SEARCH

SEARCH BY CITATION

Keywords:

  • ammonium transport;
  • ectomycorrhiza;
  • expression analysis;
  • metabolite pools;
  • Populus trichocarpa;
  • yeast complementation

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information
  • • 
    Ammonium and nitrate are the prevalent nitrogen sources for growth and development of higher plants. Here, we report on the characterization of the ammonium transporter (AMT) family in the perennial species Populus trichocarpa.
  • • 
    In silico analysis and expression analysis of AMT genes from poplar was performed. In addition, AMT1;2 and AMT1;6 function was studied in detail by heterologous expression in yeast.
  • • 
    The P. trichocarpa genome contains 14 putative AMTs, which is more than twice the number of AMTs in Arabidopsis. In roots, the high-affinity AMT1;2 strongly increased upon mycorrhiza formation and might be partly responsible for the high-affinity ammonium uptake component measured in poplar. Transcript level for the high-affinity AMT1;6 was strongly affected by the diurnal cycle. AMT3;1 was exclusively expressed in senescing poplar leaves. Remarkably AMT2;1 was highly expressed in leaves while AMT2;2 was mostly expressed in petioles. Specific expression of AMT1;5 in stamen and of AMT1;6 in female flower indicate that they have key functions in reproductive organ development in poplar.
  • • 
    The present study provides basic genomic and transcriptomic information for the poplar AMT family and will pave the way for deciphering the precise role of AMTs in poplar physiology.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Ammonium is a primary source of nitrogen (N) for both perennial and annual species. It is taken up from the soil by ammonium transporters through the plasma membrane of root cells (Kaiser et al., 2002) and incorporated into glutamine via glutamine synthetase (GS) present in the cytoplasm and plastids, the biochemistry of which has also been described in perennial species (Suarez et al., 2002). Ammonium is also produced within plants either by reduction of nitrate and nitrite obtained from the soil, or by catabolism of endogenous amino compounds. For example, the photorespiratory nitrogen cycle generates a large amount of ammonium in leaf mitochondrias that is subsequently transported to chloroplasts for reassimilation by GS, although this statement has now to be interpreted with caution, given the recent finding that the nuclear encoded GS GLN2 may also be addressed to the mitochondria (Taira et al., 2004).

The biochemistry and molecular biology of ammonium transport in plants has been extensively studied and recent comprehensive reviews are available (Schjoerring et al., 2002; Loque & von Wiren, 2004). Physiological studies on ammonium uptake by plant roots has provided evidence for the existence of a low affinity nonsaturable transport system (LATS), which operates in the millimolar concentration range and a high-affinity transport system (HATS), which operates in the submillimolar concentration range. The HATS exhibits saturation kinetics, energy dependence, and leads to depolarization of the plasma membrane electrical potential (Ludewig et al., 2002).

The first ammonium transporter (AMT) genes were identified in yeast (Marini et al., 1994) and Arabidopsis (Ninnemann et al., 1994) by functional complementation of a yeast mutant deficient in high-affinity ammonium uptake. In plants, the AMT family can be subdivided into two subfamilies (Loque & von Wiren, 2004). Members of the AMT1 subfamily are intron-free, except LjAMT1;1 (Salvemini et al., 2001); whereas members of AMT2 subfamily contain some introns in their gene sequences. The AMT2 family has been further divided into three subclades in rice (Suenaga et al., 2003). Several plant AMT1 subfamily members, including homologs from Arabidopsis thaliana (AtAMT1;1, AtAMT1;2, AtAMT1;3: Ninnemann et al., 1994; Gazzarrini et al., 1999), Brassica napus (BnAMT1;2: Pearson et al., 2002), Lotus japonicus (LjAMT1;1, LjAMT1;2, LjAMT1;3: Salvemini et al., 2001; D’Apuzzo et al., 2004), Lycopersicon esculentum (LeAMT1;1, LeAMT1;2 and LeAMT1;3: Lauter et al., 1996; von Wiren et al., 2000b; Becker et al., 2002; Ludewig et al., 2002) or Oryza sativa (OsAMT1;1, OsAMT1;2, OsAMT1;3; Sonoda et al., 2003) have been characterized in yeast or in Xenopus oocytes. AtAMT1;1 encodes a high-affinity transporter with a Km value of < 0.5 µm and is expressed in roots and leaves, while AtAMT1;2 and AtAMT1;3 encode transporters of lower affinity (Km values of 25–40 µm) and are mainly expressed in roots (Gazzarrini et al., 1999). AtAMT1;2 expressed in yeast mutant displays biphasic kinetics (Km values of 36 µm and 3.0 mm) for methylammonium uptake (Shelden et al., 2001). AMT expression has been studied in detail in Arabidopsis and rice, and the data demonstrated the close relationship between AMT1;1 and AMT1;3 expression with glutamine (Rawat et al., 1999) and sugar (Gazzarrini et al., 1999; Rawat et al., 1999) concentrations, respectively.

More recently, a second subfamily of ammonium transporters (AMT2) with distinct biochemical features, has been identified in several plants such as A. thaliana (Sohlenkamp et al., 2002), L. japonicus (Simon-Rosin et al., 2003) and O. sativa (Suenaga et al., 2003). Plant AMT2 family members are more closely related to ammonium transporters from prokaryotes than they are to plant AMT1. While plant members of the AMT1 subfamily are preferentially expressed in roots (with the exception of LeAMT1;3 (von Wiren et al., 2000b), LjAMT1;1 and LjAMT1;2 (D’Apuzzo et al., 2004), AtAMT2 showed a higher level of gene expression in shoots compared with roots (Sohlenkamp et al., 2002) and OsAMT2;1 presented a constitutive expression in shoots and roots (Suenaga et al., 2003). These distinct expression patterns may support the fact that individual members of the AMT family would function not only in ammonium uptake in roots, but also in ammonium recycling during leaf senescence or photorespiration (Howitt & Udvardi, 2000; von Wiren et al., 2000a). Multiple forms of ammonium transporters in higher plants allow a greater regulatory flexibility and organelle-, cell-, tissue- or organ-specialization, and enable cells to take up ammonium over a wide range of concentrations (D’Apuzzo et al., 2004).

As exemplified above, most studies have focused on a few annual species (A. thaliana, L. esculentum, L. japonicus and O. sativa), thus available information concerning N transport in perennial woody models is much more limited, particularly at the molecular level. The perennial life style of trees implies specific physiological traits that have been recently discussed (Suarez et al., 2002; Bhalerao et al., 2003; Andersson et al., 2004; Sterky et al., 2004). Related to N nutrition, one of these traits is the mobilization and storage in perennial tissues of the N present in leaves during autumn, which is remobilized at the beginning of the next growing season (Suarez et al., 2002). Thus, transport mechanisms for nitrogenous compounds are likely to be different from those used by annual species, and probably rely on perennial-specific transport functions.

Taking advantage of the shotgun sequenced Populus trichocarpa (Nisqually 1) genome (Tuskan et al., 2006), we present here the expression analysis of AMT members from the perennial tree species poplar and extend the analysis of five AMT members to include the functional characterization of three AMT1 and two AMT2 members by heterologous expression in yeast.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Plant growth and media composition

Populus tremula × alba (clone INRA 717 1B4) cuttings were cultivated as described by Kohler et al. (2003) in a growth chamber for 6 wk with a light intensity of 80 µmol m−2 s−1 and a day–night temperature regime of 16 h at 24°C at 80% relative humidity and 8 h at 18°C at 60% relative humidity. For further experiments (N regime, light regime), P. tremula× alba plants were grown hydroponically for 2 months in the following nutrient solution: 0.75 mm CaCl2·2H2O, 4.7 mm KNO3, 5.15 mm NH4NO3, 0.375 mm MgSO4·7H2O, 0.3 mm KH2PO4, 100 µm H3BO3, 5 µm KI, 100 µm MnSO4 H2O, 30 µm ZnSO4 H2O, 1 µm Na2Mo4·2H2O, 0.1 µm CuSO4·5H2O, 0.1 µm CoCl2, 100 µm FeSO4·7H2O. The pH was adjusted to 5.6–5.8 with KOH. The nutrient solution was renewed every week. When needed, plants were then transferred to a N-free nutrient solution. To maintain K+ at a constant concentration KCl (2.36 mm) and K2SO4 (1.17 mm) were substituted for KNO3.

