat, QPro.mgb-6A1 and QPro.mgb-6B, located on the distal regions of chromosomes 6AS and 6BS, respectively. A significant quantitative trait locus for GPC on chromosome arm 6AS in hexaploid wheat was associated with amplified fragment length polymorphism (AFLP) marker XE38M60200 (Sourdille et al., 2003). Finally, a major quantitative trait locus for high-GPC near marker Hvm74 was reported in barley chromosome 6HS (See et al., 2002).

The evaluation of a mapping population of recombinant substitution lines (RSLs) from the cross between LDN(DIC-6B) and LDN showed that the increase in GPC in LDN(DIC-6B) was associated with a QTL located on the short arm of chromosome 6B within the Xmwg79–Xabg387 interval (Joppa et al., 1997). More recently, using field trials with 10 replications and a large set of secondary RSLs from the cross between LDN and RSL65, the source of GPC variation was mapped as a single Mendelian locus within a 2.7-cM region encompassed by restriction fragment length polymorphism (RFLP) loci Xcdo365 and Xucw67. This locus was designated Gpc-B1 (Olmos et al., 2003).

To further delimit the location of Gpc-B1, we characterized the microcolinearity between rice and wheat in this region and used the rice genome sequence as a stepping stone for the development of new markers in the region from the corresponding wheat expressed sequence tags (ESTs). This approach enabled us to narrow down the position of the Gpc-B1 locus to a 0.3-cM region flanked by polymerase chain reaction (PCR) markers Xucw79 and Xucw71, which corresponds to a 64-kb region in rice chromosome 2 (Nipponbare BAC (bacterial artificial chromosome) AP004061; Distelfeld et al., 2004). This region is currently represented in the sequenced rice genome by BAC AP005647.

Genetic improvement of GPC has been a frequent target of bread and pasta wheat breeding programmes because of the potential economic benefit of reducing the necessity for expensive nitrogen (N) fertilization. Conventional breeding, however, has made slow progress in the improvement of this trait because of the complex genetic system governing GPC, the strong influence of the environment, and the negative correlation between GPC and grain yield (Simmonds, 1995). Efforts to improve GPC without selecting for low yield can be accelerated by the identification of the genes that affect GPC and the direct selection of positive alleles with molecular markers.

The specific objectives of this study were: (1) to further explore the microcolinearity between the 64-kb region in rice and the orthologous 0.3-cM region in wheat containing the Gpc-B1 locus; (2) to construct a physical map of the 6BS chromosome arm region including the Gpc-B1 gene; and (3) to develop a tightly linked codominant PCR marker for Gpc-B1, which could eliminate the use of a restriction enzyme digestion step that is required in the current cleavage amplified polymorphic sequence (CAPS) markers, and that shows polymorphisms within a large set of commercial wheat varieties.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Mapping population

The mapping population included 85 homozygous RSLs developed by L. R. Joppa from the cross LDN(DIC-6B) × LDN (Joppa et al., 1991), 134 F2 plants from the cross RSL65 × LDN used in the mapping of the GPC gene within the Xcdo365 and Xucw67 interval (Olmos et al., 2003) and 291 new F2 plants from the same cross (a total of 935 gametes). The recombinant plants from the first two populations were previously evaluated for GPC in three field experiments (Olmos et al., 2003), but the new recombinant lines have not yet been characterized for GPC. All 935 gametes were used in the present wheat–rice colinearity study. Markers developed at the University of California, Davis, CA, USA, are identified by the three letter designator ‘ucw’ whereas those developed at the University of Haifa, Israel, use the ‘uhw’ laboratory designator according to the rules for the Catalogue of Gene Symbols for Wheat (McIntosh et al., 2005).

Hybridization procedures

Plant nuclear DNAs were isolated from leaves of single plants following the procedure described by Dvorak et al. (1988). Hybridizations of the BAC library high-density filters and of genomic Southern blots were performed as described by Dubcovsky et al. (1994). The genomic Southern blots used for RFLP mapping consisted of DNAs of the parental genotypes LDN(DIC-6B) and LDN digested with 24 different restriction enzymes (AscI, ApaI, AvaII, BamHI, BfaI, BglI, BstEII, BstNI, DdeI, DraI, EcoRI, EcoRV, HaeIII, HhaI, HindIII, MspI, NcoI, NdeI, SacI, Sau3AI, SspI, StuI, StyI and XbaI).

Comparative mapping

The rice genes from the 64-kb colinear rice sequence and their Triticeae homologues were identified using the following approach. Predicted open reading frames (ORFs) and potential exon/intron boundaries of the colinear rice region were obtained from the TIGR automatic annotation (http://www.tigr.org) and Gramene (http://www.gramene.org). The potential identities of predicted coding regions were tested by searches against the nonredundant protein and DNA databases, and against the EST database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) using the blastn, blastx and blastp programs. The rice ORFs predicted in BAC AP005647 and the homologous Triticeae sequences were used to search (using tblastx) the cereal repeats database at TIGR (http://www.tigr.org/tdb/e2k1/osa1/blastsearch.shtml) and the TREP database at Grain Genes (http://wheat.pw.usda.gov/ggpages/Repeats/index.shtml) to eliminate predicted proteins with similarities to repetitive elements.

Physical maps

The 28 high-density filters of a tetraploid wheat BAC library of RSL65, which carries a 30-cM DIC 6BS chromosome segment including the high GPC gene (Cenci et al., 2003), were used for hybridization with probes from the Gpc-B1 region (Table 1). Positive BAC clones were confirmed by PCR and Southern blots of HindIII fingerprints. To establish the genome origin of the BAC clones, genome specific primers were tested in nulli-tetrasomic lines N6AT6B and N6BT6A (Sears, 1966). Fingerprinting of the positive BAC clones was performed with the SNapshot labeling kit (Applied Biosystems, Foster City, CA, USA) and capillary electrophoresis on an ABI3730 (ABI PRISM 3730 DNA sequencer; Applied Biosystems) (Luo et al., 2003). The FPC program (Marra et al., 1997) was used to build the initial BAC contigs that were further confirmed by HindIII fingerprinting and hybridization or sequencing of BAC ends and PCR assays.

