SEARCH

SEARCH BY CITATION

Keywords:

  • glycosylphosphatidylinositol (GPI) anchor biosynthesis;
  • insertional mutagenesis;
  • Leptosphaeria maculans;
  • morphogenesis;
  • oilseed rape;
  • pathogenicity gene;
  • stem canker

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • • 
    Random insertional mutagenesis was used to investigate pathogenicity determinants in Leptosphaeria maculans. One tagged nonpathogenic mutant, termed m20, was analysed in detail here.
  • • 
    The mutant phenotype was investigated by microscopic analyses of infected plant tissues and in vitro growth assays. Complementation and silencing experiments were used to identify the altered gene. Its function was determined by bioinformatics analyses, cell biology experiments and functional studies.
  • • 
    The mutant was blocked at the invasive growth phase after an unaffected initial penetration stage, and displayed a reduced growth rate and an aberrant hyphal morphology in vitro. The T-DNA insertion occurred in the intergenic region between two head-to-tail genes, leading to a complex deregulation of their expression. The unique gene accounting for the mutant phenotype was suggested to be the orthologue of the poorly conserved Saccharomyces cerevisiae gpi15, which encodes for one component of the glycosylphosphatidylinositol (GPI) anchor biosynthesis pathway. Consistent with this predicted function, a functional translational fusion with the green fluorescent protein (GFP) was targeted to the endoplasmic reticulum. Moreover, the mutant exhibited an altered cell wall and addition of glucosamine relieved growth defects.
  • • 
    It is concluded that the GPI anchor biosynthetic pathway is required for morphogenesis, cell wall integrity and pathogenicity in Leptosphaeria maculans.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In eukaryotes, glycosylphosphatidylinositol (GPI) anchoring is a conserved mode of covalent attachment of numerous proteins to cell membranes (Orlean & Menon, 2007). The model yeast Saccharomyces cerevisiae has been proposed to contain two groups of GPI-anchored proteins according to their final location (De Sampaïo et al., 1999). In the main group, the GPI anchor is involved in a transglycosylation reaction which cross-links the protein to cell wall β-glucans, whereas the second minor group includes plasma membrane-resident proteins. GPI-anchored proteins must firstly acquire a GPI anchor as a posttranslational modification in order to be addressed from their site of synthesis to their ultimate destination (De Sampaïo et al., 1999). The pathway responsible for the synthesis and attachment of the GPI anchor to proteins is complex and plays a critical role in the proper targeting, transport and function of all GPI-anchored proteins. The complete GPI anchor structure is fully preassembled in a multistep pathway that sequentially adds the various GPI components. As suggested by the presence of an evolutionary conserved core region in GPI anchors, the biosynthetic machinery that assembles GPI anchors is also conserved among eukaryotes and consists of at least 10 reaction steps (Orlean & Menon, 2007). In all cases, GPI anchor biosynthesis is initiated by the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This reaction is catalysed by an enzymatic complex called GPI-N-acetylglucosaminyltransferase (GPI-GnT), which is unusually elaborate compared to other glycosyltransferases. The human GPI-GnT consists of at least seven known subunits – PIG-A, PIG-C, PIG-H, GPI1, PIG-P, PIG-Y and DPM2 (Kamitani et al., 1993; Miyata et al., 1993; Inoue et al., 1996; Watanabe et al., 2000; Tiede et al., 2001; Murakami et al., 2005) – with the first six subunits having structural and functional counterparts in S. cerevisiae, termed GPI3, GPI2, GPI15, GPI1, GPI19 and ERI1, respectively (Leidich et al., 1995; Schönbächler et al., 1995; Leidich & Orlean, 1996; Yan et al., 2001; Sobering et al., 2004; Newman et al., 2005). Of these subunits, PIG-A/GPI3, PIG-C/GPI2, PIG-H/GPI15 and PIG-P/GPI19 are essential for GPI-GnT, because cells with mutations in these genes are completely deficient in the surface targeting of GPI-anchored proteins.