All experiments were carried out using the P. tremula × alba poplar clone, except when specific tissues were examined. Thus, fruits (harvested 21 April 2004), buds, stamens and female flowers (harvested 29 March 2005) were collected on 25-yr-old trees (Populus trichocarpa species) grown outdoors under natural conditions at the University campus.

Mycorrhizal inoculation

Populus tremula × alba (clone INRA 717 1B4) cuttings were cultivated in a growth chamber for 2 wk as already described and then transferred onto Petri dishes, coinoculated with the ectomycorrhizal fungus Paxillus involutus (Batsch) Fr, in a modified MS solution (Murashige & Skoog, 1962), supplemented with 0.1% glucose and 1.5% agar. Paxillus involutus was pregrown for 10 d on agar medium containing modified Melin-Norkrans medium, as described by Selle et al. (2005). Mycorrhizal and nonmycorrhizal control roots were harvested 1 month after contact.

Cloning of AMTs cDNAs, yeast transformation and [14C]MA uptake

Predicting coding sequences corresponding to AMT1;1, AMT1;2, AMT1;3, AMT1;4, AMT1;5, AMT1;6, AMT2;1, AMT2;2, AMT3;1 and AMT4;5 were amplified by polymerase chain reaction (PCR) from cDNA generated from same tissues used for reverse transcriptase polymerase chain reaction (RT-PCR) studies. The fidelity of PCR amplifications was verified by sequencing. The amplification products were cloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and, after NotI digestion, inserted into the yeast expression vector pFL61 (Minet et al., 1992). The yeast strain 31019b (MATa mep1Δ mep2Δ::LEU2 mep3Δ::KanMX2 ura3; (Marini et al., 1997)) was transformed with pFL61 harboring the cDNA sequences of AMTs. Yeast transformants were selected on N-free minimal medium supplemented with 1 mm glutamine and 3% glucose. Yeast complementation tests were performed as described previously (Javelle et al., 2003). Methylammonium uptake assays were conducted under previously described experimental conditions (Gazzarrini et al., 1999; Montanini et al., 2002).

RT-PCR

Total RNA extraction was performed with the RNeasy Plant Mini kit (Qiagen, Darmstadt, Germany) from approximately 100 mg of frozen tissues of poplar. To remove contaminating genomic DNA, the samples were treated with DNAse I (Qiagen). To obtain cDNA, 1 µg of total RNA was annealed to oligo-dT primers (Promega) and reverse transcribed using Reverse Transcriptase (Qiagen) at 37°C for 1 h. Every reaction was set up in three replicates. For each AMT, the PCR program was as follows: 94°C for 3 min and 37 cycles of 94°C for 30 s, 58°C for 45 s, and 72°C for 1 min 45 s. AMT fragments were gel-purified and sequenced to ensure accuracy and specificity. The whole set of AMT genes (14 genes) was tested by RT-PCR in every experiment carried out but only AMTs detected are retained in figures for greater clarity. A cDNA fragment corresponding to the constitutively expressed ubiquitin gene was amplified simultaneously (28 cycles) and used as a control. Cysteine protease (CP) gene was amplified (35 cycles) and used as control of the senescing state of leaves. The sequences of the gene-specific oligonucleotides designed in the nonconserved 5′ and 3′ regions of the genes were used for RT-PCR and are listed in Table 1.

Table 1.   Primers used for reverse transcriptase polymerase chain reaction analysis
NameSequence
AMT1;1 f AGAGACTCTGACATCCTTCACTCC
AMT1;1 r AATATGAGGTCCCTCTTAGACG
AMT1;2 f ATGGCCTGCTCAGCCTCTGAC
AMT1;2 r GCATCAAACTTGATCACACATTG
AMT1;3 f CTGTGTGACAGTACCCTTCACTTC
AMT1;3 r ACAAAATAGTCCCTCTTACGCA
AMT1;4 f TTTACAATGGCAGCTCTAACTTGC
AMT1;4 r CTAGGGATCCGCCTTTGTCATCATAAA
AMT1;5 f ACCTTTCAATGGCATCATCGCCT
AMT1;5 r TCAGACAACACCTAGCTGCTT
AMT1;6 f ATGGAGGTCTCATGGGAACAAAGT
AMT1;6 r TCATGAATGATTTCGACCTTGG
AMT2;1 f ATGAATGCCTCAACAGCTTATG
AMT2;1 r TTGTTTCTGCATTGCTTAC
AMT2;2 f ATGGATGCCCCCGCATATGAACAA
AMT2;2 r GTATGCAGGCATCTAGCTTA
AMT3;1 f AAAACCATGGCTGCTCTTCCACCCAA
AMT3;1 r CTACAACACTTGAGTTGATGAC
AMT4;1 f ATGAAGCAAGTCCAGCATGA
AMT4;1 r CCCTGTCACATTATCAGTGT
AMT4;2 f AATGAGCAATGATACTGCCTTCCC
AMT4;2 r CTATGTCTTCTCAGCTTGACGA
AMT4;3 f CGGAGGCAAAAAAGCCGTAGTC
AMT4;3 r CATTTTCAAATAAGCACAACC
AMT4;4 f ATGAACAAGGGAGACAATGCAT
AMT4;4 r TCATACCATTTGAACATCACCG
AMT4;5 f CTCCCTATGAATTTCCCACAAGGA
AMT4;5 r TCAGAAGCGTTGTCGGCAGAAGTA
UBQf GCACCTCTGGCAGACTACAA
UBQr TAACAGCCGCTCCAAACAGT
CPf AGTCACTGAGAAAGGCTGTGG
CPr CCAAATGGATTGTTCTTGCTC
ASN2f CAGGCCTGATCTTGGAAGGATT
ASN2rGCAACTGTTGCAGTTTTCTCCAGC

Amino acid extraction and analysis

Amino acids were extracted twice from 10 to 20 mg dried plant tissues with 300 µL 70% (v : v) cold ethanol. The samples were dried using a Reacti-Therm. Heating Module (Pierce, Rockford, IL, USA) and resuspended in 400 µl 0.1 n HCl. Amino acids and standards were then purified on a Dowex 50WX-8 cation ion exchange column (Sigma-Aldrich, St Louis, MO, USA) and aliquots of purified samples were transferred to microvials, dried in a Reacti-Therm Heating Module (Pierce) and derivatized according to Javelle et al. (2003). Gas chromatography and mass spectrometry (GC-MS) analysis was performed as described previously (Javelle et al., 2003).

Soluble sugars extraction and analysis

Soluble sugars were extracted from approx. 100 mg of fresh plant tissues, with 1.1 ml 70% (v : v) cold methanol. The extracts were centrifuged to get supernatant for assay of soluble sugars by the anthrone solution colorimetric method (Miller, 1959). The sugar content was determined by measuring the absorbance at 620 nm. These values were then regressed against readings from a set of standard solutions of glucose.