Table 1.  Source and information on restriction fragment length polymorphism (RFLP) probes that were used in the current research
SourceTriticeae ESTtblastn E-valuePrimer sequenceLength (bp)Locus
  • EST, expressed sequences tag.

  • b

    Xuhw86a locus located 2944-bp of locus Xuhw86 (downstream from the T7-end of BAC 409D13).

Rice geneBE4948385e−45GAAGATGGTGGACGAGGAGAN/ANot mapped
OSJNBa0026E05.13BE401694 ACAAATCTGTAGCCCGTTGC  
Rice geneBQ609014e−125CAACGTCTGCGCCTACAAC 550Not mapped
OSJNBa0026E05.15  TCAACGAAATCGTGCTCATC  
Rice geneBQ789353e−54ACCTCCAAGTGCGTCAGC 466Xuhw83
OSJNBa0026E05.18  ACTGCATGCCTGGTGAAGAC  
Rice geneBE4440664e−43TGATGAGATTTCTCCACAAAAGAA 750Xuhw84
OSJNBa0026E05.19–1  TCTTGATGAACCCGGTTAGAA  
Rice geneAL8264075e−37CAGAATGGACCCTTTGTGGT 506Xucw90
OSJNBa0026E05.24  CCTGAAGGCAATAACGTCTCC  
Rice geneBU995216e−118CATTTGGCAATGCAACTGAG1405Xucw71a
OSJNBa0026E05.30BQ753500 TCAACCCTTTTAAGCAATTTGAA  
Wheat BAC 409D13CAAGCAATGGTCAGCGTAGA 966Xuhw86ab
  GAGCATTGCTGGTGTTGAGA  

BAC-end sequencing

The BAC-end sequencing was preformed with the DNA walking SpeedUP kit (See-gene, Seoul, South Korea) according to the manufacturer's instruction. The vector specific primers designed based on the pIndigoBAC536 BAC vector sequence (supplied from the Clemson University Genomics Institute, SC, USA) (Luo et al., 2001) included Outer T7-end 5′-GTTTTCCCAGTCACGACGTT-3′, Inner T7-end 5′-ACGACTCACTATAGGGCGAAT-3′, Outer SP6-end 5′-TGTGGAATTGTGAGCGGATA-3′, and Inner SP6-end 5′-CGCCAAGCTATTTAGGTGACA-3′. These primers were used in combination with the ‘DNA Walking ACP (DW-ACP) primer’ provided with the kit and designed to capture unknown target sites. Using this method, we were able to amplify fragments in the range of 400–5000 bp. These PCR products were purified from agarose gels, cloned with pGEM-T Easy kit (Promega, Madison, WI, USA) and sequenced.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Identification of low copy-number candidate genes from rice

The 64-kb chromosome segment from rice chromosome 2, which is colinear with the 0.3 cM Gpc-B1 region in wheat (Distelfeld et al., 2004), includes 11 putative genes, of which four have significant similarities to known transposable elements in the Triticeae Repetitive Element Database (TREP) or in TIGR Cereal Repeats databases. Two had no significant similarity with any known protein or EST in any organism. The BLASTN searches using the sequences from the remaining five rice genes (OSJNBa0026E05.13, OSJNBa0026E05.15, OSJNBa0026E05.18, OSJNBa0026E05.19-1 and OSJNBa 0026E05.24) revealed significant similarities to several Triticeae ESTs (Table 1). Specific primer pairs were designed that successfully amplified fragments from LDN genomic DNA for four of these ESTs (Table 1: BQ609014, BQ789353, BE444066, AL826407). The PCR products of these four ESTs were used as probes for hybridization with genomic DNA Southern blots of the two parental lines digested with multiple restriction enzymes. Hybridization results from EST BQ609014 showed multiple bands suggesting that this gene was a member of a multigene family. The other three ESTs showed one or two bands, indicating that they correspond to single copy or low copy-number genes. Despite of the large number of restriction enzymes used in the screening (24), no polymorphisms were detected between the parental lines. Therefore, PCR-markers were developed for these ESTs.

Developing PCR markers for BQ789353, BE444066 and AL826407

BQ789353  The BQ789353 primers (Table 1) amplified a 466-bp product from LDN and from nulli-tetrasomic line N6AT6B but failed to amplify any product from N6BT6A; hence, these primers were considered to be B-genome specific. This 6B locus was designated Xuhw83. As the 466-bp LDN and DIC sequences were identical, an additional sequence was obtained from a BAC clone that included the Xuhw83 locus. Of the eight positive BAC clones detected with the 466-bp UHW83 probe (Table 2), only one (770E02) was assigned to the B genome.

Table 2.  Positive clones from the tetraploid bacterial artificial chromosome (BAC) library for loci Xucw71, Xuhw83, Xuhw84 and Xuhw86a
LocusNumber of clonesA genome BAC clonesB genome BAC clones
Xucw7110154N17, 445P02, 574J23, 797F22, 837O18, 976M3, 1217E11409D13, 947A13, 1025F04
Xuhw83 8153M06, 431C01, 678J09, 866B21, 884P09, 1130E11, 1229O05770E02
Xuhw84118F18, 154 N17, 445P02, 574J23, 797F22, 837O18, 1105M18, 1217E11409D13, 947A13, 1025F04
Xuhw86a 4_57H16, 409D13, 900C08, 916O17

A 5.5-kb HindIII fragment from BAC 770E02 containing Xuhw83 was sequenced. Two new primers, UHW83-BF and UHW83-R (Table 3) were designed from a region 1-kb downstream from the BQ789353 primers (Table 1). These primers were B-genome specific, as determined by amplification of the nulli-tetrasomic lines. One single nucleotide polymorphism (SNP) was identified and used to develop a CAPS marker. Digestion of the amplification product with restriction enzyme HaeIII produced fragments of 307-bp and 106-bp in LDN(DIC-6B) and a single 413-bp fragment in LDN (Fig. 1a). This polymorphism was used to map Xuhw83 in the critical RSLs (Table 4) completely linked to Xucw79 (Fig. 2).

