Glutathione reductase from pea leaves: response to abiotic stress and characterization of the peroxisomal isozyme

Authors

  • María C. Romero-Puertas,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • Francisco J. Corpas,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • Luisa M. Sandalio,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • Marina Leterrier,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • María Rodríguez-Serrano,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • Luis A. Del Río,

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author
  • José M. Palma

    1. Departamento de Bioquímica, Biología Celular y Molecular de Plantas, Estación Experimental del Zaidín, CSIC, Apartado 419, E−18080 Granada, Spain
    Search for more papers by this author

Author for correspondence: Jose M. Palma Tel: +34 958 181600 Fax: +34 958 129600 Email: jmpalma@eez.csic.es

Summary

  • • The glutathione reductase (GR; EC 1.6.4.2) isozyme present in peroxisomes has been purified for the first time, and its unequivocal localization in these organelles, by immunogold electron microscopy, is reported.
  • • The enzyme was purified c. 21-fold with a specific activity of 9523 units mg−1 protein, and a yield of 44 µg protein kg−1 leaves was obtained. The subunit size of the peroxisomal GR was 56 kDa and the isoelectric point was 5.4. The enzyme was recognized by a polyclonal antibody raised against total GR from pea (Pisum sativum) leaves.
  • • The localization of GR in peroxisomes adds to chloroplasts and mitochondria where GR isozymes are also present, and suggests a multiple targeting of this enzyme to distinct cell compartments depending on the metabolism of each organelle under the plant growth conditions.
  • • The expression level of GR in several organs of pea plants and under different stress conditions was investigated. The possible role of peroxisomal GR under abiotic stress conditions, such as cadmium toxicity, high light, darkness, high temperature, wounding and low temperature, is discussed.

Introduction

Glutathione reductase (GR; EC 1.6.4.2) is a ubiquitous flavoenzyme that converts oxidized glutathione (GSSG) to the reduced form (GSH), with concomitant oxidation of NADPH (Halliwell & Gutteridge, 2000). The tripeptide glutathione (γ-l-glutamyl-l-cysteinyl-glycine) is the major free intracellular thiol compound in plants, where it functions as a powerful reductant that maintains protein thiols in their reduced state and protects membranes against peroxidation by reactive oxygen species (ROS). The thiol group of two glutathione molecules can be oxidized, yielding the dimeric oxidized glutathione form, which is unable to protect against oxidation (Halliwell & Gutteridge, 2000; Foyer & Noctor, 2001; Noctor et al., 2002). Reduced glutathione participates in signalling processes by itself, and also as nitrosoglutathione (GSNO) after its reaction with nitric oxide (Noctor et al., 2002; del Río et al., 2003; Díaz et al., 2003; Lindermayr et al., 2005, Barroso et al., 2006). In plants grown under abiotic stress in the form of heavy metals and xenobiotics, GSH is an essential molecule. It is the repetitive piece from which phytochelatins, small peptides involved in zinc (Zn) and cadmium (Cd) detoxification, are synthesized (Cobbett & Goldsbrough, 2002). It is also used by glutathione S-transferases to bind and detoxify xenobiotic compounds (Marrs, 1996; Edwards et al., 2000; Romero-Puertas et al., 2004).

In plants, GR is the GSH-regenerating enzyme of the ascorbate-glutathione cycle, which removes hydrogen peroxide (H2O2) with the concerted action of three other enzymes – ascorbate peroxidase (APX), monodehydroascorbate reductase (MDAR), dehydroascorbate reductase (DAR) – plus GSH and ascorbate (Noctor & Foyer, 1998; Asada, 2000; Halliwell & Gutteridge, 2000). Glutathione reductases have been linked to many situations where oxidative stress occurs, such as salinity, drought, UV radiation, high light intensity, chilling and contamination by ozone, heavy metals and herbicides, among others (Foyer et al., 1991; Mullineaux & Creissen, 1997; Lascano et al., 1998; Apel & Hirt, 2004; Romero-Puertas et al., 2004). Under these conditions, competition for NADPH between GR and the photoreductive carbon cycle enzymes takes place.

