Carbon monoxide alleviates cadmium-induced oxidative damage by modulating glutathione metabolism in the roots of Medicago sativa

Authors

  • Yi Han,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Jing Zhang,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Xiaoyue Chen,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Zhaozhou Gao,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Wei Xuan,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Sheng Xu,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Xiao Ding,

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author
  • Wenbiao Shen

    1. College of Life Sciences, Co. Laboratory of Nanjing Agricultural University and Carl Zeiss Far East, Nanjing Agricultural University, Nanjing 210095, PR China; These authors contributed equally to this work.
    Search for more papers by this author

Author for correspondence: Wenbiao Shen
Tel: +86 258 439 6542
Fax: +86 258 439 6542
Email: wbshenh@njau.edu.cn

Summary

  • • Using pharmacological and biochemical approaches, the role of cadmium (Cd)-induced carbon monoxide (CO) release and the relationship between CO and oxidative stress conferred by Cd exposure in the root tissues of alfalfa (Medicago sativa) plants were investigated.
  • • Cd treatments showed a dose-dependent enhancement in lipid peroxidation. Both 100 and 200 µm CdCl2 treatments caused the increase of CO release, which is consistent with the changes in the activity of the CO synthetic enzyme heme oxygenase (HO) and its HO-1 transcript.
  • • A 100 µm CdCl2 exposure enhanced the formation of nonprotein thiols (NPT), and reduced glutathione (GSH) to oxidized glutathione (GSSG), which was potentiated by the pretreatment of CO scavenger hemoglobin (Hb). Plants pretreated for 6 h with 50% CO-saturated aqueous solution, which induced the rapid endogenous CO release followed by a gradual decrease when subsequently exposed to 100 µm CdCl2 for 72 h, effectively decreased oxidative damage. Meanwhile, CO pretreatment modulated several enzymes responsible for GSH metabolism, thus resulting in the partial restoration of GSH : GSSG ratio, which was significantly blocked by Hb.
  • • These results are suggestive of a role for CO release as a signal element for the alleviation of Cd-induced oxidative damage by modulating glutathione metabolism.

Introduction

Carbon monoxide (CO), a by-product released during the degradation of heme by heme oxygenases (HO EC 1.14.99.3) in animals, holds a prominent place in the history of the contemporary biological sciences (Piantadosi, 2002; Dulak & Józkowicz, 2003). Nowadays, CO is thought to be a biologically active messenger molecule and its bioactive effects are involved in many biological events. It has been proven that a low concentration of CO (250 ppm, 0.025%) plays a major role in mediating the cytoprotection against oxidant-induced lung injury in mice (Otterbein et al., 2003). In plants, in addition to the well known process of CO production in leaves of terrestrial plants in light, there is a significant light-independent source of CO gas among smaller plants associated with the soil–surface and soil–air interface (Lüttge & Fischer, 1980; Siegel & Siegel, 1987). Similar to the processes in animals, HO has been claimed as the potential source of CO in plants (Muramoto et al., 2002). However, CO has only been suggested to be involved in the response to seed germination and dormancy (Dekker & Hargrove, 2002; Liu et al., 2007). The use of CO gas, or the artificial CO donor hematin and hemin, has also shown that CO is involved in adventitious rooting process (Zimmerman et al., 1933; Zimmerman, 1937; Xu et al., 2006). Thus, the experimental evidence for CO as a signal molecule in the plant kingdom in response to multiple environmental stresses is still quite limited.

Cadmium (Cd), a well-known pro-oxidant, is a highly toxic and persistent environmental poison for plants and animals. Free Cd in plasmatic compartments disturbs cell metabolism and regulation. Normally, Cd accumulation often results in visible symptoms of plant injuries, such as growth inhibition, chlorosis, browning of root tips and even cell death (Schützendübel & Polle, 2002; Aravind & Prasad, 2005; Metwally et al., 2005; Ortega-Villasante et al., 2005). A study of the relationship between Cd toxicity and oxidative stress in plants has suggested that Cd toxicity is, at least partially, caused by an enhanced production of reactive oxygen species (ROS). Oxidative stress as a result of Cd accumulation in plants typically leads to the modulation of the expression and activities of antioxidative enzymes, such as ascorbate peroxidase (APX) and glutathione reductase (GR).

It was well known that glutathione (GSH) plays a central role in protecting plants from environmental stresses, including oxidative stress resulting from some heavy metals exposure (May et al., 1998; Xiang & Oliver, 1998). Glutathione is also involved in the detoxification of organic compounds. Many xenobiotics as well as some metabolites, such as anthocyanins, react with GSH via the action of a family of glutathione S-transferases (GST) and supposedly transported as GSH conjugates (GS-X) into the vacuole (Marrs, 1996). Glutathione is synthesized by γ-glutamylcysteine synthetase (γ-ECS) and glutathione synthetase (GS). Glutathione reductase is also essential in reducing oxidized glutathione (GSSG) back to GSH. Interestingly in response to Cd treatment, it was found that the more Cd-sensitive pea genotypes had decreased concentrations of GSH in their roots, whereas the more tolerant genotypes had increased root GSH concentrations (Metwally et al., 2005). By using loss-of-function analysis, Xiang et al. (2001) discovered that Arabidopsis plants with the lowest amounts of reduced GSH (10% of wild type) were sensitive to as little as 5 µm Cd, whereas those with 50% of wild-type amounts required higher Cd concentrations to inhibit growth. Preliminary data also showed that overexpression of tomato γ-ECS in the Cd-sensitive Arabidopsis mutant, cad2, restores Cd tolerance (Kovari et al., 1997).