Table 3.  Polymerase chain reaction (PCR)-based markers for loci Xuhw83, Xuhw84, Xuhw86, Xuhw89 and Xucw96
Locus name and marker typePrimer namePrimer sequenceRestriction enzymeExpected size LDN (bp)
  • CAPS, cleaved amplified polymorphic sequence; dCAPS, degenerate CAPS; LDN, T. durum cultivar Langdon.

  • a

    The bold A is a degenerate base pair (original sequence is T) that generates a unique NlaIII restriction site in LDN.

Xuhw83/CAPSUHW83-BFCATCACGGGGTGTCTAAGGTHaeIII413
UHW83-RGCCAAGAGAGGTTAGGCAAA  
Xuhw84/CAPSUHW84-BFCAGGAGGACTACAGGGAAGTCTStyI549
UHW84-RCGCGGTTCTTCTACCTTGTT  
Xuhw86/dCAPSUHW86-BFCAACTTCGATATGCTTTGTCCATaNlaIII133 + 24
UHW86-RTGCCAATGCTACAGCTCAAC  
Xuhw89/Allele specificUHW89-BFTCTCCAAGAGGGGAGAGACA4-bp indel126
UHW89-RTTCCTCTACCCATGAATCTAGCA  
Xucw96/CAPSUCW96-BFGGATGATCCCATGGATTCTACAMspI632 + 363 + 268
UCW96-RTTGGTTAATCTATATGCATACTGCAAC  
image

Figure 1. (a) Cleavage amplified polymorphic sequence (CAPS) marker for locus Xuhw83; polymerase chain reaction (PCR) products digested with restriction enzyme HaeIII. (b) CAPS marker for locus Xuhw84; PCR products digested with restriction enzyme StyI. (c) Degenerate CAPS marker for locus Xuhw86; PCR products were digested with restriction enzyme NlaIII. (d) Indel marker for locus Xuhw89. 1, LDN; 2, DIC; 3, RSL113; 4, RSL116; 5, RSL8; 6, RSL121; 7, RSL110; 8, RSL117; 9, RSL28; 10, RSL119; M, DNA ladder. The PCR and restriction products from markers Xuhw83, Xuhw84 and Xuhw86 were separated on 1.8% agarose gel; PCR products from marker Xuhw89 were separated on 6% polyacrylamide gel. Sizes are in bp.

Download figure to PowerPoint

Table 4.  Graphical genotypes of the subset of recombinant substitution lines (RSLs) previously characterized for grain protein content (GPC) (Olmos et al., 2003)
RSLXcdo 365Xucw 75Xucw 74Xucw 73Xucw 79Xuhw 83Xuhw 89Xuhw 86Gpc-B1Xuhw 84Xucw 71Xucw 96Xucw 70Xucw 69Xucw 67Xucw 65
  1. D, DIC (dicoccoides) alleles; L, LDN (cv. Langdon) alleles. A change between gray and white cells indicates a recombination event.

  2. Four additional markers were mapped between previous flanking markers Xucw79 and Xucw71.

113LDDDDDDDDDDDDDD
116LDDDDDDDDDDDDDDD
8LLLDDDDDDDDDDDDD
121LLLLLLLDDDDDDDDD
110DDDDDDDDDDDDLLLL
117DDDDDDDDDDDDLLLL
28DDDDDDDDDDLLLLLL
119DDDDDDDDDDDDDLLL
image

Figure 2. Microcolinearity between the Gpc-B1 region in wheat chromosome 6B and rice chromosome 2. The positions of the genes in the rice genomic sequence (top) are compared with the genetic and physical maps of the colinear region in wheat (bottom). The gray area represents the 0.2-cM region of the wheat genetic map including the Gpc-B1 locus.

Download figure to PowerPoint

BE444066  A PCR product of approx. 750-bp was amplified from LDN genomic DNA using the primers indicated in Table 1. Because the nulli-tetrasomic analysis showed that these primers were not genome-specific, PCR products were cloned from LDN to identify clones corresponding to the two different genomes. Digestion of the clones with restriction enzyme BamHI identified two types of clones, and one clone per group was sequenced. Genome-specific primers were designed and tested in nulli-tetrasomic lines N6AT6B and N6BT6A. The B-genome-specific primers UHW84-BF and UHW84-R (Table 3) amplified a 549-bp fragment from a locus designated Xuhw84. Comparison of the LDN and DIC sequences revealed the presence of one SNP that was used to develop a CAPS marker. Digestion of the amplification product with restriction enzyme StyI produced fragments of 432-bp and 117-bp in DIC and 549-bp in LDN (Fig. 1b). These polymorphisms were used to map Xuhw84 in the critical recombinant plants (Table 4) completely linked to the targeted Gpc-B1 locus (Fig. 2).

AL826407  Hybridization of a Southern blot, including DNAs from nulli-tetrasomic lines digested with restriction enzyme HindIII with the probe amplified by the AL826407 primers (Table 1), showed that the AL826407 corresponded to a locus designated Xucw90 on homoeologous group 5. Therefore, this gene was excluded as a candidate for the wheat Gpc-B1 gene.

Table 4 summarizes the graphical genotypes (Young & Tanksley, 1989) of the eight critical homozygous RSLs for which the GPC phenotype was available from previous detailed field studies (Olmos et al., 2003). These RSLs have recombination events close to the Gpc-B1 gene. In Table 4, white cells with an ‘L’ indicate Langdon alleles, whereas gray cells with a ‘D’ indicate LDN(DIC-6B) alleles. The wheat region between the flanking markers, Xuhw83 and Xucw71, which includes the Gpc-B1 gene, corresponds to a 36-kb region in rice BAC AP005647 (Fig. 2).

Physical map

The RSL65 BAC library was hybridized with probes for loci Xucw71, Xuhw83 and Xuhw84 (Table 3). Probes for loci Xuhw84 and Xucw71 detected three BACs from the B genome and nine BAC clones for the A genome, whereas distal locus Xuhw83 hybridized with a single BAC clone from the B genome (770E02) and with seven from the A genome (Table 2).

A genome contig  Among the nine BAC clones from the proximal contig, 1105M18 and 8F18 hybridized with the Xuhw84 probe but not with Xucw71, facilitating the orientation of this contig relative to the genetic map (Fig. 2). No overlap was detected between the two protruding BACs from the A-genome proximal contig (1105M18 and 8F18) and the seven A-genome BACs from the distal contig selected with probe Xucw83 (Fig. 2). As the main objective of our project was to clone the Gpc-B1 gene from the B genome, no further efforts were made to close the gap in the physical map of the A genome.