Phylogenetic analyses

Full-length amino acid sequences were aligned by clustalw and imported into the Molecular Evolutionary Genetics Analysis (mega) package version 3.1 (Kumar et al., 2004). Phylogenetic analyses were conducted using the neighbor-joining (NJ) method implemented in mega, with the pairwise deletion option for handling alignment gaps, and with the Poisson correction model for distance computation. Bootstrap tests were conducted using 1000 replicates. Branch lengths (drawn in the horizontal dimension only) are proportional to phylogenetic distances. The accession numbers or gene models of version 1.1 of the P. trichocarpa genome database used were: PtrAMT1;1 (Poptr1_1 : 804848), PtrAMT1;2 (Poptr1_1 : 665333), PtrAMT1;3 (Poptr1_1 : 565016), PtrAMT1;4 (Poptr1_1 : 799507), PtrAMT1;5 (Poptr1_1 : 645545), PtrAMT1;6 (Poptr1_1 : 804509), PtrAMT2;1 (Poptr1_1 : 802015), PtrAMT2;2 (Poptr1_1 : 808726), PtrAMT3;1 (Poptr1_1 : 175190), PtrAMT4;1 (Poptr1_1 : 754260), PtrAMT4;2 (Poptr1_1 : 260884), PtrAMT4;3 (Poptr1_1 : 205629), PtrAMT4;4 (Poptr1_1 : 806873), PtrAMT4;5 (Poptr1_1 : 424130). Other accession numbers were: AtAMT1;1 (At4g13510), AtAMT1;2 (At1g64780), AtAMT1;3 (At3g24300), AtAMT1;4 (At4g28700), AtAMT1;5 (At3g24290), AtAMT2;1 (At2g38290), LeAMT1;1 (P58905), LeAMT1;2 (O04161), LeAMT1;3 (Q9FVN0), LjAMT1;1 (Q9FSH3), LjAMT1;2 (Q7Y1B9), LjAMT1;3 (Q70KK9), LjAMT2;1 (Q93 × 02), OsAMT1;1 (Os04g43070), OsAMT1;2 (Os02g40710), OsAMT1;3 (Os02g40730), OsAMT2;1 (Os05g39240), OsAMT2;2 (Os01g61550), OsAMT2;3 (Os01g61510), OsAMT3;1 (Os01g65000), OsAMT3;2 (Os02g34580), OsAMT3;3 (Os03g62200), OsAMT4;1 (Os12g01420). BnAMT1;2 (AAG28780), PttAMT1;2 (AJ646889).

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Cloning and in silico analysis of the AMT family

The first whole-genome sequence and assembly for a tree species, namely that of P. trichocarpa was recently reported (Tuskan et al., 2006). The JGI P. trichocarpa gene search mode revealed the existence of 14 AMT gene models. As suggested by a phylogenetic tree based on protein multiple sequence alignment, six sequences from P. trichocarpa genome fell in the subgroup AMT1 and eight in the subgroup AMT2. Populus thus possesses a higher number of AMT genes in both subfamilies than Arabidopsis or rice. Populus AMT2 as well as rice AMT2 members further divided into three clades (Fig. 1).

image

Figure 1. An unrooted, neighbor-joining (NJ)-based tree of the ammonium transporter (AMT) family. The analysis was performed as described in the Material and Methods section. Branch lengths (drawn in the horizontal dimension only) are proportional to phylogenetic distances. Accession numbers are given in the Material and Methods section. Sequence logos of AMT1 and AMT2 subfamilies showed on the right were generated using weblogo (http://weblogo.berkeley.edu/logo.cgi (Crooks et al., 2004)).

Download figure to PowerPoint

Genes encoding proteins from different sub-branches markedly differ in their exon–intron structure: for example, the intron size and location of splicing sites are roughly conserved in genes in each AMT2 subclade, while AMT1 genes contain no intron with the exception of LjAMT1;1 (Salvemini et al., 2001).

Analysis of the assembled genome revealed relatively recent whole-genome duplication shared among all modern taxa in Salicaceae. A second, older duplication appears to be shared with the Arabidopsis lineage (Tuskan et al., 2006). These duplicated genes originated through very recent small-scale gene duplications and one relatively recent large-scale gene duplication event (Sterck et al., 2005). A detailed analysis of duplication events for the AMT members revealed that AMT1;1 and AMT1;4 derived from a common ancestor through an ancient duplication event, and that AMT2;2 and AMT2;1 derived from a common ancestor through a recent duplication event. Interestingly, AMT2;1 and AMT2;2 showed specific expression patterns, with AMT2;1 mostly expressed in leaves and AMT2;2 mostly expressed in petioles (Fig. 2).

image

Figure 2. Tissue-dependent expression of AMTs in poplar. Expression of AMT1;1, AMT1;2 AMT1;5, AMT1;6 AMT2;1 and AMT2;2 was analysed by reverse transcriptase polymerase chain reaction in tissues collected as described in the Material and Methods section. Aliquots of 1 µg total RNAs were reverse-transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as an internal control. Experiments were repeated at least three times, with similar results.

Download figure to PowerPoint

Figure 1 presents tentative signature sequences for the proteins of the AMT1 and AMT2 plant subfamilies, based on the existing AMT signature (Saier, 1998). Logo representation of the AMT signature was constructed at the web interface program weblogo (Crooks et al., 2004) on the basis of the alignment of 39 plant AMT members. These sequences may serve as identification motifs specific for the two subfamilies, and when scanned against the GenBank database, retrieved only members of each subfamily. These sequences can be used to identify additional members of the two subfamilies in other plant species as they are being sequenced.

Analyses carried out with the transmembrane (TM) prediction program THMM (http://www.CBS.dk) suggest that the poplar AMT family proteins are likely to have 9–11 TM domains as do the other AMT plant members (Schwacke et al., 2003). In silico analysis accompanied by experiments using fusion proteins, indicate that the majority of the Mep/Amt proteins contain 11 membrane-spanning helices, with the N-terminus on the exterior face of the membrane and the C-terminus on the interior (Marini & Andre, 2000; Thomas et al., 2000).

Table 2 shows that the AMT gene and AMT protein sequences share a high degree of identity between Populus species, with nucleotide and protein identities of at least 97.7% and 96.9%, respectively. This facilitates in silico and RT-PCR analyses and comparisons across Populus species.

Table 2.  Identity between ammonium transporter (AMT) sequences cloned from Populus tremula × alba and sequences retrieved from the Populus trichocarpa database (http://genome.jgi-psf.org/Poptr1/Poptr1.home.html)
Gene name% Identity (DNA sequence)% Identity (protein sequence)
AMT1;1 99.699.2
AMT1;2 97.796.9
AMT1;3 99.999.6
AMT1;4 99.198.4
AMT1;5 99.399.2
AMT1;6 99.999.8
AMT2;1 99.999.8
AMT2;2 99.499.2
AMT3;1 99.499.4

It is also worth noting that most AMT genes are sporadically distributed across the poplar genome, except AMT1;4, AMT1;5 and AMT4;1 which are located on linkage group (LG) II. The AMT1;4 locus stretches from position 23601578 to 23603065 while the AMT1;5 locus extends from position 23599283–23600819 on poplar LG II, thus appearing as tandem repeats (see Supplementary Material, Fig. S1).

All transcript levels were measured in all experiments described later. Expression levels for AMT1;3, AMT1;4, AMT4;1, AMT4;2, AMT4;3, and AMT4;4 were undetectable in any organs examined so far in poplar tissues. By contrast, the other AMT genes showed contrasting expression patterns as examined in the following text.

Effects of various N regimes

In order to investigate the impact of N regime on the regulation of AMT transcript levels, total RNAs and amino acids were extracted from roots and leaves of plants transferred in a N-free medium for various lengths of times, and further resupplied with N for 8 h. The concentration of total amino acids, measured by GC-MS, in roots and leaves decreased by five- and three-fold, respectively, during 9 d of N starvation (Fig. 3a). In N-fed poplar (grown for 2 months in N-supplied medium), asparagine was the predominant amino acid, accounting for 62% and 33% in roots and leaves, respectively, followed by glutamine in roots (Fig. 3b) and glutamate in leaves (Fig. 3c). The glutamine concentration decreased by 26-fold after 9 d of N-starvation in roots (Fig. 3b), whereas asparagine decreased by 25-fold in leaves (Fig. 3c). The amino acid pools were rapidly reconstituted after 8 h of N resupply in roots, while in leaves the asparagine levels did not completely reached the +N level.

image

Figure 3. Quantification of amino acids by gas chromatography–mass spectrometry in leaves and roots of poplar during nitrogen (N) deprivation and resupply. (a) Total free amino acid contents declined during N starvation in roots and leaves. (b) Asparagine and glutamine were the major amino acids in roots. (c) Asparagine and glutamate were the major amino acids in leaves. Values are expressed as means ± SE of four replicate experiments.