Glutathione reductases have been purified from diverse plant species. The native enzyme of most GRs is a homodimer of c. 100–120 kDa, and its subunit size ranges between 53 kDa and 59 kDa (Wingsle, 1989; Anderson et al., 1990; Edwards et al., 1990; Madamanchi et al., 1992). Glutathione reductase has been mainly localized in chloroplasts, mitochondria and the cytosol (Edwards et al., 1990; Madamanchi et al., 1992; Creissen et al., 1995; Jiménez et al., 1997; Rudhe et al., 2004), but also in peroxisomes (Jiménez et al., 1997; del Río et al., 2002a). In these organelles two enzymes of the ascorbate-glutathione cycle were found inserted in the peroxisomal membrane (APX and MDAR) whereas GR and DAR occurred in the peroxisomal matrix (Jiménez et al., 1998; del Río et al., 2002a). By contrast with the chloroplastic, mitochondrial and cytosolic GRs, the molecular properties of the peroxisomal GR remain unknown.

The distribution of an enzyme system in several organelles indicates that different topogenic signals direct its targeting to different cell compartments, and this is relevant from the viewpoint of the differential regulation of the distinct isozymes under plant stress conditions. Peroxisomes are subcellular organelles bound by a single membrane with an essentially oxidative metabolism (del Río et al., 2002a,b, 2003). These organelles with their intricate ROS-machinery and antioxidants, including GR, have been demonstrated to be involved in leaf senescence (del Río et al., 1998; Jiménez et al., 1998) and in the response to several abiotic stresses (Romero-Puertas et al., 1999; McCarthy et al., 2001a,b; del Río et al., 2002b, 2003; Mittova et al., 2003, 2004). In this work, the purification of peroxisomal GR was carried out for the first time and some of its molecular properties are reported. The expression of GR in pea plants under different stress conditions was also investigated, and the possible role of peroxisomal GR in these situations is discussed.

Materials and Methods

Plant material and growth conditions

Pea seeds (Pisum sativum L.), obtained from Royal Sluis (Enkhuizem, the Netherlands) were sterilized with 10% (v : v) ethanol and germinated in vermiculite for 10 d under greenhouse conditions. Plantlets were grown under the same greenhouse conditions for 14–28 d with full-nutrient solutions (del Río et al., 1985).

For the expression analysis of leaf GR under Cd stress conditions, plants were grown in the presence of 50 µm CdCl2 for 14 d, as reported by Sandalio et al. (2001). For the other abiotic stress experiments, pea plantlets 2–3 wk old grown in vermiculite were subjected to the following conditions:

Continuous light (CL)– illumination for 48 h at 190 µE s−1 m−2 in a chamber at 24°C.

High light intensity (HLI)– irradiation for 4 h at 1189 µE s−1 m−2, using a lamp (GE 300 model W-230 V PAR 56/WFL). To avoid heating of plants, a Petri dish (19 cm diameter) containing cold water was placed 4 cm above plants, and water was replaced every 30 min. Under these conditions the temperature was maintained in the range 23–25°C.

Continuous dark (CD)– in a growth chamber at 24°C for 48 h.

Mechanical wounding (MW)– leaves in plantlets were injured with a striped-tip forceps, and after 4 h, damaged leaves were excised and analysed.

Low temperature (LT)– plantlets were grown for 48 h at 8°C.

High temperature (HT)– plantlets were sequentially exposed to 30°C for 1 h, 35°C for 1 h, and, finally, 38°C for 4 h.

The illumination conditions for the LT and HT treatments were those indicated for CL.

RNA isolation and Northern blot analysis

Total RNA was extracted from the different organs of pea plants (leaves, shoots, roots, flowers, pods and seeds from 50- to 55-d-old plants) using the Trizol method, and following the manufacturer's instructions (GibcoBRL, Life Technologies, Paisley, UK). Samples 15 µg of total RNA were subjected to electrophoresis on 1.2% (w : v) agarose-Mops gels under denaturing conditions (Sambrook et al., 1989).

For Northern blotting, RNA was transferred to nylon membranes (Bio-Rad Laboratories, Hercules, CA, USA) by capillarity overnight, and crosslinked under UV light. The transfer efficiency was checked by staining membranes with 0.04% (w : v) methylene blue (Sambrook et al., 1989). Hybridization was carried out in sodium (Na)-phosphate buffer 0.5 m, pH 7.1, 2 mm ethylenediaminetetraacetic acid (EDTA), 7% (w : v) sodium dodecyl sulphate (SDS), 0.1% (w : v) Na-pyrophosphate at 42–65°C for 2 h (Church & Gilbert, 1984), using 32P-labelled cytosolic GR cDNA from pea (Stevens et al., 1997). Analyses of membranes were performed by autoradiography with an X-ray film (Hyperfilm MP; Amersham Pharmacia Biotechnology, Piscataway, NJ, USA).

For the semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR) technique, the oligonucleotides included in Table 1 were used.