Interestingly, endogenous CO production and HO induction in animals are stimulated by the different stress responses, including heat shock, oxidants, metals, lipopolysaccharide, hypoxia, hyperoxia and reactive oxygen/nitrogen species (Piantadosi, 2002; Dulak & Józkowicz, 2003). Some work has also recently indicated the involvement of HO-1, an inducible and major HO isozyme, and another by-product, biliverdin (BV), in the antioxidant defense system in soybean leaves subjected to Cd stress (Noriega et al., 2004). This effect is similar to results that have been widely proven in animal tissues (Piantadosi, 2002; Dulak & Józkowicz, 2003). More recently, Yannarelli et al. (2006) discovered that HO in soybean was being dose-dependently up-regulated as a mechanism of cell protection against ultraviolet-B irradiation-induced oxidative damage. This process was also related to the formation of hydrogen peroxide (H2O2). However, the mechanism(s) by which HO provides protection against oxidative stress is currently not understood in plants.

The work in this paper demonstrates for the first time that CO production increased in response to Cd stress at 100 or 200 µm concentrations. The mechanism and physiological significance of endogenous CO production was determined by the exogenous application of CO. Hence, the modulatory role of CO in Cd-induced oxidative damage and associated GSH metabolism in alfalfa seedling root tissues was investigated. A possible signaling role of CO in response to Cd stress is also preliminarily discussed. This work may further increase our understanding of the mechanisms of CO/HO system amelioration of Cd toxicity in plants.

Materials and Methods

Preparation of CO aqueous solution and CO content determination

The preparation of CO aqueous solution and the determination of CO content by gas chromatography-mass spectrometry (GC/MS) were carried out according to the method described in our previous report (Liu et al., 2007). CO aqueous solution was obtained by bubbling CO gas gently through a glass tube into 300 ml of quarter-strength Hoagland's solution in an open bottle for at least 30 min. Then the saturated stock solution (100% of saturation) was immediately diluted with quarter-strength Hoagland's solution to the concentration the experiment required (1, 10 and 50% of saturation).

Chemical

Hemoglobin (Hb), obtained from Shanghai Boao Ltd, Shanghai, China, was used as the scavenger of CO at a concentration of 0.15 g l−1 (Morita et al., 1995; Liu et al., 2007).

Plant materials, growth condition and treatments

Commercially available alfalfa (Medicago sativa L. cv. Zhongmu No. 1) seeds were surface-sterilized with 5% NaClO for 10 min, rinsed extensively in distilled water and germinated for 2 d at 25°C in the darkness. Uniform seedlings were then chosen and transferred to the plastic chambers and cultured in nutrient medium (quarter-strength Hoagland's solution). Alfalfa seedlings were grown in the illuminating incubator at 25 ± 1°C, with a light intensity of 200 µmol m−2 s−1 and 14 h photoperiod. After growing for 5 d, seedlings were incubated in quarter-strength Hoagland's solution containing either CO aqueous solution with varied saturation and/or Hb (0.15 g l−1) for 6 h. After the pretreatments, the plants were grown for a further 72 h, with the roots exposed to 0 (control, CK), 100, 200 or 500 µm CdCl2. The pH for both nutrient medium and treatment solutions was adjusted to 6.0 using NaOH or HCl, and treatment solutions were renewed each day to maintain constant concentrations. After various treatments, the seedlings’ root tissues were sampled, then immediately frozen in liquid nitrogen, and stored at –80°C until further analysis.

Determination of thiobarbituric acid reactive substances (TBARS), ascorbic acid (AsA), NPT, GSH and GSSG contents

Lipid peroxidation was estimated by measuring the amount of TBARS as previously described (Liu et al., 2007). About 500 mg fresh tissue was ground in 0.25% 2-thiobarbituric acid (TBA) in 10% TCA using a mortar and pestle. After heating at 95°C for 30 min, the mixture was quickly cooled in an ice bath and centrifuged at 10 000 g for 10 min. The absorbance of the supernatant was read at 532 nm and corrected for unspecific turbidity by subtracting the absorbance at 600 nm. The blank was 0.25% TBA in 10% TCA. The concentration of lipid peroxides together with oxidatively modified proteins of plants were thus quantified in terms of TBARS amount using an extinction coefficient of 155 mm−1 cm−1 and expressed as nmol g−1 fresh weight.

Ascorbic acid, NPT, GSH and GSSG contents were also measured according to methods previously reported (Law et al., 1983; Smith, 1985; Noctor & Foyer, 1998). Frozen root tissues were homogenized in cold 5% meta-phosphoric acid. The homogenate was centrifuged at 20 000 g for 15 min at 4°C and the supernatant was collected for analyses of ascorbate and glutathione. The ascorbate pool was measured according to Law et al. (1983). Color was developed in reaction mixtures after the addition of the following reagents: 0.6 ml of 10% TCA, 0.6 ml of 44% ortho-phosphoric acid, 0.6 ml 4% a,a′-dipyridyl in 70% ethanol, and 0.3% (w/v) FeCl3. After vortex mixing, the mixture was incubated at 40°C for 40 min and the A525 was read. Total glutathione (GSH plus GSSG) was determined in the homogenates spectrophotometrically at 412 nm, using GR, 5,5′dithio-bis-(2-nitrobenzoic acid) (DTNB), and NADPH. GSSG was determined by the same method in the presence of 2-vinylpyridine, and GSH content was calculated from the difference between total glutathione and GSSG. For determination of NPT, plant tissues (300 mg fresh weight) were homogenized in 0.1 m HCl/1 mm EDTA solution. The homogenate was centrifuged at 12 000 g for 5 min. The supernatant was collected. NPT contents were measured as described by Noctor & Foyer (1998). Supernatant (200 µl) was mixed with 700 µl of assay buffer containing 120 mm sodium phosphate, pH 7.8, and 6 mm EDTA, and the absorption at 412 nm was measured after 2 min following the addition of 100 µl of 6 mm DTNB to a 1 ml sample. The absorption at 412 nm was corrected for the absorption of appropriate controls.