B genome contig  Distal locus Xuhw83 provided a single small BAC clone from the B genome (770E02) with no clear overlap with the clones from the proximal contig (Fig. 2). Therefore, we focused our initial efforts for the physical mapping in the proximal B genome contig. Probes from the Xucw71 and Xuhw84 loci hybridized with the same 40-kb HindIII fragment. This result indicated that these two genes, located 31-kb apart in rice, were less than 40-kb apart in the B genome of wheat. The two genes hybridized with the same fragment in all three BACs; thus it was not possible to orient this contig relative to the genetic map.

To determine the orientation of the contig relative to the genetic map, we sequenced the ends of BAC clones 409D13 and 947A13 (Fig. 2). The SP6-end of BAC clone 409D13 revealed a wheat gene homologous to the colinear rice gene OSJNBa0026E05.31 from BAC AP005647 (Fig. 2). This locus was designated Xucw96. Primers UCW96-BF and UCW96-R (Table 3) were confirmed to be B-genome specific by nulli-tetrasomic analysis. Comparison of the DIC and LDN B-genome sequences revealed the presence of one SNP that was used to develop a CAPS marker. Digestion of the amplification product with restriction enzyme MspI produced fragments of 632-bp, 363-bp, and 268-bp in LDN and fragments of 900-bp and 363-bp in DIC. Marker Xucw96 was mapped completely linked to Xucw71 and proximal to Xuhw84 in a colinear order with rice (Fig. 2). Based on this result, it was inferred that the SP6-end of wheat BAC 409D13 was the proximal end and therefore that the T7-end should be facing the gap in the B genome contig.

The locus detected by the specific primers for the T7-end of BAC 409D13 was designated Xuhw86. Primers 5′-GTTTGAGGGGATCACACACC-3′ and 5′-GCCTGTTTCCATACCCATGT-3′ were used to amplify an 887-bp fragment from LDN genomic DNA and an 886-bp fragment from DIC genomic DNA. Comparison of the two B-genome sequences revealed the presence of one SNP that was used to develop a dCAPS marker (Michaels & Amasino, 1998) for the Xuhw86 locus (Table 3). Primer UHW86-BF included a degenerate A in the second bp from the 3′ end (the original sequence was T), creating a unique NlaIII restriction site in the amplification product from LDN. We used this primer in combination with the B-genome-specific primer UHW86-R (Table 3) to amplify a 159-bp fragment from DIC and a 158-bp fragment from LDN, which, after digestion with NlaIII, produced a polymorphism between LDN(DIC-6B) 159-bp and LDN (138-bp and 20-bp) (Fig. 1c). This polymorphism was used to map Xuhw86 in the critical recombinant plants completely linked to Xuhw84 (Table 4, Fig. 2). Based on these results, we confirmed that the T7-end of BAC 409D13 (Xuhw86), was the end of the proximal B-genome contig facing the gap in the physical map.

The T7-end of BAC 409D13 was selected as the starting point for another step in the chromosome walking. However, the marker Xuhw86 sequence was found unsuitable for screening the BAC library by hybridization because of its high similarity to a GAG/POL Polyprotein COPIA-like retro element. Sequencing of a downstream region, 3-kb from the T7-end of BAC 409D13, revealed a sequence with no significant similarity to any known repetitive element. Specific primers were designed to amplify a 966-bp PCR product from this region, and this second locus was designated Xuhw86a (Table 1).

Hybridization of the PCR product from this locus with the tetraploid BAC library revealed three positive BAC clones, 916O17, 900C08 and 57H16, in addition to BAC clone 409D13 (Table 2, Fig. 2). Analysis of the HindIII fingerprints of these clones revealed common bands with BAC clone 409D13, hence extending the B-genome contig. The ends of BAC 916O17 were sequenced and specific primers were designed for both ends. The specific primers for the SP6-end of BAC 916O17 amplified the same product from BAC 409D13 but not from BAC 947A13 or 1025F04 indicating that this was the proximal end of the BAC. The primers designed for the distal T7-end of BAC 916O17, amplified a 126-bp PCR product from LDN genomic DNA and a 122-bp PCR product from DIC genomic DNA, corresponding to a locus designated Xuhw89 (Table 3, Fig. 1d).

This polymorphism was mapped on the critical RSLs (Table 4) and showed that Xuhw89 was completely linked to Xuhw83 and one crossover distal to the Gpc-B1 gene (Fig. 2). Based on these results, we concluded that the Gpc-B1 gene was located within the BAC contig determined by overlapping BAC clones 409D13 and 916O17 that span a region of approx. 250 kb, as estimated from the HindIII fingerprints.

High-throughput marker Xuhw89

The 4 bp polymorphism detected for Xuhw89 was originated by an ACTT duplication in the LDN sequence that was absent in the DIC sequence. This size difference was sufficient to differentiate both alleles in 6% polyacrylamide gels, making this region an interesting target for the development of a high-throughput marker. Previous markers for the Gpc-B1 gene Xucw71 and Xucw79, and possibly a future marker for the gene itself, require the use of a restriction digest step after the PCR amplification, increasing cost and reducing the throughput of these markers (http://maswheat.ucdavis.edu/protocols/HGPC/index.htm).

To validate the usefulness of this marker in marker-assisted selection for tetraploid and hexaploid wheat breeding programmes, we screened a large collection of pasta and common wheat (Table 5). All the genotypes that were tested with the Xuhw89 marker (39 tetraploid and 78 hexaploid wheat varieties) carried the ACTT duplication characteristic of the LDN allele.