Table 1.  Oligonucleotides used for the semiquantitative polymerase chain reaction analysis
EnzymeOligonucleotide sequences (5′−3′)GenBank accession no.
  1. F, forward; R, reverse.

Glutathione reductase (chloroplastic; GR1)F: TCGCAGCACTCTCTTCTTCA
R: CTCCATCCAAAACCATTGCT
X60373
Glutathione reductase (cytosolic; GR2)F: ACAGTATTTGGTGGGCAAGC
R: AAACTGCGCTTTCGTAGCTC
X98274
Actin IIF: AGCAAGATCCAAACGAAGGA
R: AATGGTGAAGGCTGGATTTG
X68649

Two micrograms of total RNA from leaves was used as a template for the reverse transcriptase reaction. This was added to a mixture containing 5 mm MgCl2, 1 mm dNTPs, 0.5 µg oligo (dT) primers, 1× RT-Buffer, 20 U Rnasin ribonuclease inhibitor, 15 U AMV reverse transcriptase (Promega, Madison, WI, USA). The reaction was carried out at 42°C for 40 min, followed by a 5-m step at 98°C, and then by cooling at 4°C.

Amplification of actin II cDNA from pea (X68649) was chosen as a control. Each specific mRNA and actin II (ACTII) cDNAs were amplified by PCR as follows: 1 µl of the produced cDNA diluted 1 : 20 was added to 250 µm dNTPs, 1.5 mm MgCl2, 1× PCR buffer, 1 U of Ampli Taq Gold (PE Applied Biosystems, Foster City, CA, USA) and 0.5 µm of each specific oligonuclotide (see Table 1) in a final volume of 20 µl. Reactions were carried out in a Hybaid thermo-cycler. A first step of 10 min at 94°C was followed by 28–33 cycles (depending on the enzymes) according to the following protocol: 30 s at 94°C, 30 s at 60°C and 45 s at 72°C. Amplified PCR products were detected by electrophoresis on 1% agarose gels and staining with ethidium bromide.

Quantification of the bands was performed with a Gel Doc System (Bio-Rad Laboratories) coupled with a high sensitivity charge-coupled device (CCD) camera. Band intensities were expressed as relative absorbance units. The ratio between the specific enzyme and the ACTII amplification was calculated to normalize the initial variations in sample concentrations. Means and standard deviations (not indicated in Figures) were calculated after normalization with ACTII.

Preparation of crude extracts

Immediately after plants were subjected to the different stress conditions, pea leaves were pulverized under liquid nitrogen, and 100 mm Tris-HCl buffer, pH 8.0, containing 1 mm EDTA, 0.1% (v : v) Triton X-100, 2 mm dithiothreitol (DTT) was added (1 : 2, w : v). Homogenates were centrifuged at 27 000g for 15 min, and supernatants were cleared using PD10 (Amersham Pharmacia Biotechnology) columns.

Enzyme activity

The oxidation rate of NADPH at 340 nm was followed as described by Edwards et al. (1990). The reaction mixture (1 ml) contained 0.1 mN-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (HEPES) buffer, pH 7.8, 1 mm EDTA, 3 mm MgCl2 and 0.5 mm GSSG and appropriate amounts of sample (25–150 µl). Mixtures without GSSG were used as negative controls. In samples containing DTT, NAP10 columns (Amersham Pharmacia Biotechnology) were used to remove the reducing agent thus avoiding unspecific NADPH reduction. Protein concentration was determined according to Bradford (1976), using bovine serum albumin (BSA) to standardize the method.

Purification of peroxisomal GR

Unless otherwise stated, all operations were carried out at 0–4°C. Pea leaves were washed with distilled water, and then homogenized as described by López-Huertas et al. (1995). Peroxisomes were isolated from pea leaf homogenates by two differential centrifugations, and the final 12 000g particulate pellets, enriched in peroxisomes and mitochondria, were subjected to sucrose density-gradient centrifugation (35–60%, w : w), as described by López-Huertas et al. (1995). After centrifugation, gradients were eluted with a gradient fractionator (model 185; Isco, Lincoln, NE, USA) equipped with an optical unit and an absorbance detector. Further characterization of the sucrose gradients, using specific marker enzymes of different organelles, was carried out. Catalase and glycolate oxidase were used as marker enzymes of peroxisomes and the purified organelles obtained by this procedure had intactness percentages of c. 90% (López-Huertas et al., 1995). In order to assess possible contamination of peroxisomes, the gradient fractions were assayed for fumarase, fructose-1,6-bisphosphatase, acid phosphatase and cytochrome c reductase activities, as marker enzymes of mitochondria, chloroplasts, vacuoles and endoplasmic reticulum (ER), respectively. Peroxisomes purified by this method showed low cross-contamination (< 2%) by mitochondria, chloroplasts, vacuoles and endoplasmic reticulum (Distefano et al., 1997).