Histochemical analyses

Histochemical detection of lipid peroxidation was performed with Schiff's reagent as described by Pompella et al. (1987). Histochemical detection of loss of plasma membrane integrity in root apexes was performed with Evans blue described by Yamamoto et al. (2001). All the roots stained with Schiff's reagent or Evans blue were washed extensively, then observed under a light microscope (model Stemi 2000-C; Carl Zeiss, Germany) and photographed on color film (Powershot A620, Canon Photo Film, Japan).

Determination of Cd content in plant tissues

Cadmium in root tissues was extracted and measured by graphite furnace atomic absorption spectrophotometry (180–80 Hitachi, Tokyo, Japan) as described by Brune & Dietz (1995).

Enzymatic activities assays

Heme oxygenase, superoxide dismutase (SOD), and guaiacol peroxidase (POD) activities were analysed using the methods described in our previous reports (Huang et al., 2006; Liu et al., 2007). For the HO activity test, the concentration of biliverdin IX was estimated using a molar absorption coefficient at 650 nm of 6.25 mm−1 cm−1 in 0.1 m HEPES-NaOH buffer (pH 7.2). One unit of activity (U) was calculated by taking the quantity of the enzyme to produce 1 nmol BV per 30 min. Total SOD activity was measured on the basis of its ability to reduce nitroblue tetrazolium (NBT) by the superoxide anion generated by the riboflavin system under illustration. One unit of SOD (U) was defined as the amount of crude enzyme extract required to inhibit the reduction rate of NBT by 50%. POD was determined by measuring the oxidation of guaiacol (extinction coefficient 26.6 mm−1 cm−1) at 470 nm.

Lipoxygenase (LOX) activity was measured according to the method described by Zhang et al. (2003). GST activity was assayed following the method described by Aravind & Prasad (2005). Phenylalanine ammonium lyase (PAL) activity was determined based on the rate of cinnamic acid production as described by Ochoa-Alejo & Gómez-Peralta (1993). Ascorbate peroxidase (APX) activity was measured as described by Nakano & Asada (1981). GR activity was determined by following the oxidation of NADPH at 340 nm (extinction coefficient 6.2 mm−1 cm−1) (Jiang & Zhang, 2002). Protein was determined by the method of Bradford (1976), using bovine serum albumin (BSA) as a standard.

Transcript quantification

Root tissue was homogenized with mortar and pestle in liquid nitrogen. Total RNA was isolated using the RNeasy mini kit (Qiagen, Valencia, CA, USA) according to the instructions supplied by the manufacturer. Approximately 4 µg of total RNA was reverse-transcribed using an oligo(dT) primer and SuperScript™ Reverse Transcriptase (Invitrogen, Carlesbad, CA, USA). cDNA was amplified by PCR using the following primers: HO-1 (according to the method described by Baudouin et al. (2004), the AW981017 and AL381336 sequences were assembled to construct the HO-1 cluster sequence), forward TACATACAAAGGACCAGGCTAAAG and reverse GTCCCTCACATTCTGCAACAACTG (amplifying a 476 bp fragment); Cu,Zn-SOD (accession number AF056621), forward ACTTCTCACTCTCTTCTCCGAT and reverse ATGAACCACTAAGGCTCTCCCA (amplifying a 468 bp fragment); POD (accession number X90695), forward TTGTTACTGTTCCTGCTACC and reverse TGAATAAACCTTTTCCTTGT (amplifying a 636 bp fragment); GST (accession number AB040439), forward CAATAAAAGTGCACGGAAGCCC and reverse GCAAATCCACCAAGGTGAAACA (amplifying a 498 bp fragment); PAL (accession number X58180), forward CTTGATGAGGTGAAGCGTAT and reverse TGTTGCTGTTTTTGGTAGTG (amplifying a 348 bp fragment); APX (accession number DQ122791), forward GGAAAATCTTACCCAACCGTGAG and reverse AGTAATCCCAACAGCAACAACCT (amplifying a 321 bp fragment); GR (accession number AM407889), forward GTGCCAATGTCAATCTCGTTT and reverse TGTTTGCTCTACTGCCTCCTC (amplifying a 538 bp fragment); ECS (accession number AM407888), forward TTTGATGACTCCTTCGGGTTT and reverse TTCCTTAGCATTTCTCTTTCT (amplifying a 535 bp fragment); GS (accession number AM411123), forward AATGGAGAGCTAGGCTACT and reverse CAACCCCACCTTCGTCAGA (amplifying a 537 bp fragment); EF-2 (accession number DQ122789), forward AATGGCTGATGAGAACCTGC and reverse TTGTCCTCGAACTCGGAGAG (amplifying a 498 bp fragment). To standardize the results, the relative abundance of EF-2 was also determined and used as the internal standard.

The cycle numbers of the PCR reactions were adjusted for each gene to obtain visible bands in agarose gels. Aliquots of the PCR reactions were loaded on 1.2% agarose gels with the use of ethidium bromide. Specific amplification products of the expected size were observed and their identities were confirmed by sequencing. Ethidium bromide stained gels were scanned and analysed using TotalLab v1.10 software (Nonlinear Dynamics, Newcastle-upon-Tyne, UK). The ratio of HO-1 mRNA to EF-2 was quantified.