Download figure to PowerPoint

AMT1;2 transcripts strongly increased in roots under a short period of N starvation, but declined after 9 d of N starvation and increased again upon N resupply (Fig. 4a). It is worth noting that expression of AMT1;2 was restricted to roots, whereas AMT1;1 transcripts were detected in shoot and root tissues (Fig. 2). AMT1;1 transcripts were undetectable under N-sufficient condition in roots, increased under N starvation, and remained weakly expressed during nitrogen resupply (Fig. 4a). In leaves, AMT1;1 was weakly expressed and poorly affected by N starvation (Fig. 4b). Similarly, AMT1;5 and AMT2;1 were only weakly expressed under these experimental conditions (data not shown). AMT1;6 transcripts declined under N starvation, compared with a N-sufficient growth condition, but remained low after N resupply (Fig. 4b), which might be linked to the poor increase in asparagine level at that time. All other AMTs were also analysed but were not detected under the conditions used in this experiment.

image

Figure 4. Effect of the nitrogen (N) regime on AMT expression in leaves and roots of poplar. (a) Expression of the AMT1;1 and AMT1;2 transcripts in roots of poplar plants. (b) Expression of the AMT1;1 and AMT1;6 transcripts in leaves of poplar plants. RNA was extracted at different times of N starvation and 500 ng of total RNAs were reverse transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as internal control. Analyses were performed by reverse transcriptase polymerase chain reaction in triplicate and without substantial variation of expression levels.

Download figure to PowerPoint

Effects of light regimes

Figure 5 shows diurnal variations in AMT expression levels in roots and leaves of plants collected at 4-h intervals in poplar. Our data indicate that AMT1;1, AMT1;2, AMT1;6 and AMT2;1 transcript levels exhibit diurnal rhythms, the largest diurnal changes in transcript levels being found for AMT1;2 in root (Fig. 5a) and AMT1;6 in leaf (Fig. 5b). AMT1;1 and AMT1;5 were only weakly expressed in leaves throughout the time course of the experiment (not shown). When light was switched off, the soluble sugar content in roots was at the highest level (98 mg equivalent glucose g−1 FW at 22 : 00 h) and decreased to 69 mg equivalent glucose g−1 FW after 8 h of dark regime. In leaves, the soluble sugar content was, respectively, 445 and 368 mg equivalent glucose g−1 FW at 22 : 00 h and 06 : 00 h. In addition, expression of a leaf asparagine synthetase gene (ASN2) was followed and showed a diurnal variation, similar to AMT1;6 transcript level, although at a lesser extent.

image

Figure 5. Effect of the light–dark cycle on AMT expression in leaves and roots of poplar. (a) Expression of the AMT1;1 and AMT1;2 transcripts in roots of poplar plants. (b) Expression of the AMT2;1, AMT1;6 and ASN2 transcripts in leaves of poplar plants. RNA was extracted from tissues collected at 4-h intervals in poplar during a light–dark period. Aliquots of 500 ng total RNAs were reverse transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as internal control. Analyses were performed by reverse transcriptase polymerase chain reaction in triplicate and without substantial variation of expression levels. ASN: asparagine synthetase gene.

Download figure to PowerPoint

AMT expression during senescence

The expression of the AMTs was studied in young, mature and senescing leaves. The senescing state of the leaves was confirmed by the parallel amplification of a cysteine protease gene (Bhalerao et al., 2003; Andersson et al., 2004), which was detected only at the latter stage (Fig. 6). AMT1;5 and AMT1;6 showed increased expression levels in senescing leaves compared with young leaves. By contrast, AMT3;1 was exclusively expressed in senescing leaves (Fig. 6).

image

Figure 6. Senescence-dependent expression of AMT1;5, AMT1;6 and AMT3;1 in leaves of poplar. Expression of AMT1;5, AMT1;6 and AMT3;1 was analysed by reverse transcriptase polymerase chain reaction in young, mature and senescing leaves. Aliquots of 300 ng total RNAs were reverse transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as an internal control. Cystein protease (CP) was used as a marker of the senescing state (Bhalerao et al., 2003). Experiments were repeated for each member at least three times, with similar results.

Download figure to PowerPoint

AMT expression in reproductive organs

Stamens exhibited a strong expression level for AMT1;5 transcripts, whereas female flowers showed expression for AMT1;6 (Fig. 7a). Amino acid pools in these tissues also reached the highest levels ever measured in poplar tissues, especially in stamens (Fig. 7b). We might therefore conclude that AMT1;5 and AMT1;6 are not under the control of N catabolic repression in these poplar tissues. This also indicates that another as yet unidentified mechanism allowed for full derepression of AMT1;5 and full repression of AMT1;6 in stamens, and the reverse in female flowers.

image

Figure 7. Specific expression of AMTs in reproductive organs of poplar. (a) Expression of AMT1;1, AMT1;5, AMT1;6 and AMT2;1 genes in stamens and female flowers of poplar. Aliquots of 1 µg total RNAs were reverse-transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as internal control. Analyses were performed by reverse transcriptase polymerase chain reaction in triplicate. (b) Quantification of free amino acids by gas chromatography-mass spectrometry in stamens and female flowers of poplar. Glutamine (Gln) was the major amino acid in stamens whereas asparagine (Asn) was the major amino acid in female flowers. Values are expressed as means ± SE of three replicate experiments.

Download figure to PowerPoint

Effects of mycorrhizal inoculation

Figure 8 shows variations in AMT expression levels of roots inoculated with the ectomycorrhizal fungus Paxillus involutus, collected after 1 month of growth after contact. Our data indicate a substantial increase of the root AMT1;2 transcript level, whereas the other root expressed AMTs did not show any significant transcript variation (not shown).

image

Figure 8. Impact of ectomycorrhiza formation on AMT1;2 expression in roots of poplar. Mycorrhizal (Myc) and nonmycorrhizal (NM) roots were collected on Petri dishes grown poplar, in association with Paxillus involutus. Aliquots of 200 ng and 100 ng total RNA from Myc and NM roots (to ensure equal amount of root material), respectively, were reverse transcribed into cDNA. The ubiquitin (Ubq) gene was amplified and used as internal control.

Download figure to PowerPoint

In silico analysis of ESTs

An in silico analysis of poplar expressed sequence tags (ESTs) was carried out using the GenBank EST databases, from which 69 ESTs corresponding to AMTs from poplar could be retrieved. This analysis confirmed the broad distribution of AMT1;1 and AMT2;1 transcripts and the root distribution of AMT1;2 transcripts. The lack of transcript for AMT1;4 and for some AMT4 subclade members is also confirmed. Expressed sequences tags corresponding to AMT1;6 were mostly found in EST database from leaves (Table 3), which agreed with the fact that AMT1;6 was mostly expressed in shoot tissues (Figs 2, 3, 4, 5 and 6).

Table 3.  In silico analyses of ammonium transporter (AMT) genes in poplars (Populus)
Gene nameNumber of occurrences in EST databaseEST tissue localizationRT-PCR product (present work)
  1. EST, expressed sequences tag; RT-PCR, reverse transcriptase polymerase chain reaction.

  2. Number of occurrences and tissue localizations of AMT ESTs retrieved from the EST GenBank database (Altschul et al., 1997). Tissues were as follows: B, bud; Ba, bark; C, cambium; CC, cell culture; F, fruit; FB, floral bud; FC, female catkin; FF, female flower; L, leaf; P, petiole; R, root; S, stem; SL, senescing leaf; St, stamen; X, not determined.