To obtain peroxisomal soluble fractions (matrices), purified peroxisomes from several sucrose density-gradients were broken by hypotonic shock in 100 mm potassium (K)-phosphate buffer, pH 7.8, 1 mm EDTA (López-Huertas et al., 1995; Distefano et al., 1997). The suspensions were centrifuged at 120 000g for 30 min to separate the organelle membranes. Excess sucrose in the peroxisomal supernatants was removed by gel-filtrating the samples in PD10 columns (Pharmacia LKB Laboratories, Uppsala, Sweden), and matrices were concentrated by ultrafiltration with a PM-10 membrane (Amicon, Beverly, MA, USA).

Concentrated peroxisomal matrices were applied to a Mono Q HR 5/5 column connected to an ÄKTA FPLC system (Amersham Pharmacia Biotechnology). Sample volumes of 1 ml were loaded onto the Mono Q column, previously equilibrated with 50 mm K-phosphate buffer, pH 7.8, containing 1 mm DTT, and the fractionation was performed at room temperature. The column was washed with 18 ml of equilibrating buffer, and then eluted with 24 ml of a linear salt gradient (0–0.5 m KCl) in equilibrating buffer. Fractions of 1 ml were collected at a flow rate of 1 ml min−1. The GR activity-containing fractions were pooled, concentrated by ultrafiltration, and subjected to affinity chromatography. A 2′5′-ADP Sepharose 4B (Amersham Pharmacia Biotechnology) column (3.5 × 0.5 cm internal diameter) was equilibrated in 50 mm K-phosphate, pH 7.8, 1 mm EDTA, 10 mmβ-mercaptoethanol. Sample volumes of 1 ml were applied to the column and this was kept at room temperature for 1 h to allow binding of samples to the active groups of the gel. Unbound proteins were eluted as only one fraction with 5 ml equilibrating buffer. The bound proteins were then eluted in a single fraction with 5 ml of equilibrating buffer containing 1 mm NADP. Finally, 10 ml 0.5 m NaCl in equilibrating buffer were applied to the column to elute bound unspecific material. The NADP-eluted fraction, containing GR activity, was concentrated to a small volume with Centricon 10 concentrators (Amicon).

Determination of the subunit size

The subunit size was determined by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) after heating the samples at 100°C for 5 min in the presence of 0.1% (w : v) SDS and 5 mm DTT. Electrophoresis was performed in 12% acrylamide slab gels (MiniProtean II; Bio-Rad Laboratories), as described by Corpas et al. (1998). Standards used were: phosphorylase b (Mr = 97 400), BSA (Mr = 66 000), ovoalbumin (Mr = 45 000), carbonic anhydrase (Mr = 31 000), soybean trypsin inhibitor (Mr = 21 500), and lysozyme (Mr = 14 400) (Bio-Rad Laboratories). Proteins were detected in gels by silver staining (Heukeshoven & Dernick, 1985).

Western blotting

A SDS-PAGE was carried out in 12% acrylamide gels, as described above. For immunoblotting, after SDS-PAGE proteins were transferred to polyvinyldifluoride (PVDF) membranes (Immobilon P transfer membranes; Millipore Corporation, Bedford, MA, USA) in a Semi-Dry Transfer Cell (Bio-Rad Laboratories). Membranes were processed for recognition with a specific antibody against GR from pea leaves (Edwards et al., 1990), using the immunoblot conditions described by Corpas et al. (1998).

Isoelectric focusing

Isoelectric focusing was carried out in 6% acrylamide slab vertical gels (MiniProtean II; Bio-Rad Laboratories) in a pH range of 4–6, according to Corpas et al. (1999). The following isoelectric point standards (Pharmacia LKB Biotechnology, Uppsala, Sweden) were used: pepsinogen (pI = 2.80), amyloglucosidase (pI = 3.50), red-methyl (pI = 3.75), glucose oxidase (pI = 4.15), soybean trypsin inhibitor (pI = 4.55), β-lactoglobulin (pI = 5.20), bovine carbonic anhydrase B (pI = 5.85) and human carbonic anhydrase B (pI = 6.55). After isoelectric focusing, gels were processed for either silver staining for protein detection (Corpas et al., 1999) or GR activity (Ye et al., 1997). In the latter case, after electrophoresis gels were immersed for 15 min into 0.6 mm DTNB, prepared in 50 mm K-phosphate buffer, pH 8.0, at room temperature and darkness. The gels were then incubated for 30 min in a solution containing 1.2 mm GSSG and 0.35 mm NADPH in the same buffer. Finally, gels were transferred into a 1 mm NBT, 0.04 mm DCIP solution, prepared in the buffer mentioned above, and incubated in the dark for 4–10 h, until blue-purple bands appeared.