Statistical analysis

Values are means ± SE of three different experiments with at least three replicated measurements. Differences among treatments were analysed by one-way anova, taking P < 0.05 as significant according to Duncan's multiple range test.

Results

Effects of Cd exposure on lipid peroxidation, CO releasing, HO activity and gene expression

To assess the oxidative stress produced by the different concentrations of Cd exposure, TBARS formation was determined after treatments for 12 h. As shown in Fig. 1(a), treatment with CdCl2 at 100, 200 and 500 µm external concentration significantly increased TBARS content in a dose-dependent manner. Further, in comparison with the Cd-free sample (CK), exposure of seedlings to the lower concentrations of Cd (100 and 200 µm) for 12 h resulted in the potent induction of CO release (Fig. 1b) and HO activity (Fig. 1d), whereas neither CO release nor HO activity could be detected in seedlings exposed to the higher concentration of Cd (500 µm). Changes in the relative abundance of the HO-1 transcript (Fig. 1c) were found to be similar to those for CO release and HO activity under different Cd stresses, except that under 500 µm stress, HO-1 transcript was still detectable. Meanwhile, severe Cd-toxicity phenomena, including root growth inhibition, were present in the seedlings treated with 500 µm Cd, while the seedlings treated with the lower concentrations of Cd showed no sign of Cd toxicity (data not shown). The toxicity symptoms indicate that the higher dose of Cd had a detrimental effect on the plants, which was consistent with the results shown in Fig. 1.

Figure 1.

Thiobarbituric acid reactive substance (TBARS) concentration (a), CO concentration (b), heme oxygenase-1 (HO-1) transcript level (c) and activity (d) in alfalfa (Medicago sativa) seedling roots under different Cd concentrations (100, 200 and 500 µm CdCl2). Seedlings were incubated in quarter-strength Hoagland's solution for 5 d then transferred to the same solution containing the indicated concentrations of CdCl2 for 12 h. mRNA expression was analysed by semiquantitative RT-PCR. Relative HO-1 transcript expression taking control (CK) as 1 U. Values are means ± SE of three different experiments with at least three replicated measurements. Bars with different letters are significantly different at P < 0.05 according to Duncan's multiple range test. CK, control.

Figure 2(a) shows that CO concentration in alfalfa seedling roots continuously increased during the 12 h treatment period under 100 µm CdCl2 stress (Cd treatment relative to the control (CK treatment)). HO activities and relative HO-1 transcripts had also increased after 3 h, and further at 12 h (Fig. 2b,c), of treatment. The pretreatment with 50% CO-saturated aqueous solution for 6 h in culture solution increased the CO content in the roots, which also mimicked a physiological response elicited by Cd treatment at 12 h. Furthermore, the addition of Cd to the CO-treated plants at the end of the pretreatment period (50% CO→Cd) led to a gradual decrease in CO concentration. After 12 h, the CO content with the 50% CO→Cd treatment was even lower than that with Cd treatment alone. For the 50% CO→Cd treatment, the HO activity and relative level of HO-1 transcript in the seedling roots increased by a similar amount to Cd alone by 3 h but then fell between 3 and 12 h. Pretreatment with 50% CO alone (50% CO) did not change the relative level of HO-1 transcript or HO activity.

Figure 2.

Changes in endogenous concentrations of CO (CK, rhombuses; Cd, closed squares; 50% CO→Cd, triangles; 50% CO, open squares) (a), heme oxygenase activities (open bars, 3 h; closed bars, 12 h) (b), and HO-1 transcripts (c) in alfalfa (Medicago sativa) seedling roots under cadmium (Cd) stress. Seedlings were incubated in quarter-strength Hoagland's solution with or without 50% CO-saturated aqueous solution for pretreatment for 6 h. The roots were then grown for 12 h, either exposed to 100 µm CdCl2 or under Cd-free control conditions (CK). Values are means ± SE of three different experiments with at least three replicated measurements. Within each set of experiments, bars with different letters are significantly different at P < 0.05 according to Duncan's multiple range test.

Pretreatment with 50% CO-saturated aqueous solution alleviates Cd toxicity

Exposure of plants to heavy metal ions often causes growth inhibition. In our experiment, the fresh weight of 10 seedling plants treated with Cd at 100 µm external concentration for 3 d decreased by 36.1% as compared with the control sample (Cd-free, CK). To evaluate the concentration at which CO showed the most significant effect on plant growth, preliminary pretreatments with CO aqueous solution at 1, 10, 50 and 100% saturation were conducted. As shown in Fig. 3(a), the effect of Cd on seedling growth was reduced by treatment with CO aqueous solution in a dose-dependent manner. Among these pretreatments, the addition of 50% CO aqueous solution displayed the greatest effect on the alleviation of Cd-induced inhibition of seedling growth (P < 0.05). The Cd content in plant seedling roots was also measured. Addition of 100 µm Cd to the treatment medium resulted in a rapid uptake of Cd in root parts during the initial 24 h. After that, the rate of Cd accumulation was reduced (Fig. 3b). The uptake of Cd in the CO-pretreatment (50% saturation) roots exhibits a similar pattern but with a lower accumulation rate. For example, at 72 h of treatment, the Cd content in the CO-pretreated root tissues was 23.7% lower than without CO pretreatment.

Figure 3.

(a) Effects of CO-saturated aqueous solution with different saturations on the cadmium (Cd)-induced inhibition of 10 alfalfa (Medicago sativa) seedlings growth for 72 h; (b) pretreatment with 50% CO-saturated aqueous solution alleviates Cd concentration in root tissues of alfalfa plants. Seedlings were pretreated with CO aqueous solution at the indicated saturations for 6 h and then exposed to 100 µm CdCl2 for 72 h. Values are means ± SE of three different experiments with at least five replicated measurements. Different letters indicate significant differences (P < 0.05) according to Duncan's multiple range test. Asterisks indicate that mean values are significantly different between the treatments with 50% CO→Cd (open squares) and Cd alone (closed squares) (P < 0.05).