Table 5.  Wheat varieties tested with Xuhw89
WheatCountry of originVariety name
Durum wheat (tetraploid)FranceDurelle, Durfort, Exeldur, Nefer, Neodur
ItalyAdamello, Appio, Appulo, Capelli, Ciccio, Cirillo, Colosseo, Duilio, Karel, L35, Latino, Messapia, Ofanto, Russello SG7, San Carlo, Saragolla, Trinakria, Valbelice, Valforte, Valnova, Varano, Vitron, Zenit
IsraelInbar
MexicoAconchi 89, Altar 84, Mexicali 75
TunisiaInrat 69, Karim, Khiar
USAColorado, Langdon, Kronos, WB881
Common wheat (hexaploid)AustraliaSummit
CanadaMarquis
IsraelBeit-Hashita, Mivhor, Nirit, Lachis, Galil, Gedera, Yarden, Ariel, A38
 USAAccord, Aldente, Alpowa, Andrews, Anza, Barbee, Big Club 60, Blanca, Bonne Ville, Brooks, Cajeme 71, Calorwa, Canthatch, Centennial, Challenger, Colt, Copper, Dirkwin, Eltan, Express, Fieldwin, Garland, Gene, Hill 81, Hyak, Inia 66R, Klasic, Kmor, Lambert, Len, Mac Vicar, Madsen, Malcolm, Marshall, Meridian, Nainari 60 (CIMMYT), Newton, Nugaines, Owens, Penawawa, Phoenix, Pitic 62 (CIMMYT), Poco Red, Pomerelle, Probrand 755, Probred, Promontory, Ramona 50, Red Chief, Rohde, RSI 5, Rulo, Shasta, Siete Cerros 66 (CIMMYT), Sonora 64 (CIMMYT), Spillman, Stoa, Tadinia,Tammy, Tascosa, Treasure, Triumph 64, Turkey, Twin Serra, Vanna, Waduel 94, Yecora Rojo

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The grass family provides more than 80% of the world's edible dry matter (FAO, 2004) with wheat contributing 28% of this total (600 million tons per year). Therefore, the protein content of the wheat grain may have a significant impact on the amount of protein available for human consumption, and this was the rationale for the initial targeting of Gpc-B1 for a positional cloning effort.

Positional cloning in the large genomes of temperate cereals is not a trivial exercise because of the huge size of the cereal genomes (13 000 Mb in tetraploid wheat and 16 000 Mb in hexaploid wheat; Arumuganathan & Earle, 1991). However, recent successful positional cloning projects have been reported in wheat and barley, demonstrating the feasibility of this approach. The positional cloning of disease-resistance genes Mla and Rpg1 in barley (Wei et al., 1999; Brueggeman et al., 2002) was followed by map-based cloning reports in wheat for Lr10 (Feuillet et al., 2003), Vrn1 (Yan et al., 2003), Vrn2 (Yan et al., 2004), Q (Faris et al., 2003), and Lr21 (Huang et al., 2003). In this report, we describe the identification of two overlapping BAC clones including the flanking markers for the Gpc-B1 gene, demonstrating once more that limited chromosome walks in wheat are feasible. However, the difficulties generated by the abundant repetitive sequences in the wheat genome complicate this task and justify an initial large investment in high-resolution genetic maps to reduce the chromosome walking efforts.

Wheat-rice microcolinearity

In a previous study, a 2.1-cM wheat region defined by markers Xucw75 and Xucw67 on wheat chromosome 6BS was shown to have a high level of microcolinearity with a 350 kb region in rice chromosome 2 (Distelfeld et al., 2004). Except for the interruption in colinearity at the distal end of the analysed segment, the nine wheat genes included in this region were colinear with rice. In this study, three additional genes, represented by markers Xuhw83, Xuhw84 and Xucw96, were found to be colinear between wheat and rice in the Gpc-B1 region (Fig. 2).

The wheat Xuhw84 gene, orthologous to the rice OSJNBa0026E05.19-1 gene cosegregated with the Gpc-B1 gene and, therefore, is a putative candidate gene for Gpc-B1. The function of the Xuhw84 gene is unknown, but it has a conserved RNA recognition motif in the first and second exons, suggesting that it might be a regulatory factor involved in controlling the expression of other genes. The rice gene OSJNBa0026E05.24, adjacent to the Xuhw84 orthologue, was mapped outside the Gpc-B1 region in wheat (Xucw90, Fig. 2), representing an interruption of the colinearity between wheat and rice, close to the Gpc-B1 gene. Therefore, this gene cannot be considered as a candidate for Gpc-B1, leaving OSJNBa0026E05.19-1 (Xuhw84) as the only candidate gene for the Gpc-B1 locus in the colinear region in rice. However, in order to validate this conclusion and prove that Xuhw84 is the Gpc-B1 gene, we need to sequence the complete colinear 250-kb region in wheat to verify that no other wheat genes are present in this region.

This study demonstrates the power of combining the rice genome sequence information (Goff et al., 2002; Yu et al., 2002) with the extensive Triticeae EST collections (Qi et al., 2004) to establish high resolution genetic and physical maps in wheat. However, the observed interruptions in colinearity in the Gpc-B1 region and similar observations in other microcolinearity studies suggest that a final sequencing of the wheat physical maps will be a frequently needed step in the positional cloning of wheat genes (Kilian et al., 1997; Yan et al., 2004).

Physical map of the Gpc-B1 locus

The construction of a large-insert tetraploid wheat BAC library from RSL65 containing the DIC allele of the Gpc-B1 gene was a necessary first step for the physical mapping of the Gpc-B1 locus (Cenci et al., 2003). This library is particularly useful for genes located on the B genome (such as Gpc-B1), as no diploid wheat matches the B genome from polyploid wheats perfectly (Dvorak & Zhang, 1990; Huang et al., 2002). The large size of the inserts (average 130-kb) facilitated the construction of the physical map using only two BACs covering a region of approx. 250-kb, which includes markers Xuhw89 and Xucw71 flanking the Gpc-B1 gene.

The average number of positive clones selected by hybridization with probes for genes Xucw71, Xuhw83 and Xuhw84 was 9.7, as expected from the estimated library coverage of 5.1 genome equivalents per genome (Cenci et al., 2003). Theoretically, the number of clones from the A genome should have been similar to that from the B genome, but a larger number of A-genome clones was recovered in this particular region (Table 2). This different representation of BACs from the Gpc-B1 and Gpc-A1 regions may be associated with an unusual result in the random sampling of the genome in the Gpc-B1 region.