The phytopathogenic Ascomycete Leptosphaeria maculans is the causal agent of stem canker of Brassica species, the most damaging disease on oilseed Brassica such as B. napus (Fitt et al., 2006). This hemibiotrophic fungus develops a complex life cycle, alternating saprophytic, biotrophic and necrotrophic phases. These traits are representative of infection strategies of fungi belonging to the class Dothideomycetes and also include other traits such as endophytic intercellular colonization of plant tissues and the lack of development of specialized infection structures (for a review, see Rouxel & Balesdent, 2005). Despite major economic losses in the main growing areas of the world (Fitt et al., 2006), the molecular determinism of L. maculans pathogenicity towards its host plant is currently poorly understood, with only three factors required for pathogenicity identified to date. Two of these factors, ICL1 and THIOL, are involved in lipid metabolism, whereas the third one has no putative predicted function (Idnurm & Howlett, 2002, 2003; Elliott & Howlett, 2006). In addition, two genes conferring avirulence on resistant genotypes of B. napus have been recently cloned, AvrLm1 and AvrLm6 (Gout et al., 2006; Fudal et al., 2007). Avirulence genes are suggested to participate in virulence or fitness of the pathogen as ‘effectors’ (Huang et al., 2006).

Insertional mutagenesis is a powerful tool for uncovering new pathogenicity genes in fungi, with Agrobacterium tumefaciens-mediated transformation (ATMT) being the tool of choice for such a purpose (Michielse et al., 2005; Elliott & Howlett, 2006; Blaise et al., 2007). A large collection of L. maculans random insertional transformants was generated via ATMT to identify novel pathogenicity factors (Blaise et al., 2007). A total of 53 transformants reproducibly affected in their virulence, and showing various altered phenotypes, were recovered from a subset of 1388 ATMT transformants (Blaise et al., 2007). Following formal genetic analyses, only 50% of the ‘loss of pathogenicity’ mutants were actually tagged by the T-DNA (i.e. were mutants where the T-DNA insertion was responsible for the altered phenotype).

Here, we report on the phenotypic and molecular characterization of one of the L. maculans nonpathogenic mutants, m20, previously shown by formal genetics to be a tagged mutant (Blaise et al., 2007). Our data show that the mutant exhibited a significantly reduced growth rate and an altered morphology in vitro. Following inoculation of oilseed rape cotyledons, it was blocked during the invasive growth phase of plant tissues. The T-DNA integration occurred in the overlapping promoter region of two head-to-tail genes, leading to a complex deregulation of their expression. Complementation experiments further identified one of the two genes as responsible for the mutant phenotype. The corresponding gene encoded an endoplasmic reticulum (ER)-localized protein, which is the putative functional homologue of the human PIG-H and S. cerevisiae GPI15 proteins, involved in GPI anchor biosynthesis. This study thus highlights the intimate connections between GPI anchoring, cell wall integrity and pathogenicity in L. maculans.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fungal isolates

The v23.1.3 isolate of L. maculans (Balesdent et al., 2001) was used as the recipient isolate for the generation of the ATMT collection of L. maculans (Blaise et al., 2007), and was used as the wild-type (WT) isolate in this study. The identified mutant, m20, showed an altered sporulation phenotype (see the Results section) and analyses were thus performed on one progeny isolate from cross m20 × v23.1.2, m20.4.21, displaying the same phenotype as m20 (Blaise et al., 2007). In vitro crosses and random ascospore progeny recovery were performed as previously established (Gall et al., 1994). Two isolates, m20GFPa and m20GFPb, exhibiting the mutant phenotype and strongly expressing GFP, were isolated in the progeny of a cross between m20.4.21 and the near-isogenic isolate v41.4.6 (fifth backcross) of v23.1.3 isolate transformed by a strongly GFP-expressing construct (a gift from Dr Y. J. Huang, Rothamsted Research, UK; unpublished). All fungal cultures were maintained on V-8 juice agar medium and highly sporulating cultures were obtained on V-8 juice agar medium as previously described (Ansan-Melayah et al., 1995).