Electron microscopy and immunocytochemistry

Pea leaf segments (1 mm2) were fixed according to Corpas et al. (1994). Labelling experiments were done using ultrathin sections with antibodies against GR, as primary antibody, and goat antirabbit IgG conjugated to 15 nm gold particles as secondary antibody. Sections were poststained in 2% (w : v) uranyl acetate for 3 min and examined with a Zeiss EM 10C transmission electron microscope (Sandalio et al., 1997).

Results

The activity of the peroxisomal GR, an enzyme which has not yet been characterized, was twofold higher in leaves from plants treated with 50 µm Cd2+, but no parallel response was observed in the protein level of the peroxisomal enzyme (Fig. 1a). The GR activity was also studied by nondenaturing PAGE and further specific activity staining. The peroxisomal isozyme comigrated with the band detected in crude extracts, and was slightly slower than the GR activity band detected in mitochondria (Fig. 1b). However, the analysis of the GR isoenzymatic pattern by isoelectric focusing showed that the activity detected in crude extracts was resolved into four independent bands (results not shown).

Figure 1.

Effect of cadmium on glutathione reductase (GR) from pea (Pisum sativum) leaves. (a) The GR activity and specific protein content, determined by Western blotting, were assayed in crude extracts (30 µg) and in leaf peroxisomes (0.7 µg). (b) Nondenaturing PAGE and specific activity staining of GR from crude extracts (70 µg protein), mitochondria (3 µg) and peroxisomes (3 µg) from pea leaves. (c) The expression levels of chloroplastic and cytosolic GRs were analysed by semiquantitative reverse transcriptase polymerase chain reaction using actin II as control. The values represent the mean from at least three separate amplifications of each transcript upon two different reverse transcription reactions. Value 1 represents no changes in the expression level of GRs.

Total GR transcripts were also analysed in leaves from plants grown under high Cd concentrations by semiquantitative RT-PCR. Cadmium did not affect the expression of either chloroplastic or cytosolic GRs (Fig. 1c). Accordingly, in leaf crude extracts the GR activity and specific protein content, determined by Western blot analysis, did not vary with the Cd treatment (Fig. 1a).

The presence of GR in plant peroxisomes was first reported by Jiménez et al. (1997) in organelles isolated from pea leaves by measuring the GR enzymatic activity. In this work, the peroxisomal localization of this isozyme was corroborated by immunogold electron microscopy studies. GR was mainly localized in chloroplasts and mitochondria, but also in peroxisomes (Fig. 2).

Figure 2.

Immunogold electron microscopy localization of glutathione reductase (GR) in (Pisum sativum) pea leaves. Arrows show the localization of GR indicated by the detection of the 15 nm gold particles. (a) Micrograph showing sections of two chloroplasts (Ch) and one mitochondrion (M). (b) Micrograph showing one peroxisome where the peroxisomal core (PC) and the peroxisomal matrix (PM) are well differentiated. Bar, 1 µm.

Because of the differential behaviour of the leaf peroxisomal GR in pea plants under Cd stress, compared with the total activity of crude extracts, and the lack of reports on its molecular properties, it was important to purify and characterize this GR isoenzyme. The enzyme was purified to homogeneity from leaf peroxisomes isolated from pea plants, using two successive chromatographic steps: anion exchange and affinity column chromatography. In the first step, using a Mono Q HR column GR eluted at KCl concentrations in the range 0.10–0.18 m (fractions 24–27; Fig. 3). In the next step of affinity column chromatography in an ADP-Sepharose column, most GR protein (70–80%) eluted with two column volumes (5 ml) of 1 mm NADP. The remaining 20–30% protein was recovered by an additional elution with 0.5 m NaCl, but other contaminating peptides appeared in this fraction after analysis by SDS-PAGE (Fig. 4, lane 4). Therefore, only the NADP-eluting fraction was considered to obtain the pure enzyme.

Figure 3.