Relationship between genetic and physical distances in the Gpc-B1 region

The Gpc-B1 locus was mapped within the deletion bin 6BS-5 (fraction length 0.49–0.68), which is located proximal to the Nor2 locus (Olmos et al., 2003). Based on its proximal location within the chromosome arm, we expected a high physical to genetic distance ratio within the region. Cytogenetic studies have shown an exponential decrease in recombination with distance from the telomere (Dvorak & Chen, 1984; Lukaszewski & Curtis, 1993), with a rapid increase in the physical to genetic distance ratios closer to the centromere.

Most of the wheat positional cloning projects completed so far support this predicted increase of physical distances relative to genetic distances towards the centromeric regions. Physical to genetic distance ratios of 1.4 and 1.7 Mb cM−1 reported for the distal regions of chromosomes 1A and 5Am, respectively (Stein et al., 2000; Yan et al., 2004), are lower than the genome-wide estimate of 3 Mb cM−1 (Bennett & Smith, 1991). The VRN-1 region located within a more proximal bin (fraction length 0.68–0.78) showed a physical to genetic distance ratio larger than the genome-wide estimate (4.1 Mb cM−1, erroneously reported before as 6.1 Mb cM−1; Yan et al. 2003). An exception to this general trend was reported for the Q locus located more distal than the Vrn1 region, but more proximal than the 1A and 5Am distal regions (fraction length 0.87; Faris et al., 2003) that yielded an unusually low ratio of 0.33 Mb cM−1.

The physical to genetic distance ratio of 1.25 Mb cM−1 found in the Gpc-B1 region (250 kb, 0.2 cm) also seems to be exceptionally low considering its relatively proximal location. This ratio is similar to the values reported for the two available distal regions (Stein et al., 2000; Yan et al., 2004). The results from the Gpc-B1 and Q regions suggest that exceptions to the general tendency of increased physical to genetic distance ratios towards the centromere will be encountered and will be difficult to predict a priori. Recent studies have shown that local patterns of recombination rate evolve very rapidly and can be different even between closely related species (Winckler et al., 2005). Therefore, the chromosome location of a target gene for a positional cloning effort in wheat should be used only as a crude approximation of the physical to genetic distance ratio that will be encountered in the actual region.

Luo et al. (1998) suggested that recombination rates are reduced in regions adjacent to the Nor loci. Because the Gpc-B1 gene is located within a small deletion bin (16% of the arm length) adjacent to the Nor2 locus, we were concerned about a possible reduction in the recombination rates in this region, which could have complicated our positional cloning efforts. Fortunately, the reduced physical to genetic distance ratio observed in this study provides evidence that Gpc-B1 lies far enough from Nor2 to avoid any effect that this locus might have on suppressing recombination in this region.

Marker assisted selection (MAS)

Comparison of the distal end of the physical map between DIC and LDN (Xuhw89) yielded a useful polymorphic indel that was used to develop a codominant marker. This marker does not require digestion with restriction enzymes and therefore can be efficiently used in high-throughput screenings for the Gpc-B1 gene. As this marker is tightly linked to the Gpc-B1 gene (0.1 cM), only one in a 1000 gametes is expected to show recombination between this marker and the Gpc-B1 gene. Based on this genetic distance, an efficient strategy would be to use only Xuhw89 in the initial screenings for the Gpc-B1 DIC allele. This Xuhw89 marker showed polymorphisms between DIC and all the tetraploid and hexaploid lines tested and therefore should be useful in a wide variety of crosses in both pasta and common wheat breeding programmes. The proximal marker Xucw71 can be used to confirm the absence of recombination in this small genetic interval in the most advanced lines of the breeding program. Markers external to Xuhw89 and Xucw71 can also be used to reduce the linkage drag during the introgression of the Gpc-B1 gene.