Pathogenicity assays and assessment of growth and hyphal morphology

Pathogenicity of isolates was firstly assessed following inoculation of cotyledons of cv. Westar, a highly susceptible genotype of Brassica napus L., as previously described (Balesdent et al., 2001). Plants were incubated in a growth chamber at 18°C (night) and 24°C (day) with a 12 h photoperiod. Symptoms were scored 14, 17 and 21 d postinoculation (dpi) according to the semiquantitative IMASCORE rating scale, where scores up to 3 correspond to resistance responses of the plants and scores above 3 correspond to susceptibility (Balesdent et al., 2001). The ability to cause stem necrosis at later stages was evaluated by depositing a 10 µl droplet of a 107 ml−1 suspension of conidia at the basis of the petiole of the second leaf of 1-month-old plantlets of cv. Westar wounded three times with a needle (Hammond & Lewis, 1986). Incubation took place in the same conditions as for the cotyledon inoculation test. Symptoms were scored 3 months postinoculation by numbering plants exhibiting lesions (incidence) and by measuring length of the necrosis whenever present (severity).

Growth defects in vitro were assessed by depositing 10 µl of water containing 105 conidia in the centre of 90 mm Petri dishes containing V-8 juice agar medium and by measuring the radial growth after a 2 wk incubation at 23°C. In order to evaluate the sensitivity of isolates to reagents that affect osmotic pressure, cell wall integrity or GPI anchor biosynthesis, radial growth tests were performed using MPDA medium (1.5% malt, 2% potato dextrose agar, 2 g l−1 agar) supplemented with sorbitol, and minimal medium II (MMII; Pontecorvo et al., 1953) supplemented with either NaCl, SDS (sodium dodecylsulphate), Congo red (Sigma Aldrich, St Louis, MO, USA) or glucosamine (Merck, Darmstadt, Germany). The range of concentrations assessed in each case was such that it never induced > 30% inhibitory effect on the WT control.

To analyse hyphal morphology, 10 µl of water containing 105 conidia of the GFP-expressing isolates were allowed to germinate and the hyphae allowed to spread between two cellophane sheets on 1.5% water agar medium according to Bowman et al. (2006). Images of isolated colonies were viewed with a Leica MZ16F stereomicroscope (Leica, Heidelberg, Germany) following 72 h of growth at room temperature. For the detection of GFP fluorescence, a GFP2 filter set from Leica Microsystems was used.

Nucleic acid manipulation, DNA sequencing

Genomic DNA used for PCR experiments was extracted from conidia using the DNeasy 96 Plant Kit (Qiagen SA, Courtaboeuf, France) as described previously (Gout et al., 2006). Genomic DNA for Southern blotting was extracted by using Sarcosyl, as described by Balesdent et al. (1998). Procedures for gel electrophoresis, Southern blots and hybridizations have been reported (Attard et al., 2005) and were adapted from procedures described by Sambrook et al. (1989).

For cloning experiments, we used Nucleospin extract II, Nucleobond BAC 100 and Nucleospin Plasmid extraction kits (Macherey-Nagel, Hoerdt, France) for plasmid and BAC extractions, and purification of DNA from agarose gels, respectively. Enzymatic digestions and ligations were performed according to the manufacturer's instructions (Invitrogen, Cergy Pontoise, France, and New England Biolabs, Hitchin, UK). Escherichia coli DH10B electrocompetent cells were prepared as described by Sambrook et al. (1989) and electroporated at 1.5 kV and 50 µF.

The PCR-walking method described by Balzergue et al. (2001) was used with minor modifications for the rescue of genomic regions flanking the inserted T-DNA. A sequence of 1139 bp was generated and used to design a pair of specific primers for the screening by PCR of the HindIII BAC library available in the laboratory (Gout et al., 2006). One positive BAC clone was digested with EcoRV and the genomic fragments were cloned into pUC18. A positive subclone of c. 10 kb was detected and a 4.8 kb fragment encompassing the T-DNA integration site was fully sequenced. Sequencing was performed using a Beckman Coulter CEQ 8000 automated sequencer (Beckman Coulter, Fullerton, CA, USA) according to the manufacturer's instructions.