Fractionation of peroxisomes isolated from leaves of pea (Pisum sativum) plants on a Mono Q column using a fast protein liquid chromatography (FPLC) system. Leaf peroxisomes were purified from pea leaves by differential centrifugation and sucrose density-gradient centrifugation, as described in the Materials and Methods section. Peroxisomal soluble fractions (matrices) were obtained by hypotonic shock of intact peroxisomes, and were fractionated on a Mono Q column. Upper graph indicates the absorbance at 280 nm of the eluted fractions, whereas the lower panel shows the glutathione reductase (GR) activity in fractions as arbitrary units.

Figure 4.

Sodium dodecyl sulphate–polyacrylamide gel electrophoresis and immunoblotting of purified glutathione reductase (GR) from pea (Pisum sativum) leaf peroxisomes. Proteins were either stained with silver (lanes 1–5), or analysed by Western blot with an antibody against GR from pea leaves (lane 6). 1, molecular mass markers; 2, peroxisomal matrices (30 µg); 3, GR activity-containing fractions from the Mono Q column (3 µg); 4, NaCl-eluted fraction from the affinity chromatography step (0.4 µg); 5, purified GR after the affinity chromatography step (40 ng); 6, immunoblot of purified GR after the affinity chromatography step (30 ng). A 1/2000 dilution of the antibody was used.

The purification of peroxisomal GR is summarized in Table 2. The enzyme was purified c. 21-fold with a specific activity of 9523 units mg−1 protein, and a yield of 44 µg protein kg−1 leaves was obtained by the purification procedure followed. The enzyme was homogenous as indicated by the single protein band obtained after SDS-PAGE analysis and silver staining (Fig. 4, lane 5). The subunit size of purified GR was 56 kDa, and the enzyme was recognized by a polyclonal antibody against total GR from pea leaves (Fig. 4, lane 6).

Table 2.  Purification of glutathione reductase from leaf peroxisomes isolated from pea (Pisum sativum) plants (1000 g of pea leaves were processed)
StepTotal activity (Units)Total protein (mg)Specific activity (Units mg−1)Yield (%)Purification (fold)
  1. FPLC, fast protein liquid chromatography.

Peroxisomal matrices9872.19 451100 1
Mono Q FPLC6910.2332966 70 6.6
ADP-Sepharose4190.0449523 4221

The UV-visible absorption spectrum of the purified enzyme was characterized by a single absorption maximum at 260 nm (Fig. 5). If it is assumed that the native molecular mass of peroxisomal GR is similar to that of nonchloroplastic GRs from pea leaves (114 kDa) (Madamanchi et al., 1992), then the peroxisomal GR reported in the present work would have a molar extinction coefficient at 260 nm (ɛ260) of 12.4 × 108 m−1 cm−1. The isoelectric point of the purified GR was determined by isoelectric focusing at a pH range of 4–6 in vertical slab minigels, and a value of 5.4 was determined (results not shown).

Figure 5.

The UV-visible absorption spectra of glutathione reductase (GR) purified from pea (Pisum sativum) leaf peroxisomes. An enzyme concentration of 3.816 µg ml−1 was used.

The expression level of GR in different organs of pea plants was investigated by Northern blot analysis using cytosolic GR cDNA. Flowers, shoots and, to a lesser extent, pods, showed the highest transcription levels, whereas in roots, seeds and leaves the expression of GR was lower (Fig. 6a). Additionally, the transcription level of both chloroplastic and cytosolic GR genes was analysed by semiquantitative RT-PCR in leaves from plants subjected to different stress conditions, using the expression of constitutive actin II as control (Fig. 6b). Chloroplastic GR (GR1) appeared to be repressed by high light, continuous dark and high temperature and induced by mechanical wounding. Conversely, cytosolic GR (GR2) appeared to be repressed by high light and darkness. However, the most drastic effect was observed when plants were subjected to low temperature with a high induction of the two isoforms. Total GR activity was determined in leaves from pea plants subjected to the abiotic stresses mentioned above. Except for darkness, GR activity increased slightly in all treatments (Fig. 6c).

Figure 6.

Expression and activity of glutathione reductase (GR) in different organs of pea (Pisum sativum) plants and in leaves from plants subjected to abiotic stress conditions. (a) Northern blot. The following organs were analysed: R, roots; SH, shoots; L, leaves; F, flowers; P, pods; S, seeds. (b) Semiquantitative reverse transcriptase polymerase chain reaction: chloroplast (GR1) and cytosolic (GR2) glutathione reductase cDNA were used (Stevens et al., 1997). Actin II (ACT II) was used as control to standardize the expression of both GRs. The value of each enzyme transcript is expressed as percentage of the signal delivered by amplification of the ACT II RNA, used as internal control. The values represent the mean from at least three separate amplifications of each transcript upon two different reverse transcription reactions. Value 1 represents no changes in the expression level of GRs. Values below 0.8 and above 1.2 are significantly different. (c) Enzyme activity of crude extracts. Values represent the mean of at least three replicates ± SEM. CL, continuous light; HLI, high light intensity; CD, continuous dark; MW, mechanical wounding; LT, low temperature; HT, high temperature. Asterisks indicate that the differences are significant.