AMT1;1 213C, 11L, 2SL, 2S, 1Ba, 1R, 1XR, L, F, FF, P, B
AMT1;2 1313RR
AMT1;3 55L 
AMT1;4 0  
AMT1;5 0 R, L, St
AMT1;6 1111LL, F, FF, P
AMT2;1 91R, 2CC, 2FC, 1FB, 2SL, 1LL, FF, P
AMT2;2 0 R, P
AMT3;1 74L, 1B, 2BaSL
AMT4;1 0  
AMT4;2 11FB 
AMT4;3 0  
AMT4;4 0  
AMT4;5 22CCR, F

Although detected by RT-PCR, no EST was retrieved for AMT1;5 and AMT2;2, probably because there were no EST databases for the specific tissues, i.e. stamens (AMT1;5). Conversely, ESTs were found for AMT4;2 in floral bud databases, for AMT3;1 in poplar bark database (Ralph et al., 2006) and for AMT4;5 in poplar cultured cells. These are tissues that we have not investigated in the present study but this opens new perspectives for the search of AMT4 subgroup transcripts. For AMT3;1, transcripts of which were detected specifically in senescing leaves (Fig. 6), four ESTs were retrieved from a leaf EST database, although the development state was not provided in the database. AMT1;3 was not detected by RT-PCR, although we found five ESTs in leaf databases. However these studies were of P. euphratica (three ESTs (Brosche et al., 2005)) or systemically wound-induced leaf (two ESTs; Christopher et al., 2004) – specific conditions that were not tested in the present study.

Functional expression of AMTs in a yeast mutant defective in NH4+ uptake

Yeast has provided a genuine heterologous expression system for characterizing many plant nutrient and metabolite transporters. The yeast strain 31019b is defective in the three endogenous NH4+ transporters (mep1, mep2 and mep3) and is unable to grow on medium containing 1 mm NH4+ as the sole N source (Marini et al., 1997). Transformation with the yeast expression vector pFL61 bearing the AMT1;2, AMT1;5, AMT1;6, AMT2;1 or AMT2;2 coding sequences under the control of the constitutive yeast phosphoglycerate kinase gene promoter (Minet et al., 1992), conferred the ability of 31019b to grow at 1 mm NH4+ as the sole N source (Fig. 9). Yeast transformed with empty plasmid (pFL61) was used as a negative control. Thus, all five genes encode functional NH4+ transporters. By contrast, the other three-expressed poplar AMTs (AMT1;1, AMT3;1 and AMT4;5) were unable to complement the Mep deficiency in the yeast strain 31019b. This inability might result from poor targeting to the yeast plasma membrane. Two intron-free AMTs, for which transcripts were not detected (AMT1;3 and AMT1;4), were cloned using their genomic sequence and used to transform the triple Mep mutant, but were unable to complement the growth deficiency on low ammonium (data not shown). Cells expressing AMT1; 5 grew less than the control strain on 10 mm ammonium (Fig. 9), suggesting that AMT1;5 expression was toxic to yeast cells.

image

Figure 9. Complementation of yeast mutant Δmep strain 31019b by poplar ammonium transporters (AMTs). Yeast strain 31019b was transformed with the yeast expression vector pFL61 or pFL61 harboring the coding sequences of AMT1;2, AMT1;5, AMT1;6, AMT2;1, or AMT2;2. Growth was assayed on minimal medium containing 1 mm or 10 mm NH4+ as sole nitrogen source. Pictures were taken after 2 d of growth at 30°C.

Download figure to PowerPoint

We further tested the sensitivity of yeast cells to increasing methylammonium concentrations (Fig. 10). Cells expressing AMT2;1, or AMT2;2 retained the ability to grow on methylammonium, therefore indicating that methylammonium was not taken up by these cells. As found for other AMT2 family members (Sohlenkamp et al., 2002), it seems that poplar AMT2;1, or AMT2;2 have a particularly low affinity for methylammonium, whereas AMT1 family members can readily take up methylammonium.

image

Figure 10. Sensitivity of yeast cells to toxic concentrations of methylammonium. Yeast strain 31019b was transformed with the yeast expression vector pFL61 or pFL61 harboring the coding sequences of AMT1;2, AMT1;5, AMT1;6, AMT2;1, or AMT2;2. Growth was assayed on minimal medium containing 0.1% proline supplemented with 0–100 mm methylammonium. Pictures were taken after 3 d of growth at 30°C.

Download figure to PowerPoint

Kinetics studies of AMT1;2 and AMT1;6 transporters expressed in yeast

To determine differences in substrate affinities between the AMT proteins, we used 14C-labeled methylammonium as a substrate analog and measured short-term uptake in transformed yeast Δmep strain 31019b. Only members of the AMT1 subfamily showed methylamine uptake capacities (Sohlenkamp et al., 2002). Among the AMT1 members, expression of AMT1;2 and AMT1;6 conferred the ability to take up 14C-labeled methylammonium in the range of 0.03–3 mm whereas 31019b transformed with the vector alone (Fig. 11a) did not take up significant amounts of 14C-labeled methylammonium in the same concentration range. Kinetic parameters were calculated from Lineweaver–Burk plots. AMT1;2 displayed a higher affinity (Km = 45 µm) and a lower capacity (Vm = 0.349 ± 0.007 nmol min−1 108 cell−1) for methylammonium than AMT1; 6 (Km = 85 µm; Vm = 1.058 ± 0.024 nmol min−1 108 cell−1). Since the affinities for methylammonium do not necessarily reflect the affinity for ammonium, we performed inhibition studies with varying NH4+ concentrations. The Ki values were deduced from Dixon plots, and a 50% inhibition was observed at 11 and 16 µm for AMT1;2 and AMT1;6, respectively (Fig. 11b). Inhibition studies indicated that these two NH4+ transporters possess a much higher affinity for NH4+ than for methylammonium.

image

Figure 11. Kinetic analysis of AMT1;2 and AMT1;6 in transformed yeast. (a) Concentration dependent kinetics of 14C-methylammonium uptake by the yeast strain 31019b (Marini et al., 1997) transformed with pFL61 alone or pFL61 harboring AMT1;2 and AMT1;6. (b) Influence of increasing NH4+ concentrations on 14C-methylammonium uptake rates. The 14C-methylammonium uptake was measured at the corresponding Km of each AMT. Values are expressed as means ± SD of three replicate experiments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

An extended AMT family in the poplar genome

Analysis of genomes of Arabidopsis and rice revealed the presence of six and 10 AMT genes, respectively. In the poplar genome, 14 AMT genes were identified, and assigned to the AMT1 subfamily (six genes) or to the AMT2 subfamily (eight genes). Interestingly, poplar possesses a much greater number of AMT2 genes than Arabidopsis and a greater number of AMT1 genes than rice. Although a few poplar AMT transcripts were not detectable in any tissue tested in this work, the expression patterns of the expressed members strongly suggest specific features related to the peculiar physiology of a perennial and mycorrhizal tree. Trees differ fundamentally from annual plant species in that they are adapted to survive on a long time-scale. The most obvious manifestation of this is the development of wood, or secondary xylem, from the vascular cambium. This secondary meristem is essential for tree growth and development and in providing support for a tall structure. Taken with caution, a comparison of the number of AMT genes in different species might suggest that plant species from different environments or with different life style organize ammonium transport with a fairly unequal number of ammonium transporters.

The root specific AMT1;2 is highly regulated by N availability and mycorrhization

AMT1;2 was specifically and highly expressed in roots (Figs 4 and 5). Determination of affinity constants for 14C methylammonium uptake by AMT1;2 in yeast and transport inhibition by NH4+ revealed that this protein is a high-affinity ammonium transporter (Km NH4+ = 11 µm), indicating that it might be partly responsible for the HATS ammonium uptake component measured in Populus species (Min et al., 2000). The downregulation of AMT transcript in N-fed P. tremula × alba root is consistent with the downregulation of HATS ammonium influx measured in P. tremuloides (Min et al., 2000). Indeed, AMT1;2 transcript levels in poplar (Fig. 4a) negatively correlated with root glutamine concentrations (Fig. 3b), as already demonstrated for AtAMT1;1 (Rawat et al., 1999) and LeAMT1;1 (von Wiren et al., 2000b). AMT1;2 seems to represent the functional ortholog of AtAMT1;1 and LeAMT1;1. However, prolonged incubation in a N-deficient growth medium resulted in a decrease of the AMT1;2 transcript level, probably owing to the appearance of proteolysis-derived ammonia. In addition, AMT1;2 was overexpressed in P. involutus mycorrhizal roots. Indeed, expression of its closest ortholog PttAMT1;2 from Populus tremula × tremuloides was increased fourfold in the ectomycorrhizal symbiosis between P. tremula× tremuloides and Amanita muscaria, suggesting an increased ammonium uptake capacity of mycorrhizal poplar roots (Selle et al., 2005). Recent studies on the arbuscular mycorrhizal fungus Glomus intraradices demonstrated that ammonium is exported by intraradical hyphae in arbuscular mycorrhizal symbiosis (Govindarajulu et al., 2005), suggesting that ammonium could be a major source of fungus-derived N in mycorrhizal symbiosis (Chalot et al., 2006).