Pretreatment with 50% CO-saturated aqueous solution counteracts Cd-induced oxidative damage

To further evaluate the Cd toxicity to the roots of alfalfa, the oxidative damage to membranes was examined by measuring the content of TBARS, an indicator of lipid peroxidation and free radical generation. Exposure of alfalfa seedlings to Cd caused an increase in the TBARS content (Fig. 4a) over the 24 h period. Compared with the Cd treatment alone, the addition of CO aqueous solutions at a range of concentrations produced a similar dose-dependent reduction in the amount of TBARS as was found for seedling growth (P < 0.05, Fig. 3a). The optimal reduction was produced at 50% CO in aqueous solution (Fig. 4a). Since the expression of LOX (EC 1.13.11.12) may increase the formation of oxidation products, the effect of CO aqueous solution on the activity of LOX under Cd stress was further investigated. There was a similar change pattern between LOX activity and TBARS formation in the Cd-stressed alfalfa roots (Fig. 4). Similarly, the pretreatment with 50% CO aqueous solution produced lower LOX activity compared with the Cd-stressed sample alone, whereas the combination of Hb and CO pretreatment could block this response. Also, no apparent difference occurred between the pretreatment with 50% CO aqueous solution alone (50% CO) and the control sample (CK).

Figure 4.

Effects of CO-saturated aqueous solution with different saturations and its scavenger hemoglobin (Hb) on the contents of thiobarbituric acid reactive substances (TBARS) (a) and lipoxygenase (LOX) activity (b) in roots of alfalfa (Medicago sativa) plants under 100 µm Cd stress. Seedlings were pretreated with CO aqueous solution at the indicated saturations for 6 h and then exposed to 100 µm CdCl2 for 12 h (open bars) and 24 h (closed bars). Values are means ± SE of three different experiments with at least five replicated measurements. Within each set of experiments, bars with different letters indicate significant differences (P < 0.05) according to Duncan's multiple range test.

Histochemical staining

Alfalfa seedlings were treated with or without 100 µm CdCl2 for 24 h. Assessments of lipid peroxidation and the loss of plasma membrane integrity in roots under different treatments were performed by histochemical staining with Schiff's reagent and Evans blue. Pretreatment with CO alone did not change the staining patterns observed for these reagents in comparison with the control samples. The roots of alfalfa seedlings treated with Cd alone were stained extensively (Fig. 5), whereas those pretreated with 50% CO aqueous solution exhibited only light staining, both of which were consistent with the changes in TBARS formation and LOX activity (Fig. 4). These results further proved that the application of exogenous CO to the culture medium provided protection against Cd-induced oxidative damage in plant roots.

Figure 5.

Effects of 50% CO-saturated aqueous solution pretreatment on the cadmium (Cd)-induced lipid peroxidation (a) and loss of plasma membrane integrity (b) in the root tips of alfalfa (Medicago sativa). Seedlings were incubated in quarter-strength Hoagland's solution with or without 50% CO-saturated aqueous solution for pretreatment for 6 h. The roots were then grown for 24 h, either exposed to 100 µm CdCl2 or under Cd-free control conditions (CK). Afterward, the roots were stained with Schiff's reagent (a) or Evans blue (b), and immediately photographed under a light microscope. Bars, 1 mm.

Changes of SOD, POD and PAL activities and transcripts

Analysis of two antioxidant enzymes revealed that activities of SOD and POD in alfalfa roots decreased after 24 h of Cd exposure, being 42.8 and 31.8% lower than the controls, respectively (Fig. 6a,b). CO pretreatment alone had no effect but when applied with Cd it significantly alleviated the effect of Cd on SOD and POD activities, being 50.5 and 28.9% higher, respectively, than those with the Cd treatment alone (Cd). Pretreatment with CO also led to significant increases in Cu,Zn-SOD and POD (particularly) transcripts compared with samples without CO pretreatment (Fig. 6e). Plants pretreated with only CO aqueous solution did not show any changes in Cu,Zn-SOD and POD transcripts. The above results combined with the changes of TBARS content (Fig. 4a) indicated the efficient antioxidative and reactive oxygen species scavenging activity by CO pretreatment against Cd-induced oxidative stress.

Figure 6.

Effects of pretreatment with 50% CO-saturated aqueous solution on the expression and activities of superoxide dismutase (SOD) (a), guaiacol peroxidase (POD) (b), glutathione S-transferase (GST) (c), and phenylalanine ammonium lyase (PAL) (d) in roots of alfalfa (Medicago sativa) seedlings under Cd stress at 24 h. (e) Transcript quantification tests were carried out after 24 h of treatment. Values are means ± SE of three different experiments with at least five replicated measurements. Bars with different letters indicate significant differences (P < 0.05) according to Duncan's multiple range test.

Cadmium treatment also induced a small increase in the intracellular PAL transcription and its activity in alfalfa seedling roots after 24 h of treatment (Fig. 6d,e). Although CO pretreatment alone did not stimulate the PAL activity and its gene expression by itself, the Cd-induced PAL activity and transcription were further enhanced by CO pretreatment, showing a positive effect of CO pretreatment on the Cd-induced PAL expression.