Total RNA was extracted from mycelium grown during 3 wk in liquid Fries medium, germinating conidia grown for 36 h in Fries or B5 minimal medium, and infected plants, by using TRIzol reagent (Invitrogen, Cergy Pontoise, France). Extracts were treated with DNAseI (New England BiolabsUK) according to the manufacturer's instructions. Five micrograms of total RNA were reverse-transcribed using an oligo-dT anchor and PowerScript Reverse Transcriptase (Clontech, Palo Alto, CA, USA).

Quantitative RT-PCR analysis

Quantitative RT-PCR was performed using model 7700 real-time PCR equipment (Applied Biosystems, Foster City, CA, USA) and Absolute SYBR Green Rox dUTP Mix (Abgene, Courtaboeuf, France). For each condition tested, two RNA extractions and two reverse transcriptions for each of the three biological repeats were performed. RNA extracted from uninfected leaves and water was used as negative control. Conditions for reactions and thermocycling profile were as previously described (Fudal et al., 2007). After the cycling, dissociation curve analysis confirmed the absence of nonspecific products in the reaction. The fluorescence threshold (Ct) value was determined at 0.1 of fluorescence intensity. Ct values were analysed as described by Muller et al. (2002). Oligonucleotides actF (5′ AGTGCGATGTCGATGTCAG) and actR (5′ AAGAGCGGTGATTTCCTTCT) were used as primers to detect cDNAs corresponding to actin. Similarly, oligonucleotides tubF (5′ AAGAACTCATCCTACTTCGT) and tubR (5′ TGAATAGCTCCTGAATGG) were used for β-tubulin; orf1F (5′ AAAAGGAGAAGAAGGCAACA) and orf1R (5′ TAGGCAGACACGGGACTTGG) were used for orf1; and orf2F (5′ CGTCAACGATCCAATACACA) and orf2R (5′ AGGATGAGTACGGCGATTAG) were used for orf2.

Bioinformatics analysis and gene annotation

Sequences were assembled using CAP3 (http://pbil.univ-lyon1.fr/cap3.php) (Huang & Madan, 1999) and the final genomic region was analysed using ORF Finder (http://www.ncbi.nlm.nih.gov/) (Rombel et al., 2002) in order to search for potential open reading frames (ORFs) within the sequence. BLASTP and BLASTX searches were performed at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/BLAST/) or at the Broad Institute website (http://www.broad.mit.edu/) (Altschul et al., 1990). PFAM A was used to search for conserved annotated domains (http://www.sanger.ac.uk/Software/Pfam/) (Sonnhammer et al., 1998). Putative transmembrane regions were predicted by the TMHMM version 2.0 program (Krogh et al., 2001; http://www.cbs.dtu.dk/services/TMHMM/). The presence of an N-terminal ER import signal was analysed using SignalP version 3.0 (http://www.cbs.dtu.dk/services/SignalP/) (Nielsen et al., 1997). Multiple sequence alignment was realized using CLUSTALW (http://www.ebi.ac.uk/clustalw/; Thompson et al., 1994), and was refined manually using GeneDoc 2.6.002 (Nicholas & Nicholas, 1997). For S. nodorum orthologues, accession numbers were as follows: SNOG_05510 (EAT86574); SNOG_05511 (EAT86575); SNOG_05512 (EAT86576); SNOG_05513 (EAT86577) (Broad Institute).

Intron positions were determined following PCR amplification and sequencing of the corresponding cDNA. Annotations of untranscribed regions (UTR), transcription start and stop sites were performed on cDNA using the GeneRacer Kit (Invitrogen) and the cDNA SMART Kit (Clontech) according to the manufacturer's recommendations.

Vector construction and transformation of fungal isolates

The binary vector pNAT1 (a gift from Dr Barbara Howlett, University of Melbourne, Australia; Gardiner et al., 2005), which carries the nourseothricin acetyltransferase gene (NAT1) conferring resistance to the antibiotic nourseothricin, was used in all ATMT experiments.