In roots, four other AMT genes, AMT1;1 (Fig. 4), AMT1;5 (Table 3), AMT2;2 (Fig. 2) and AMT4;5 (Table 3) were expressed, reflecting a potential role in covering the N demand through uptake of soil NH4+ in various N regime. Although the kinetic parameters were not determined for this subset of genes, we might hypothesize that some of them could be involved in the LATS component of ammonium influx (Min et al., 2000), or in the retrieval of leaked ammonium (von Wiren et al., 2000a). However, they were also expressed in other poplar tissues such as petiole (AMT1;1 and AMT2;2) or stamen (AMT1;5) and therefore a specific function in root uptake can be ruled out.

The shoot-specific AMT1;6 and AMT3;1 are strongly upregulated during senescence

Several lines of evidence indicate that transport of NH4+, and hence leaf-expressed AMTs, might be of particular importance for N nutrition and metabolism in leaves. First, NH4+ can be imported from the atmosphere into leaf cells through stomata (Husted & Schjoerring, 1996). Second, significant concentrations of NH4+ have been measured in the xylem (Rawat et al., 1999), indicating that a considerable amount of N is translocated to shoots in this form. Third, the photorespiratory N cycle generates a large amount of NH4+ in leaf mitochondria that is subsequently transported to chloroplasts for reassimilation by GS, implying that the expression of AMT genes can be important to ensure the recycling of NH4+ during photorespiration (D’Apuzzo et al., 2004). Finally, the AMTs might also be recruited during the senescing process.

Expression of AMT1;6, AMT2;1 and AMT3;1 was exclusively detected in shoot tissues (Table 3). AMT1;6 is the closest ortholog of LeAMT1;3 in tomato (von Wiren et al., 2000b) and both genes form a distant clade in the AMT1 subfamily (Fig. 1). AMT1;6 complemented the triple ΔMep yeast strain (Fig. 9) and had a high affinity constant (Km NH4+ = 16 µm) comparable to that of AMT1;2 (Fig. 11b). It was suggested that LeAMT1;3 might be linked to the synthesis of asparagine as a N storage form in darkness or to the deamination of glutamate by glutamate dehydrogenase (von Wiren et al., 2000b). Consistent with this observation, AMT1;6 transcripts declined under N starvation in poplar (Fig. 4b), which was characterized by a decrease of the asparagine pool (Fig. 3c). In Arabidopsis, asparagine synthetase is encoded by a small gene family (ASN1, ASN2 and ASN3) and it has been shown that ASN2 expression correlates with ammonium metabolism (Wong et al., 2004). Indeed, the light induction of ASN2 is ammonium dependent and ASN2 transcripts decreased after transfer to ammonium-free growth medium. It has been suggested that the physiological role of ASN2 may be related, directly or indirectly to the recapture of lost N resources under stress conditions. However, the hypothesis that LeAMT1;3 is involved in the transport of photorespiratory NH4+ was not supported. AMT1;6 expression was strongly affected by the diurnal cycle (Fig. 5b) and correlated well with the sugar content. This is in good agreement with a recent report, which indicated that sugars make a major contribution to the diurnal changes of gene expression, while light, N metabolites and water deficit may make smaller contributions (Blasing et al., 2005).

Expression of AMT1;5, AMT1;6 and AMT3;1 increased with the state of maturation of leaves and highly correlated with the expression of the marker gene, cysteine protease whose implication in senescence has been revealed (Bhalerao et al., 2003) (Fig. 6). However, in contrast to AMT1;5 and AMT1;6, AMT3;1 expression was only detected in senescing leaves. Ammonium release during senescence has been documented (Mattsson & Schjoerring, 2003) and the specific expression of the glutamine synthetase gene NtGLN 1;3 was observed in senescing leaves of Nicotiana tabacum (Brugiere et al. 2000). In addition to the putative function of AMT2 members during leaf senescence (Howitt & Udvardi, 2000; von Wiren et al., 2000a; van der Graaff et al., 2006), our data suggest that AMT1 members might also be recruited to ensure ammonium assimilation during the process of leaf senescence.

It is also worth noting the contrasting expression patterns of AMT1;5 and AMT1;6: both were fully expressed in senescing leaves (Fig. 6), but the expression of AMT1;5 in flowers was specific to stamens and that of AMT1;6 specific to female flowers (Fig. 7a). The higher expression of AMT1;5 in stamens (Fig. 7) is in good agreement with data on its closest ortholog AtAMT1;4. Indeed, to complement the poplar data, we extracted genevestigator (Zimmermann et al., 2004) (http://www.genevestigator.ethz.ch) data for the Arabidopsis AMT gene family, which indicated that AtAMT1;4 was solely expressed in male flower but not in female flower parts. AMT1;5 and AMT1;6, might have important and specific roles in reproductive organ development in the dioecious plant, poplar. Further functional analysis is required to establish the precise role of AMTs and their correlation to plant reproduction mechanisms.

The two AMT genes AMT2;1 and AMT2;2 have been partly subfunctionalized during poplar evolution

AMT2;1 and AMT2;2 restored growth of the triple Mep mutant (Fig. 9) but were unable to take up methylamine, as demonstrated for other AMT2 members (Simon-Rosin et al., 2003). The single members of the AMT2 subfamily in Arabidopsis and L. japonicus, as well as the closest ortholog in rice (OsAMT2;1) were expressed in all organs (Sohlenkamp et al., 2002; Simon-Rosin et al., 2003; Suenaga et al., 2003). AtAMT2 was suggested to play a significant role in transferring ammonium between the apoplast and symplast of cells throughout the plant. Although expression of AtAMT2 in shoots responded little to changes in root N status, transcript levels in leaves declined under high CO2 conditions (Sohlenkamp et al., 2002). The LjAMT2;1 gene was found to be constitutively expressed throughout Lotus plants particularly in all major tissues of nodules. LjAMT2;1 would be implicated in the recovery of ammonium lost from nodule cells by efflux. A similar role may be fulfilled in other organs, especially leaves, which liberate ammonium during normal metabolism (Simon-Rosin et al., 2003). Unlike other plant species, this set of AMT genes in poplar displayed specific expression pattern, AMT2;2 being mostly expressed in petiole and AMT2;1 being highly expressed in leaves (Fig. 2). AMT2;2 and AMT2;1 arose from a recent duplication event (Sterck et al., 2005; Tuskan et al., 2006), which, in addition, resulted in a functional specialization (this work). The release of duplicate copies from constraints enables the evolution of new functions (neofunctionalization) or the loss of function (formation of a pseudogene), as observed for MADS-box genes (Irish & Litt, 2005). Alternatively, duplicated gene copies can potentially diverge in their roles, retaining different subfunctions of the original gene. The distribution and tissue localization of this subset of AMT2 genes in various plant species (AtAMT2;1, LjAMT2;1, OsAMT2;1, AMT2;1 and AMT2;2) suggest that the two poplar genes have been partly subfunctionalized during poplar evolution.