In addition to the discovery of the Xuhw89 high-throughput marker, the completion of the physical map for Gpc-B1 is a significant step towards the cloning of this important agronomic gene. The final identification of Gpc-B1 will enable the development of a perfect marker for this gene and more importantly, will shed light on the mechanisms responsible for the differences in GPC. Efforts are underway to sequence the 250-kb region and to determine whether additional wheat genes that are absent in the colinear region of rice are present in the wheat contig.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This research was supported by Research Grant No. US-3573-04C from BARD, the United States–Israel Binational Agricultural Research and Development Fund, equipment grants from Israel Science Foundation (No. 048/99 and 1478/04) and by USDA-CSREES competitive CAP grant 2005–05130. We thank Dr Maria Corinna Sanguineti (University of Bologna, Italy) for providing seeds of tetraploid wheats used in this study.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Arumuganathan K, Earle ED. 1991. Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 9: 208218.
  • Avivi L. 1978. High protein content in wild tetraploid Triticum dicoccoides Korn. In: RamanujamS, ed. Proceedings of the 5th International Wheat Genetics Symposium. New Delhi, India: Indian Society of Genetics and Plant Breeding (ISGPB), 372380.
  • Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London, Series B. Biological Sciences 334: 309345.
  • Blanco A, Pasqualone A, Di Troccoli AFN, Simeone Royal. 2002. Detection of grain protein content QTLs across environments in tetraploid wheats. Plant Molecular Biology 48: 615623.
  • Brueggeman Royal, Rostoks N, Kudrna D, Kilian A, Han F, Chen J, Druka A, Steffenson B, Kleinhofs A. 2002. The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases. Proceedings of the National Academy of Sciences, USA 99: 93289333.
  • Cantrell RG, Joppa LR. 1991. Genetic analysis of quantitative traits in wild emmer (Triticum turgidum L. var. dicoccoides). Crop Science 31: 645649.
  • Cenci A, Chantret N, Kong X, Gu Y, Anderson OD, Fahima T, Distelfeld A, Dubcovsky J. 2003. Construction and characterization of a half million clone BAC library of durum wheat (Triticum turgidum ssp. durum). Theoretical and Applied Genetics 107: 931939.
  • Chee PW, Elias EM, Anderson JA, Kianian SF. 2001. Evaluation of a high grain protein QTL from Triticum turgidum L. var. dicoccoides in an adapted durum wheat background. Crop Science 41: 295301.
  • Distelfeld A, Uauy C, Olmos S, Schlatter AR, Dubcovsky J, Fahima T. 2004. Microcolinearity between a 2-cM region encompassing the grain protein content locus Gpc-6B1 on wheat chromosome 6B and a 350-kb region on rice chromosome 2. Functional and Integrative Genomics 4: 5966.
  • Dubcovsky J, Galvez AF, Dvorak J. 1994. Comparison of the genetic organization of the early salt stress response gene system in salt-tolerant Lophopyrum elongatum and salt-sensitive wheat. Theoretical and Applied Genetics 87: 957964.
  • Dvorak J, Zhang HB. 1990. Variation in repeated nucleotide sequences sheds light on the phylogeny of the wheat B and G genomes. Proceedings of the National Academy of Sciences, USA 87: 96409644.
  • Dvorak J, Chen KC. 1984. Distribution of nonstructural variation between wheat cultivars along chromosome arm 6Bp: evidence from the linkage map and physical map of the arm. Genetics 106: 325333.
  • Dvorak J, McGuire PE, Cassidy B. 1988. Apparent sources of the A genomes of wheats inferred from the polymorphism in abundance and restriction fragment length of repeated nucleotide sequences. Genome 30: 680689.
  • FAO. 2004. FAOSTAT data. http://apps.fao.org/
  • Faris JD, Fellers JP, Brooks SA, Gill BS. 2003. A bacterial artificial chromosome contig spanning the major domestication locus Q in wheat and identification of a candidate gene. Genetics 164: 311321.
  • Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B. 2003. Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proceedings of the National Academy of Sciences, USA 100: 1525315258.
  • Gerechter-Amitai ZK, Grama A. 1977. Use of alien genes in wheat breeding. Annual Wheat Newsletter 23: 5758.
  • Goff SA, Ricke D, Lan TH, Presting G, Wang R, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, Hadley D, Hutchison D, Martin C, Katagiri F, Lange BM, Moughamer T, Xia Y, Budworth P, Zhong J, Miguel T, Paszkowski U, Zhang S, Colbert M, Sun WL, Chen L, Cooper B, Park S, Wood TC, Mao L, Quail P, Wing Royal, Dean R, Yu Y, Zharkikh A, Shen R, Sahasrabudhe S, Thomas A, Cannings R, Gutin A, Pruss D, Reid J, Tavtigian S, Mitchell J, Eldredge G, Scholl T, Miller RM, Bhatnagar S, Adey N, Rubano T, Tusneem N, Robinson R, Feldhaus J, Macalma T, Oliphant A, Briggs S. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296: 92100.
  • Grama A, Gerechter-Amitai ZK, Blum A. 1983. Wild emmer as a donor of genes for resistance to stripe rust and for high protein content. In: SakamotoS, ed. Proceedings of the 6th International Wheat Genetics Symposium. Kyoto, Japan: Plant Germplasm Institute, University of Kyoto, 187192.
  • Huang L, Brooks SA, Li W, Fellers JP, Trick HN, Gill BS. 2003. Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics 164: 655664.
  • Huang S, Sirikhachornkit A, Su XJ, Faris J, Gill B, Haselkorn Royal, Gornicki P. 2002. Genes encoding plastid acetyl-CoA carboxylase and 3-phosphoglycerate kinase of the Triticum/Aegilops complex and the evolutionary history of polyploid wheat. Proceedings of the National Academy of Sciences, USA 99: 81338138.
  • Joppa LR, Cantrell RG. 1990. Chromosomal location of genes for grain protein content of wild tetraploid wheat. Crop Science 30: 10591064.
  • Joppa LR, Hareland GA, Cantrell RG. 1991. Quality characteristics of the Langdon durum–dicoccoides chromosome substitution lines. Crop Science 31: 15131517.
  • Joppa LR, Du C, Hart GE, Hareland GA. 1997. Mapping a QTL for grain protein in tetraploid wheat (Triticum turgidum L.) using a population of recombinant inbred chromosome lines. Crop Science 37: 15861589.
  • Kade MA, Barneix J, Olmos S, Dubcovsky J. 2005. Nitrogen uptake and remobilization in tetraploid Langdon durum wheat and a recombinant substitution line with the high grain protein gene. Gpc-B1. Plant Breeding 124: 343349.
  • Khan IA, Procunier JD, Humphreys DG, Tranquilli G, Schlatter AR, Marcucci-Poltri S, Frohberg R, Dubcovsky J. 2000. Development of PCR based markers for a high grain protein content gene from Triticum turgidum ssp. dicoccoides transferred to bread wheat. Crop Science 40: 518524.