Changes of glutathione metabolism

Treatment with 100 µm Cd for 24 h induced a decrease in content of AsA and GSH, and an increase of GSSG and TBARS in roots (Table 1). However, the CO plus Cd treatment (50% CO→Cd) reduced or eliminated the effects of Cd treatment alone on AsA, GSH and GSSG content. These results are consistent with the changes of ECS, GS, APX and GR transcripts or activities (Fig. 7). When the CO scavenger Hb and CO were given together before Cd treatment, the changes induced by CO in the content of AsA, GSH, GSSG and TBARS were completely prevented (Table 1). Interestingly, a high ratio of GSH/GSSG, an important parameter for the intracellular redox status, was also found in the 50% CO→Cd treatment compared with the solely Cd-treated sample. Furthermore, the CO scavenger Hb given before Cd significantly decreased GSH content and enhanced GSSG and TBARS when compared with the values obtained when 100 µm Cd alone was used. On the other hand, administration of CO (Table 1) or Hb (data not shown) alone did not affect these parameters.

Table 1.  Ascorbic acid (AsA), nonprotein thiols (NPT), reduced and oxidized glutathione (GSH and GSSG), thiobarbituric acid reactive substance (TBARS) contents and the ratio of GSH/GSSG in 5-d-old alfalfa (Medicago sativa) roots treated with 0 (CK) or 100 µm CdCl2 for 24 h with or without 6 h pretreatment with 50% CO-saturated aqueous solution and/or the CO scavenger hemoglobin (Hb, 0.15 g l−1)
TreatmentAsA
(nmol g−1 FW)
NPT
(nmol g−1 FW)
GSH
(nmol g−1 FW)
GSSG
(nmol g−1 FW)
GSH/GSSGTBARS
(nmol g−1 FW)
  1. Values are means ± SE of three different experiments with at least five replicated measurements. Different letters within columns indicate significant differences (P < 0.05) according to Duncan's multiple range test.

CK98.7 ± 1.3 a393 ± 9 c292 ± 4 a74 ± 3 c3.9469.2 ± 0.4 d
Cd42.0 ± 1.8 c901 ± 12 b146 ± 3 c91 ± 4 b1.60420.7 ± 1.0 b
50% CO→Cd69.0 ± 1.3 b1004 ± 16 a235 ± 8 b78 ± 3 c3.01315.9 ± 0.8 c
50%CO92.2 ± 1.3 a417 ± 2 c294 ± 3 a74 ± 4 c3.9739.4 ± 0.8 d
50%CO + Hb→Cd44.6 ± 1.1 c896 ± 12 b147 ± 5 c93 ± 4 b1.58121.5 + 0.7 b
Hb→Cd39.3 ± 0.9 c891 ± 9 b116 ± 4 d102 ± 2 a1.13724.1 ± 0.5 a
Figure 7.

Effects of pretreatment with 50% CO-saturated aqueous solution on the activities of ascorbate peroxidase (APX) (a) and glutathione reductase (GR) (b) in roots of alfalfa (Medicago sativa) seedlings under cadmium (Cd) stress for 72 h. (c) Gene expression of APX, GR, γ-glutamylcysteine synthetase (ECS), and glutathione synthetase (GS) at 24 h for different treatments. Values are means ± SE of three different experiments with at least five replicated measurements. Asterisks indicate that mean values are significantly different between the treatments of 50% CO→Cd and Cd alone (P < 0.05). CK, triangles; Cd, closed squares; 50% CO→Cd, open squares.

Analysis of the GSH metabolism enzymes provided more insights into the exact mode of action of CO-pretreatment in combating Cd toxicity. GST is regarded as an important cellular detoxifier of metabolites involved in oxidative stress. Cd significantly increased the GST activity (65.4%) (Fig. 6c), and the addition of CO pretreatment with Cd caused a further increase in GST activity (139.1%), indicating an increased detoxification. The changes in GST transcript levels also coincided with that of their activities. Figure 7(a) shows that activities of APX in alfalfa roots increased after Cd exposure for 24, 48 and 72 h, being 15.8, 117.4 and 104.3% higher, respectively, than the activities of the controls (CK). The increased activity rate of APX caused by Cd stress was significantly reduced by the addition of 50% CO pretreatment. Exposure to 100 µm Cd also led to significant decreases in the total activity of GR (Fig. 7b). CO pretreatment (50% CO→Cd) significantly reduced the Cd-induced decreases in the activity of GR (P < 0.05). The analysis of gene expression for 24 h also showed that the APX and GR transcript levels displayed similar patterns to the changes in their respective enzyme activities (Fig. 7c).

The influence of Cd on total NPT was also investigated because these thiol substances represent the compounds of monothiols and ploythiols (phytochelatins) and confer plant tolerance against heavy metal stresses. As shown in Table 1, a significant increase of NPT (P < 0.05) was observed after 24 h of Cd exposure. Pretreatment with CO kept this tendency. However, combination with Hb pretreatment completely reversed the enhancement of NPT.

Discussion

Recent reports suggested that CO, one of the products of HO (EC 1.14.99.3) catalysis in animals, is stimulated by a range of different stress responses, including heat shock, oxidants, metals, lipopolysaccharide, hypoxia, and hyperoxia (Piantadosi, 2002; Dulak & Józkowicz, 2003). Three HO isozymes have been found in mammals: the inducible HO-1, and the constitutively expressed form HO-2 and HO-3 (Ryter et al., 2006). In this study, we discovered that the exposure of alfalfa roots to relatively lower concentrations of Cd (100 or 200 µm CdCl2) causes rapid release of CO (Figs 1, 2), which has not been reported previously. The changes in CO concentration are also consistent with the changes in HO activity and relative level of HO-1 transcript, an important CO synthetic enzyme in both animals and plants. The effective concentrations of Cd that resulted in the increased CO release were found to lie within a narrow range. Higher concentrations (500 µm) exhibited a negative effect. Yannarelli et al. (2006) also found that the expression of HO-1 mRNA in soybean leaves in response to higher doses of UV-B treatment (30 kJ m−2) at different recuperation times displayed a dramatic diminution (80%), while lower doses of UV-B (7.5 and 15 kJ m−2) resulted in the overexpression of HO-1 gene transcripts. In response to these observations, two questions should be answered: (i) what is the physiological significance of this endogenous CO production conferred by a lower concentration of Cd; (ii) is cellular CO production important in the plant cell's response to environmental changes?