The high expression of AMT1;1 and AMT2;2 in petiole tissues is intriguing (Fig. 2). Much controversy exists about whether or not NH4+ is translocated in the xylem from roots to shoots. It was demonstrated that NH4+ might indeed constitute a significant part of the N translocated from the roots to the shoot in the xylem. A fundamental requirement for ammonium translocation is the presence of transport systems capable of loading NH4+ into the xylem and of subsequently moving NH4+ from the leaf apoplast solution into the leaf cells (Schjoerring et al., 2002). Furthermore, significant NH4+ contents were measured in the phloem sap of ammonium-fed tobacco plants, which was correlated with a higher glutamate dehydrogenase activity and polypeptide content in stems (Terce-Laforgue et al., 2004). Considering the frequency of plasmodesmata along the palisade cell/bundle sheath cell/companion cell and paraveinal mesophyll cell/bundle sheath cell/companion cell routes, Russin & Evert (1985) concluded that Populus deltoides would rather behave as a symplastic loader, suggesting that N compounds may also use the symplastic route for loading. In that case, active transport would not be required during these transfer steps. The compartmentalization of the ammonia assimilatory pathway in the vascular tissue, especially in perennial plants (Paczek et al., 2002), to better control carbon and N allocation at particular stages of plant development and/or under certain physiological conditions, needs to be better assessed.

Conclusion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

The analysis of the AMT expression patterns in different organs of poplar show that expression of a given transporter can be very specific or can overlap with other genes, thus covering most tissues tested so far in poplar. The cell specificity of the individual members still remains to be demonstrated. The present data could show that multiple AMT genes with different spatial expression and transcriptional regulation allow the plant to respond differentially to varying nutritional conditions in the environment. Specific features of the perennial lifestyle plant, such as a high potential for ammonium remobilization during senescence or upon ectomycorrhization, together with subfunctionalization of AMT members, have been highlighted. The elucidation of the AMT gene family may present a comprehensive foundation for future studies on the ammonium nutrition of perennial plants.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