For functional complementation experiments, three different vectors were constructed. A first fragment of 1205 bp containing the orf1 gene along with the entire promoter region was amplified using the primers orf1F (5′ TTACTAGTGGTTATCGGGGAATCATCG) with a flanking SpeI site and orf1R (5′ TTAGATCTATGAGTAGGATTGGAGCAGCTGCG) with a flanking BglII site. A second fragment of 1425 bp containing the orf2 gene along with the entire promoter region was amplified using the primers orf2F (5′ TTGGATCCTCGGGCTTCTGGCGTTTGGC) with a flanking BamHI site and orf2R (5′ TTACTAGTGTGCGGAGATGGAGACGGCAT) with a flanking SpeI site. A third fragment of 2310 bp containing the orf(1 + 2) genes was amplified with orf2F and orf1R. The digested fragments were inserted into BglII/SpeI-linearized pNAT1, generating vectors pNAT1::orf1, pNAT1::orf2 and pNAT1::orf(1 + 2), respectively.

The plasmid for orf2 RNA silencing experiment was constructed as previously described by Fitzgerald et al. (2004) with minor modifications (Fudal et al., 2007). An orf2 sense fragment was amplified using the primers orf2SsF (5′ TTAAGCTTAATCGCCGTACTCATCCTTT) with a flanking HindIII site, and orf2SsR (5′ TTGGATCCTTCCCTCTTCTTTGCCATCC) with a flanking BamHI site. A orf2 antisense fragment was amplified using the primers orf2SaF (5′ TTGAATTCAATCGCCGTACTCATCCTTT) with a flanking EcoRI site, and orf2SaR (5′ TTGGATCCAGCGTGTGGTCGGGGATTGT) with a flanking BamHI site. The resulting PCR products were digested and both were inserted into the HindIII/EcoRI-linearized pJK11 vector (a gift from Dr Kim Plummer, Horticulture and Food Research Institute, New Zealand; Fitzgerald et al., 2004). The resulting plasmid places the hairpin inverted repeat fragments under the control of the promoter of Glomerella cingulata gpdA and the terminator of Aspergillus nidulans trpC. This expression cassette was excised by XhoI and SpeI, and subcloned into the corresponding sites of pNAT1, generating vector pNAT1[m20sil].

A functional translational fusion between orf2 and eGFP genes was constructed as follows. The orf2 coding sequence was amplified with primers orf2FU (5′ TTACATGTCCGCCATCCTG) and orf2FL (5′ TTGCGGCCGCTTAGTAATAACCCTCC), introducing a PciI site adjacent to the start codon and a NotI site immediately downstream of the stop codon. A 1.2 kb fragment of Lmpma1 promoter (Remy et al., 2008) was amplified using the primers prom2F (5′ TTGTCGACGGGATGCCGCTGTCAGGTCA) with a flanking SalI site, and prom2R (5′ TTCCATGGCGATTAAAGAATGCTGTGG), introducing a NcoI site immediately upstream of the translational site. These fragments were digested and inserted into SalI/NotI-linearized pBluescript II KS (+/−) (Stratagene, La Jolla, CA, USA), yielding plasmid pBS[pLmpma1::orf2]. A 2 kb fragment encompassing pLmpma1 and orf2 coding sequence was amplified from pBS[pLmpma1::orf2], with primers prom2F and orf2FL, except that the flanking NotI site was replaced by a NcoI site. In parallel, the orf2 terminator was amplified with primers orf2TU (5′ TTGCGGCCGCGTGGATTTTGATTGTAGAC), introducing a NotI site immediately downstream of the stop codon, and orf2TL (5′ TTACTAGTTCGGGCTTCTGGCGTTTGGC) with a flanking SpeI site. The digested fragment and the 750 bp NcoI/NotI GFP cassette of pEGFP (Clontech) were inserted into a NcoI/SpeI-linearized pGEM®-T Easy vector (Promega, Charbonnières, France), yielding plasmid pGEM[eGFP::torf2]. The SalI/NcoI fragment of pBS[pLmpma1::orf2] and the NcoI/SpeI fragment of pGEM[eGFP::torf2] were inserted into SalI/SpeI-linearized pNAT1. The resulting plasmid, pNAT1[pLmpma1::orf2::eGFP::tOrf2], encodes a C-terminal fusion between orf2 and eGFP, expressed under the control of the plasma membrane H+-ATPase promoter and the orf2 terminator.