In a further report, the experiments described analyze the beneficial effect of exogenous CO, which induced the endogenous CO release ahead of time in the pretreatment period for 6 h (Fig. 2b), on plants exposed to 100 µm CdCl2 further. In animals, some findings suggested that CO could confer beneficial cytoprotection against oxidative damage (Otterbein et al., 2003). Our results illustrated that, besides providing a significant promotion of plant growth as compared with the control samples (Fig. 3a), alfalfa plants pretreated with 50% CO-saturated aqueous solution had significant alleviation of Cd-induced oxidative injury. We have shown this was a result of inducing and activating antioxidant/detoxifying enzymes, including SOD, POD and GST activities or their transcripts (Fig. 6). This increased enzymatic activity resulted in partially preventing oxidative injury to membranes, evaluated as TBARS formation and LOX activity (Fig. 4) in alfalfa root tissues. Such effects were confirmed by the histochemical staining for the detection of peroxidation of lipid and injury of plasma membrane integrity in root apexes (Fig. 5). Cd uptake was also suppressed by CO pretreatment in a time-dependent manner (Fig. 3b). It was well known that CO, a potent inhibitor of cytochrome c oxidase, could lead to a collapse in mitochondrial membrane potential, the decrease of production of mitochondrial ATP synthesis, and even depletion of ATP concentrations in animals. In plant leaves, CO was previously found to induce stomatal closure by its inhibition of cytochrome c oxidase, which in turn depletes the ATP supply for stomatal functions (Pollok et al., 1989). Thus, the interrelationship between the depletion of ATP concentration elicited by CO and the decrease of Cd uptake should be investigated in the near future.

In HO-1-deficient mammalian cells, it has been proven that the increase of ROS production was significantly lowered by the applications of CO and GSH (Matsumoto et al., 2006). Our results clearly show that CO is able to play an important role in promoting plant tolerance to Cd toxicity, at least partially by preventing oxidative stress in the roots of alfalfa plants. Moreover, applying exogenous CO or putative CO donor(s) has been found to increase the tolerance of plants against salinity stress (Huang et al., 2006), and to enhance seed germination (Liu et al., 2007) and adventitious rooting processes (Zimmerman et al., 1933; Zimmerman, 1937; Xu et al., 2006). Thus, CO appears to be a bioregulator or effector with multiple functions in mediating plant responses to some stresses and plant developmental processes.

In recent years, knowledge of the functions of GSH in plants has expanded rapidly. The reactivity, along with the relative stability and high water solubility of GSH, makes it an ideal biochemical to protect plants against stress, including oxidative stress, heavy metals, and certain exogenous and endogenous organic chemicals. For example, it has been proven that reduced GSH is one of the most efficient scavengers of ROS arising as by-products of cellular metabolism or during oxidative stress (May et al., 1998). The toxicity of Cd is usually monitored by various endogenous antioxidants whereby the thiol pool of the plants plays an important role against oxidative damage. In this study, we observed simultaneous decreases in AsA content and GSH concentration in Cd-treated root tissues (Table 1). The changes in AsA contents were partially consistent with the changes in APX (Fig. 7a), which produced ascorbyl radical (monodehydroascorbate) and oxidized forms of ascorbate (dehydroascorbate) from reduced ascorbate. The depletion of GSH pools could be the result of the increase in synthesis of phytochelatin (PC), one of the most important components of NPT, or GS-X catalyzed by GST (Fig. 6) and the simultaneous increase in the oxidized GSH form (GSSG) in the Cd-treated root cells (Table 1). However, the thiol pool responses, except for the changes in NPT, could be partially reversed by pretreatment with the CO aqueous solution. CO pretreatment probably modulates GSH concentrations by enhancing its biosynthesis, as can be seen from the changes of ECS and GS transcripts (Fig. 7c), or by the up-regulation of GR activity and transcripts (Fig. 7b,c). Interestingly, both CO-induced restoration of GSH/GSSG and alleviation of lipid peroxidation were significantly blocked by Hb, a scavenger of CO (Table 1). These results may provide some explanation for the cytoprotective role of CO in mediating Cd-induced oxidative damage in alfalfa root tissues as follows: CO stimulates the production a high level of reduced GSH levels in Cd-treated root tissues, because a lot of evidence has clearly demonstrated that GSH synthesis is driven by increasing demand for GSH in response to heavy metal exposure, and GSH conversion to phytochelatin (PC) or even GS-X, two consumption pathways related to GSH homeostasis (Xiang & Oliver, 1998). Furthermore, the CO-promoted GSH concentration exerts an alleviation of Cd-induced oxidative damage possibly by quenching ROS produced by some heavy metals (Alscher, 1989; Foyer et al., 1994). GSH has been found to play a central role in protecting plants from environmental stresses, including oxidative stress resulting from the generation of ROS, xenobiotics, and some heavy metals. It was also proven by the fact that CO-induced enhancement of reduced GSH concentration was correlated with the inhibition of lipid peroxidation and LOX activity (Figs 4, 5). Thus, it was also possible that CO pretreatment resulted in the alleviation of lipid peroxidation by blocking LOX activity, which catalyzes the peroxidation of unsaturated fatty acids of biomembranes to produce hydroperoxides and oxy-free radicals (Brash, 1999). However, the mechanism behind CO-induced inhibition of LOX activity under stressed condition in plants is unclear.