B.M. was supported by a postdoctoral fellowship and J.C. by a PhD fellowship from the ‘Ministère déléguéà l’Enseignement supérieur et à la Recherche’. We thank Prof. Simone Ottonello (University Parma, Italy) for providing facilities for yeast uptake experiments and Dr Pascal Frey and Veronica Pereda (INRA Nancy) for providing leaf material. Financial support from the IFR 110 (Génomiques, Ecophysiologie et Ecologie fonctionnelle) is gratefully acknowledged.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information
  • Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST – a new generation of protein database search programs. Nucleic Acids Research 25: 33893402.
  • Andersson A, Keskitalo J, Sjodin A, et al. 2004. A transcriptional timetable of autumn senescence. Genome Biology 5: R24.
  • Becker D, Stanke R, Fendrik I, Frommer WB, Vanderleyden J, Kaiser WM, Hedrich R. 2002. Expression of the NH4+-transporter gene LeAMT1; 2 is induced in tomato roots upon association with N2-fixing bacteria. Planta 215: 424429.
  • Bhalerao R, Keskitalo J, Sterky F, Erlandsson R, Bjorkbacka H, Birve SJ, Karlsson J, Gardestrom P, Gustafsson P, Lundeberg J, Jansson S. 2003. Gene expression in autumn leaves. Plant Physiology 131: 430442.
  • Blasing OE, Gibon Y, Gunther M, Hohne M, Morcuende R, Osuna D, Thimm O, Usadel B, Scheible WR, Stitt M. 2005. Sugars and circadian regulation make major contributions to the global regulation of diurnal gene expression in Arabidopsis. Plant Cell 17: 32573281.
  • Brosche M, Vinocur B, Alatalo ER, Lamminmaki A, Teichmann T, Ottow EA, Djilianov D, Afif D, Bogeat-Triboulot MB, Altman A, Polle A, Dreyer E, Rudd S, Paulin L, Auvinen P, Kangasjarvi J. 2005. Gene expression and metabolite profiling of Populus euphratica growing in the Negev desert. Genome Biology 6: R101.
  • Brugiere N, Dubois F, Masclaux C, Sangwan RS, Hirel B. 2000. Immunolocalization of glutamine synthetase in senescing tobacco (Nicotiana tabacum L.) leaves suggests that ammonia assimilation is progressively shifted to the mesophyll cytosol. Planta 211: 519527.
  • Chalot M, Blaudez D, Brun A. 2006. Ammonia: a candidate for nitrogen transfer at the mycorrhizal interface. Trends in Plant Sciences 11: 263266.
  • Christopher ME, Miranda M, Major IT, Constabel CP. 2004. Gene expression profiling of systemically wound-induced defenses in hybrid poplar. Planta 219: 936947.
  • Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo: a sequence logo generator. Genome Research 14: 11881190.
  • D’Apuzzo E, Rogato A, Simon-Rosin U, El Alaoui H, Barbulova A, Betti M, Dimou M, Katinakis P, Marquez A, Marini AM, Udvardi MK, Chiurazzi M. 2004. Characterization of three functional high-affinity ammonium transporters in Lotus japonicus with differential transcriptional regulation and spatial expression. Plant Physiology 134: 17631774.
  • Gazzarrini S, Lejay L, Gojon A, Ninnemann O, Frommer WB, von Wiren N. 1999. Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 11: 937948.
  • Govindarajulu M, Pfeffer PE, Jin H, Abubaker J, Douds DD, Allen JW, Bucking H, Lammers PJ, Shachar-Hill Y. 2005. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature 435: 819823.
  • van der Graaff E, Schwacke R, Schneider A, Desimone M, Flugge U-I, Kunze R. 2006. Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiology 141: 776792.
  • Howitt SM, Udvardi MK. 2000. Structure, function and regulation of ammonium transporters in plants. Biochimica Biophysica Acta 1465: 152170.
  • Husted S, Schjoerring JK. 1996. Ammonia flux between oilseed rape plants and the atmosphere in response to changes in leaf temperature, light intensity, and air humidity (interactions with leaf conductance and apoplastic NH4+ and H+ concentrations). Plant Physiology 112: 6774.
  • Irish VF, Litt A. 2005. Flower development and evolution: gene duplication, diversification and redeployment. Current Opinion in Genetic Development 15: 454460.
  • Javelle A, Morel M, Rodriguez-Pastrana BR, Botton B, Andre B, Marini AM, Brun A, Chalot M. 2003. Molecular characterization, function and regulation of ammonium transporters (Amt) and ammonium-metabolizing enzymes (GS, NADP-GDH) in the ectomycorrhizal fungus Hebeloma cylindrosporum. Molecular Microbiology 47: 411430.
  • Kaiser BN, Rawat SR, Siddiqi MY, Masle J, Glass AD. 2002. Functional analysis of an Arabidopsis T-DNA ‘knockout’ of the high-affinity NH4+ transporter AtAMT1;1. Plant Physiology 130: 12631275.
  • Kohler A, Delaruelle C, Martin D, Encelot N, Martin F. 2003. The poplar root transcriptome: analysis of 7000 expressed sequence tags. FEBS Letters 542: 3741.
  • Kumar S, Tamura K, Nei M. 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinformatics 5: 150163.
  • Lauter FR, Ninnemann O, Bucher M, Riesmeier JW, Frommer WB. 1996. Preferential expression of an ammonium transporter and of two putative nitrate transporters in root hairs of tomato. Proceedings of the National Academy of Sciences, USA 93: 81398144.
  • Loque D, von Wiren N. 2004. Regulatory levels for the transport of ammonium in plant roots. Journal of Experimental Botany 55: 12931305.
  • Ludewig U, von Wiren N, Frommer WB. 2002. Uniport of NH4+ by the root hair plasma membrane ammonium transporter LeAMT1; 1. Journal of Biological Chemistry 277: 1354813555.
  • Marini AM, Andre B. 2000. In vivo N-glycosylation of the mep2 high-affinity ammonium transporter of Saccharomyces cerevisiae reveals an extracytosolic N-terminus. Molecular Microbiology 38: 552564.
  • Marini AM, Vissers S, Urrestarazu A, Andre B. 1994. Cloning and expression of the MEP1 gene encoding an ammonium transporter in Saccharomyces cerevisiae. EMBO Journal 13: 34563463.
  • Marini AM, Soussi-Boudekou S, Vissers S, Andre B. 1997. A family of ammonium transporters in Saccharomyces cerevisiae. Molecular Cellular Biology 17: 42824293.
  • Mattsson M, Schjoerring JK. 2003. Senescence-induced changes in apoplastic and bulk tissue ammonia concentrations of ryegrass leaves. New Phytologist 160: 489499.
  • Miller GL. 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical Chemistry 31: 426428.
  • Min X, Siddiqi MY, Guy RD, Glass ADM, Kronzucker HJ. 2000. A comparative kinetic analysis of nitrate and ammonium influx in two early-successional tree species of temperate and boreal forest ecosystems. Plant, Cell & Environment 23: 321328.
  • Minet M, Dufour ME, Lacroute F. 1992. Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant Journal 2: 417422.
  • Montanini B, Moretto N, Soragni E, Percudani R, Ottonello S. 2002. A high-affinity ammonium transporter from the mycorrhizal ascomycete Tuber borchii. Fungal Genetics and Biology 36: 2234.
  • Murashige T, Skoog F. 1962. A revised medium for the growth and bioassay with tobacco tissue culture. Physiologia Plantarum 15: 473497.
  • Ninnemann O, Jauniaux JC, Frommer WB. 1994. Identification of a high affinity NH4+ transporter from plants. EMBO Journal 13: 34643471.
  • Paczek V, Dubois F, Sangwan R, Morot-Gaudry JF, Roubelakis-Angelakis KA, Hirel B. 2002. Cellular and subcellular localisation of glutamine synthetase and glutamate dehydrogenase in grapes gives new insights on the regulation of carbon and nitrogen metabolism. Planta 216: 245254.
  • Pearson JN, Finnemann J, Schjoerring JK. 2002. Regulation of the high-affinity ammonium transporter (BnAMT1; 2) in the leaves of Brassica napus by nitrogen status. Plant Molecular Biology 49: 483490.
  • Ralph S, Oddy C, Cooper D, et al. 2006. Genomics of hybrid poplar (Populus trichocarpa×deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences in poplar. Molecular Ecology 15: 12751297.
  • Rawat SR, Silim SN, Kronzucker HJ, Siddiqi MY, Glass AD. 1999. AtAMT1 gene expression and NH4+ uptake in roots of Arabidopsis thaliana: evidence for regulation by root glutamine levels. Plant Journal 19: 143152.
  • Russin WA, Evert RF. 1985. Studies on the leaf of Populus deltoides (Salicaceae): ultrastructure, plasmodesmatal frequency, and solute concentrations. American Journal of Botany 72: 12561273.
  • Saier MH Jr. 1998. Molecular phylogeny as a basis for the classification of transport proteins from bacteria, archaea and eukarya. Advances in Microbial Physiology 40: 81136.
  • Salvemini F, Marini A, Riccio A, Patriarca EJ, Chiurazzi M. 2001. Functional characterization of an ammonium transporter gene from Lotus japonicus. Gene 270: 237243.
  • Schjoerring JK, Husted S, Mack G, Mattsson M. 2002. The regulation of ammonium translocation in plants. Journal of Experimental Botany 53: 883890.
  • Schwacke R, Schneider A, van der Graaff E, Fischer K, Catoni E, Desimone M, Frommer WB, Flugge UI, Kunze R. 2003. ARAMEMNON, a novel database for Arabidopsis integral membrane proteins. Plant Physiology 131: 1626.
  • Selle A, Willmann M, Grunze N, Gessler A, Weiss M, Nehls U. 2005. The high-affinity poplar ammonium importer PttAMT1.2 and its role in ectomycorrhizal symbiosis. New Phytologist 168: 697706.
  • Shelden MC, Dong B, De Bruxelles GL, Trevaskis B, Whelan J, Ryan PR, Howitt SM, Udvardi MK. 2001. Arabidopsis ammonium transporters, AtAMT1;1 and AtAMT1;2, have different biochemical properties and functional roles. Plant and Soil 231: 151–160.
  • Simon-Rosin U, Wood C, Udvardi MK. 2003. Molecular and cellular characterisation of LjAMT2; 1, an ammonium transporter from the model legume Lotus japonicus. Plant Molecular Biology 51: 99108.
  • Sohlenkamp C, Wood CC, Roeb GW, Udvardi MK. 2002. Characterization of Arabidopsis AtAMT2, a high-affinity ammonium transporter of the plasma membrane. Plant Physiology 130: 17881796.
  • Sonoda Y, Ikeda A, Saiki S, von Wiren N, Yamaya T, Yamaguchi J. 2003. Distinct expression and function of three ammonium transporter genes (OsAMT1; 1–1; 3) in rice. Plant and Cell Physiology 44: 726734.
  • Sterck L, Rombauts S, Jansson S, Sterky F, Rouze P, van de Peer Y. 2005. EST data suggest that poplar is an ancient polyploid. New Phytologist 167: 165170.
  • Sterky F, Bhalerao RR, Unneberg P, Segerman B, Nilsson P, Brunner AM, Charbonnel-Campaa L, Lindvall JJ, Tandre K, Strauss SH, Sundberg B, Gustafsson P, Uhlen M, Bhalerao RP, Nilsson O, Sandberg G, Karlsson J, Lundeberg J, Jansson S. 2004. A Populus EST resource for plant functional genomics. Proceedings of the National Academy of Sciences, USA 101: 1395113956.
  • Suarez MF, Avila C, Gallardo F, Canton FR, Garcia-Gutierrez A, Claros MG, Canovas FM. 2002. Molecular and enzymatic analysis of ammonium assimilation in woody plants. Journal of Experimental Botany 53: 891904.
  • Suenaga A, Moriya K, Sonoda Y, Ikeda A, von Wiren N, Hayakawa T, Yamaguchi J, Yamaya T. 2003. Constitutive expression of a novel-type ammonium transporter OsAMT2 in rice plants. Plant and Cell Physiology 44: 206211.
  • Taira M, Valtersson U, Burkhardt B, Ludwig RA. 2004. Arabidopsis thaliana GLN2-encoded glutamine synthetase is dual targeted to leaf mitochondria and chloroplasts. Plant Cell 16: 20482058.
  • Terce-Laforgue T, Dubois F, Ferrario-Mery S, de Crecenzo MA, Sangwan R, Hirel B. 2004. Glutamate dehydrogenase of tobacco is mainly induced in the cytosol of phloem companion cells when ammonia is provided either externally or released during photorespiration. Plant Physiology 136: 43084317.
  • Thomas GH, Mullins JG, Merrick M. 2000. Membrane topology of the Mep/Amt family of ammonium transporters. Molecular Microbiology 37: 331344.
  • Tuskan GA, Difazio S, Jansson S, et al. 2006. The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 15961604.
  • von Wiren N, Gazzarrini S, Gojon A, Frommer WB. 2000a. The molecular physiology of ammonium uptake and retrieval. Current Opinion in Plant Biology 3: 254261.
  • von Wiren N, Lauter FR, Ninnemann O, Gillissen B, Walch-Liu P, Engels C, Jost W, Frommer WB. 2000b. Differential regulation of three functional ammonium transporter genes by nitrogen in root hairs and by light in leaves of tomato. Plant Journal 21: 167175.
  • Wong HK, Chan HK, Coruzzi GM, Lam HM. 2004. Correlation of ASN2 gene expression with ammonium metabolism in Arabidopsis. Plant Physiology 134: 332338.
  • Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. 2004. GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136: 26212632.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. References
  10. Supporting Information

Fig. S1 Linkage map positions of ammonium transporter (AMT) poplar genes.

Table S1 Ratios (ammonium transporter (AMT) expression/ubiquitin (UBQ) expression) were calculated for each gene

FilenameFormatSizeDescription
NPH_1992_sm_FigS1.pdf15KSupporting info item
NPH_1992_sm_TableS1.pdf36KSupporting info item