Discussion

In the present work, the purification and partial characterization of a glutathione reductase from leaf peroxisomes is reported for the first time. Several GR forms have been purified and characterized from different plant sources (Guy & Carter, 1984; Wingsle, 1989; Anderson et al., 1990), and the most studied GRs are those from pea plants particularly the isozymes located in chloroplasts, cytosol and mitochondria (Kalt-Torres et al., 1984; Bielawski & Joy, 1986; Edwards et al., 1990; Madamanchi et al., 1992; Creissen et al., 1995; Stevens et al., 1997, 2000; Rudhe et al., 2004). However, it was not until 1997 when the first evidence of the localization of GR activity in peroxisomes was reported (Jiménez et al., 1997), and the characterization of this peroxisomal isoform has not been achieved so far. To the authors’ knowledge, this is the first report that unequivocally demonstrates the localization of GR in peroxisomes, by using immunogold electron microscopy.

Our interest in GR from peroxisomal origin stemmed from the response found for this peroxisomal enzyme in pea plants subjected to different types of abiotic stress (Romero-Puertas et al., 1999; McCarthy et al., 2001a, 2001b) and during the senescence of pea leaves (Jiménez et al., 1998; del Río et al., 1998). In pea plants, Cd induced a concentration-dependent oxidative stress in leaves, characterized by an accumulation of lipid peroxides and oxidized proteins (Sandalio et al., 2001). Although the total GR activity and protein content, determined in crude extracts from leaves did not vary with the Cd treatment, a twofold increase in the peroxisomal GR activity was found, confirming other previously reported results in our laboratory (Romero-Puertas et al., 1999, 2002). However, analysis by Western blotting showed the absence of a parallel increase in the peroxisomal GR protein content, indicating that a post-translational activation of this isozyme might take place. In these Cd-induced responses, the ascorbate–glutathione cycle, where GR is involved, played an essential role, and this prompted us to approach the characterization of the peroxisomal GR from pea leaves.

Furthermore, peroxisomal GR might also participate in the response to other abiotic stresses, such as those reported in this work. It has been proposed that the alteration in the kinetic properties of pea GR in response to stress were explained as changes in the isoform population (Edwards et al., 1994; Stevens et al., 1997). In our experimental stress conditions, the comparison between results of total GR activity in crude extracts and the corresponding transcript levels showed no correlations. Thus, except for darkness, all other treatments increased the total GR activity c. 18–24%, whereas the expression patterns of both chloroplastic and cytosolic GRs were variable. This suggests that a post-translational regulation of GR is taking place under these conditions, where the peroxisomal isozyme could have a relevant role. This strategy guarantees the supply of GSH for the ascorbate–glutathione cycle and other reactions (Noctor et al., 2002) and to bind nitric oxide (NO) to form GSNO, a long-distance signal molecule which can operate under certain stress conditions (del Río et al., 2003, 2004; Díaz et al., 2003; Lindermayr et al., 2005; Barroso et al., 2006).

Peroxisomes isolated from pea leaves were used to purify the enzyme, thus avoiding contamination by GRs known to be present in chloroplasts, cytosol and mitochondria (Edwards et al., 1990; Madamanchi et al., 1992; Stevens et al., 1997, 2000; Rudhe et al., 2004). Thus, the starting material used in this work for the purification of the enzyme was not contaminated by mitochondria and chloroplasts, as indicated by the absence in the purified peroxisomal fractions of their respective marker enzymes, fumarase and fructose-1,6-bisphosphatase. This strategy has been broadly used for the purification of enzymes that are distributed in different cell compartments, and with respect to peroxisomal enzymes, a manganese superoxide dismutase (Mn-SOD) and several catalase isoforms have been purified and characterized from peroxisomes isolated from pea leaves (Palma et al., 1998; Corpas et al., 1999).