Phenylalanine ammonium lyase is a key enzyme in the first step of the phenylpropanoid pathway responsible for the synthesis of plant phenylpropanoids or phenolics, many of which play important roles in plant defense against pathogens and herbivores (Dixon & Paiva, 1995; Delledonne et al., 1998). The activation of PAL is also a common response of plant cells to abiotic stress. For example, it has been reported (Kuthanováet al., 2004) that the PAL activity exhibited an earlier rise in 50 µm CdCl2-treated tobacco BY-2 cells in comparison with the control cells. In our present study, Cd-induced PAL activity and gene expression in the root tissues of alfalfa plants were potentiated by the CO pretreatment (Fig. 6d,e), illustrating that the activation of PAL may be modulated by the CO produced endogenously or conferred by exogenous CO aqueous solution pretreatment.

In animals, the HO-1/CO system has attracted greater research interests because of its newly discovered physiological effects (Ryter et al., 2006). However, relatively few studies have addressed the role of HO-1/CO in plants. The role attributed to HO in plants was its participation in the biosynthetic pathway leading to phytochrome chromophore formation (Davis et al., 1999, 2001; Muramoto et al., 2002). Although Baudouin et al. (2004) suggested that HO-1 could not be modulated by ROS or reactive nitrogen species, some investigators have carefully examined the cytoprotective role of HO-1, the inducible form of HO, against oxidative stress in plants (Noriega et al., 2004; Balestrasse et al., 2005; Yannarelli et al., 2006). The mechanisms by which HO-1 provides protection most likely involves its enzymatic reaction products. For example, administration of BV, another product of HO-1, and which can act as an efficient ROS scavenger, partially prevented the oxidative effects caused by Cd in soybean leaves (Noriega et al., 2004). In our study, administration of CO aqueous solution can substitute for HO-1 or BV with respect to its cytoprotective role against oxidative damage in plant tissues (Noriega et al., 2004; Balestrasse et al., 2005; Yannarelli et al., 2006), further suggesting a role for CO also as a key mediator of HO-1 functions in plants.

It was well known that CO could modulate gene expression in mammalian cells in several ways (Dulak & Józkowicz, 2003). Firstly, an increase in CO concentration in vivo will result in the formation of carboxyhemoglobin, and decreased oxygenation and hypoxia. Secondly, local effects of CO, which lead to gene expression in a cGMP-dependent manner, may be derived from its interaction with nitric oxide (NO), another signal molecule in both the animal and plant kingdoms. Recently, responses and adaptations of plants to several abiotic stresses have been shown to be associated with NO. This includes drought, salinity, heat and heavy metal stresses (Delledonne, 2005). In view of the fact that Hb, applied in our experiment as the scavenger of CO, was also reported to be the scavenger of NO (Perazzolli et al., 2004), the possibility of NO-elicited responses involved in CO reduction of Cd-induced oxidative damage could not be easily ruled out. Thirdly, HO-1-derived CO might influence the bioactivity of several transcriptional factors and kinases, as has been demonstrated so far for NF-κB and p38 kinase (Brouard et al., 2002). In addition, by interacting with heme proteins, CO influences electron-transport reactions in a variety of ways, which can produce either prooxidant or antioxidant effects. Thus, whether similar signaling pathways also exist in moderating plant responses against Cd stress should be carefully investigated.

In plants, APX is an important heme-containing protein (Nakano & Asada, 1981). APX-mediated detoxification of H2O2 is coupled with AsA oxidation. Although H2O2 initiates several oxidatively destructive processes, it is also regarded as the signal to trigger various signaling pathways, and the maintenance of appropriate H2O2 concentrations might represent a survival response (Neill et al., 2003). Meanwhile, oxidized AsA is then regenerated via the oxidation of GSH. Therefore, it is interesting that, besides the enhancement of GSH and NPT concentrations, AsA contents were increased in the CO-pretreated alfalfa seedling roots, whereas APX activity decreased (Table 1 and Fig. 7a). Thus, the evidence of the direct inhibition of APX activity in alfalfa root tissues by CO, and whether the fact that the H2O2 signal derived from less APX activity was also involved in the CO-induced Cd tolerance, should be elucidated further.

Taken together, this study illustrated that in alfalfa seedling roots, the increase in CO production increased in response to Cd stress, and exogenously applied CO increased Cd tolerance by preventing oxidative damage with the enhancement of glutathione metabolism in the roots of Medicago sativa. Interestingly, we also found that the effect of 100 µm Cd on AsA, GSH and GSSG content was potentiated by the pretreatment of the CO scavenger Hb, and TBARS formation was also enhanced (Table 1). Thus, these results further indicated that endogenous CO might be involved in plant tolerance against Cd. Our evidence not only provides a further possible mechanism to explain the cytoprotective role of HO-1, as demonstrated by the results of Noriega et al. (2004) and Yannarelli et al. (2006), but also suggests that CO gas might be an important signal molecule for abiotic stress tolerance, although characterization of the CO gas as a signal molecule in plants has been limited so far.

Acknowledgements

We are grateful for the grant obtained from the program for new century excellent talents in university, and the 111 project of China (grant no. B07030). We also thank Dr Meixue Zhou and Dr Evan Evans from the University of Tasmania, Australia, for their kind help in writing the manuscript.

Ancillary