  • Kilian A, Chen J, Han F, Steffenson B, Kleinhofs A. 1997. Towards map-based cloning of the barley stem rust resistance genes Rpg1 and Rpg4 using rice as an intergenomic cloning vehicle. Plant Molecular Biology 35: 187195.
  • Kuspira J, Unrau J. 1957. Genetic analysis of certain characters in common wheat using whole chromosome substitution lines. Canadian Journal of Plant Science 37: 300326.
  • Law CN. 1967. The location of genetic factors controlling a number of quantitative characters in wheat. Genetics 56: 445461.
  • Levy AA, Feldman M. 1988. Ecogeographical distribution of HMW glutenin alleles in populations of the wild tetraploid wheat Triticum turgidum var. dicoccoides. Theoretical and Applied Genetics 75: 651658.
  • Lukaszewski AJ, Curtis CA. 1993. Physical distribution of recombination in B-genome chromosomes of tetraploid wheat. Theoretical and Applied Genetics 84: 121127.
  • Luo M, Wang YH, Frisch D, Joobeur T, Wing RA, Dean RA. 2001. Melon bacterial artificial chromosome (BAC) library construction using improved methods and identification of clones linked to the locus conferring resistance to melon Fusarium wilt (Fom-2). Genome 44: 154162.
  • Luo MC, Yang ZL, Dvorak J. 1998. Position effects of ribosomal RNA multigene loci on meiotic recombination in wheat. Genetics 149: 11051113.
  • Luo MC, Thomas C, You FM, Hsiao J, Ouyang S, Buell CR, Malandro M, McGuire PE, Anderson OD, Dvorak J. 2003. High-throughput fingerprinting of bacterial artificial chromosomes using the snapshot labeling kit and sizing of restriction fragments by capillary electrophoresis. Genomics 82: 378389.
  • Marra MA, Kucaba TA, Dietrich NL, Green ED, Brownstein B, Wilson RK, McDonald KM, Hillier LW, McPherson JD, Waterston RH. 1997. High throughput fingerprint analysis of large-insert clones. Genome Research 7: 10721084.
  • McIntosh RA, Devos KM, Dubcovsky J, Rogers WJ, Morris CF, Appels R, Anderson OA. 2005. Catalogue of gene symbols for wheat 2005. http://wheat.pw.usda.gov/ggpages/wgc/2005upd.html.
  • Mesfin A, Frohberg RC, Anderson JA. 1999. RFLP markers associated with high grain protein from Triticum turgidum L. var. dicoccoides introgressed into Hard Red Spring Wheat. Crop Science 39: 508513.
  • Michaels SD, Amasino RM. 1998. A robust method for detecting single-nucleotide changes as polymorphic markers by PCR. Plant Journal 14: 381385.
  • Nevo E, Korol AB, Beiles A, Fahima T. 2002. Evolution of wild emmer and wheat improvement: population genetics, genetic resources, and genome organization of wheat's progenitor Triticum dicoccoides. Berlin, Germany: Springer-Verlag.
  • Olmos S, Distelfeld A, Chicaiza O, Schlatter AR, Fahima T, Echenique V, Dubcovsky J. 2003. Precise mapping of a locus affecting grain protein content in durum wheat. Theoretical and Applied Genetics 107: 12431251.
  • Qi LL, Echalier B, Chao S, Lazo GR, Butler GE, Anderson OD, Akhunov ED, Dvorak J, Linkiewicz AM, Ratnasiri A, Dubcovsky J, Bermudez-Kandianis CE, Greene RA, Kantety R, La Rota CM, Munkvold JD, Sorrells SF, Sorrells ME, Dilbirligi M, Sidhu D, Erayman M, Randhawa HS, Sandhu D, Bondareva SN, Gill KS, Mahmoud AA, Ma XF, Miftahudin Gustafson JP, Con ley EJ, Nduati V, Gonzalez-Hernandez JL, Anderson JA, Peng JH, Lapitan NL, Hossain KG, Kalavacharla V, Kianian SF, Pathan MS, Zhang DS, Nguyen HT, Choi DW, Fenton RD, Close TJ, McGuire PE, Qualset CO, Gill BS. 2004. A chromosome bin map of 16 000 expressed sequence tag loci and distribution of genes among the three genomes of polyploid wheat. Genetics 168: 701712.
  • Sears ER. 1953. Nullisomic analysis in common wheat. American Naturalist 87: 245252.
  • Sears ER. 1966. Nullisomic-tetrasomic combinations in hexaploid wheat. In: Rilly, Royal, Lewis, KR, eds. Chromosome Manipulations and Plant Genetics. Edinburgh, USA: Oliver & Boyd. 2945.
  • See D, Kanazin V, Kephart K, Blake T. 2002. Mapping genes controlling variation in barley grain protein concentration. Crop Science 42: 680685.
  • Simmonds NW. 1995. The relation between yield and protein in cereal grain. Journal of the Science of Food and Agriculture 67: 309315.
  • Sourdille P, Cadalen T, Guyomarc’h H, Snape JW, Perretant MR, Charmet G, Boeuf C, Bernard S, Bernard M. 2003. An update of the Courtot × Chinese Spring intervarietal molecular marker linkage map for the QTL detection of agronomic traits in wheat. Theoretical and Applied Genetics 106: 530538.
  • Stein N, Feuillet C, Wicker T, Schlagenhauf E, Keller B. 2000. Subgenome chromosome walking in wheat: a 450-kb physical contig in Triticum monococcum L. spans the Lr10 resistance locus in hexaploid wheat (Triticum aestivum L.). Proceedings of the National Academy of Sciences, USA 97: 1343613441.
  • Wei F, Gobelman-Werner K, Morroll SM, Kurth J, Mao L, Wing Royal, Leister D, Schulze-Lefert P, Wise RP. 1999. The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 153: 19291948.
  • Winckler W, Myers SR, Richter DJ, Onofrio RC, McDonald GJ, Bontrop RE, McVean GA, Gabriel SB, Reich D, Donnelly P, Altshuler D. 2005. Comparison of fine-scale recombination rates in humans and chimpanzees. Science 308: 107111.
  • Yan L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J. 2003. Positional cloning of the wheat vernalization gene. Vrn1. Proceedings of the National Academy of Sciences, USA 100: 62636268.
  • Yan L, Loukoianov A, Blechl A, Tranquilli G, Ramakrishna W, SanMiguel P, Bennetzen JL, Echenique V, Dubcovsky J. 2004. The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 303: 16401644.
  • Young ND, Tanksley SD. 1989. Restriction fragment length polymorphism maps and the concept of graphical genotypes. Theoretical and Applied Genetics 77: 95101.
  • Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X, Cao M, Liu J, Sun J, Tang J, Chen Y, Huang X, Lin W, Ye C, Tong W, Cong L, Geng J, Han Y, Li L, Li W, Hu G, Huang X, Li W, Li J, Liu Z, Li L, Liu J, Qi Q, Liu J, Li L, Li T, Wang X, Lu H, Wu T, Zhu M, Ni P, Han H, Dong W, Ren X, Feng X, Cui P, Li X, Wang H, Xu X, Zhai W, Xu Z, Zhang J, He S, Zhang J, Xu J, Zhang K, Zheng X, Dong J, Zeng W, Tao L, Ye J, Tan J, Ren X, Chen X, He J, Liu D, Tian W, Tian C, Xia H, Bao Q, Li G, Gao H, Cao T, Wang J, Zhao W, Li P, Chen W, Wang X, Zhang Y, Hu J, Wang J, Liu S, Yang J, Zhang G, Xiong Y, Li Z, Mao L, Zhou C, Zhu Z, Chen Royal, Hao B, Zheng W, Chen S, Guo W, Li G, Liu S, Tao M, Wang J, Zhu L, Yuan L, Yang H. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296: 7992.