Peroxisomal GR was purified to homogeneity and its specific activity was found to be two to three times higher than that determined for other glutathione reductases (Kalt-Torres et al., 1984; Bielawski & Joy, 1986; Wingsle, 1989; Madamanchi et al., 1992). The molecular properties of the peroxisomal GR are similar to those described for most GRs. Thus, the subunit size is very close to that determined for the enzymes from pea chloroplasts and mitochondria (Edwards & Joy, 1990; Madamanchi et al., 1992), pea roots (Bielawski et al., 1986), Scots pine needles (Wingsle, 1989), spinach leaves (Guy & Carter, 1984) and pine needles (Anderson et al., 1990). The isoelectric point reported in this work for peroxisomal GR (5.4) is slightly lower than that determined for other pea GRs. Edwards et al. (1990) found that pIs of chloroplastic GRs varied between 5.6 and 6.3, whereas the mitochondrial forms had pI values of 6.3–6.5. These authors attributed a cytoplasmic origin to the isozymes with pIs between 5.6 and 5.2. Nevertheless, these data contrast with those reported by Madamanchi et al. (1992) who obtained lower pIs for all the GR isozymes present in pea leaves.

An overview of the molecular properties of the pea GRs concludes that there are two cDNA classes: one of them corresponds to the cytosolic GR, whereas the other accounts for the different isoforms which appear to be products of the post-translational processing of a single gene. In plants, pea GR was the first dual targeting protein reported to be encoded by a single gene, whose products are imported into either chloroplasts or mitochondria owing to an ambiguous-targeting sequence located at the N-terminus (Creissen et al., 1995; Stevens et al., 1997; Cleary et al., 2002; Rudhe et al., 2002, 2004; Chew et al., 2003). In this context, it seems reasonable to assume that peroxisomal GR could be encoded by the same gene responsible for the chloroplastic and mitochondrial forms, and the product would be directed to peroxisomes by any of the specific peroxisomal targeting signals (PTS) reported so far (Johnson & Olsen, 2001; Brown & Baker, 2003; Reumann, 2004). This would explain the slight difference in the isoelectric point of both mitochondrial and peroxisomal GRs reported here, and might imply a fine regulation in the targeting process to the different compartments which is possibly linked to the metabolism of each organelle, depending on the environmental conditions where plants grow. However, the possibility that GR2 could encode a peroxisomal form was not ruled out (Stevens et al., 1997). In peroxisomes, a considerable number of additional splice variants and alternative start methionines (Met) have recently been detected (Reumann, 2004). The peroxisomal MDAR, which contains a PTS1 in its genomic clone, has been shown to combine a second Met thus encoding a new MDAR isoform which is possibly associated with mitochondria (Leterrier et al., 2005). Further research should be directed towards the identification of either the specific peroxisomal gene or the PTS sequences in the full GR gene.

In conclusion, despite the small contribution of peroxisomal GR to the total cell GR activity, this isozyme seems to play an important role under different stress conditions, either biotic (Kuzniak & Skłodowska, 2005) or abiotic (Romero-Puertas et al., 1999; McCarthy et al., 2001a,b; Mittova et al., 2003, 2004), by providing reduced GSH to the H2O2-scavenging ascorbate-glutathione cycle. Moreover, peroxisomes contain GSH (Jiménez et al., 1997, 1998) and can generate NO enzymatically (Corpas et al., 2004; Barroso et al., 1999). It is known that NO in the presence of oxygen can react with reduced glutathione to form S-nitrosoglutathione (GSNO), a reactive nitrogen species (Wink et al., 1996). Therefore, GSNO can be formed inside peroxisomes and this compound could function as a signal molecule transporting GSH-bound NO to neighbouring organelles/cells and throughout the plant (Noctor et al., 2002; Díaz et al., 2003; Lindermayr et al., 2005). This would lend support to the postulate that plant peroxisomes could act as subcellular indicators or sensors of plant stress by releasing different signalling molecules (NO, O2, H2O2, etc.) to the cytosol and triggering specific gene expressions (Corpas et al., 2001, 2004; Romero-Puertas et al., 2002).

Acknowledgements

This work was supported by the CICYT (grant BFI2002-04440) and the European Commission (contract HPRN-CT-2000-00094). M. C. R-P. and M. R-S. were recipients of postdoctoral and PhD fellowships from the Junta de Andalucía and Ministerio de Ciencia y Tecnología (Spain), respectively. M. L. acknowledges an RTN contract of the European Commission. The generous donation of antibodies against pea GR and the pea GR cDNAs provided by Prof. Phil M. Mullineaux, Department of Biological Sciences, University of Essex, UK, are appreciated. The authors sincerely thank Dr Ana M. León for her valuable help in the growth of pea plants under stress conditions. The electron microscopy analyses were carried out at the Centre of Scientific Instrumentation of the University of Granada.

Ancillary

Advertisement