The different constructs were then introduced into A. tumefaciens strain C58pGV2260 by electroporation at 1.5 kV and 25 µF. ATMT was performed as described by Gout et al. (2006). Transformants were selected on MMII medium supplemented with 50 µg ml−1 hygromycin B (Invitrogen) and/or 50 µg ml−1 nourseothricin (WERNER BioAgents, Jena, Germany), purified by single conidium isolation and maintained on selective medium.

Microscopy

Cotyledons of cv. Westar were stained by trypan blue at 14, 17 and 21 dpi as described by Keogh et al. (1980) and cleared in chloral hydrate before examination by light microscopy.

To examine the ability of conidia to germinate on the plant surface, 10 µl of a 107 ml−1 suspension of conidia were deposited on the surface of excised cotyledons of cv. Westar without wounding. Cotyledons were incubated in Petri dishes containing water agar, and incubated at room temperature and under natural light for 72 h. Germination was visualized using cryoscanning electron microscopy (SEM). Samples with an area of c. 1.5 × 3 mm were cut with a razor blade, mounted on a cryostage at –160°C and then incubated under vacuum on the scanning electron microscope stage at –80°C for c. 10 min to allow sublimation to occur before being returned to –160°C for sputter-coating with gold. Samples were viewed by conventional mode and at low temperature with a scanning electron microscope (Philips 525M, FEI, Limeil Brevannes, France) modified with a cryostage (cryotrans system CT 1500, Gatan, Grandchamps, France).

For ultrastructural analysis of plant-infected materials by transmission electron microscopy (TEM), samples with an area of c. 1.5 × 3 mm, including part of the inoculation wound, were cut with a razor blade from cotyledons of B. napus cv. Westar infected with either the WT isolate or m20.4.21, at 3 and 14 dpi. They were placed into vials containing 2% glutaraldehyde in 0.1 m cacodylate buffer (pH 7.2) and infiltrated using a water jet pump for c. 1 min. Following six rinses in 0.1 m cacodylate buffer, they were transferred to vials of secondary fixative consisting of 1% OsO4 in cacodylate buffer for 2 h in the dark, washed in water, and stained en bloc with 1% aqueous uranyl acetate for 1 h in the dark. After five rinses with water, the material was dehydrated in acetone, with 10 min changes at 25, 50, 70, 95, and 3 × 100% anhydrous acetone. The samples were then placed into increasing concentrations of the ERL resin in acetone (1 : 2 for 30 min, 1 : 1 for 30 min, 2 : 1 overnight, pure ERL for 4 h, pure ERL overnight). All steps were performed at room temperature. Finally, samples were embedded in pure resin at 70°C for 1 d. For cutting and post-staining of samples, semithin sections of all treatments were made with a glass knife using an ultramicrotome (Ultracut Reichert-Jung, Vienna, Austria) and analysed for the presence of fungal hyphae within the leaf with a light microscope. Ultrathin sections (60–90 nm) were cut from well-preserved samples showing the presence of such hyphae with a diamond knife (Diatome, Switzerland), placed on to copper grids coated with formvar and post-stained with 1% uranyl acetate in acetone for 20 min and Reynold's lead citrate for 20 min. In between and after post-staining, sections were rinsed with distilled water. Finally, they were examined with a Zeiss EM 109 transmission electron microscope at 80 kV. At least 50 points of contact between hyphae of each fungal strain and host cells were analysed for both 3 and 14 dpi samples.

For confocal microscopy, transformants were routinely grown on MMII and observed using the ‘inverted agar block method’ (Hickey et al., 2005). Growing hyphae were imaged at 20–22°C using an inverted Zeiss LSM-510 META laser scanning confocal microscope fitted with an argon/2 ion laser with a GFP filter set (excitation 488 nm, emission 515–530 nm). A 100X DIC Plan Apochromat oil immersion objective (N.A. 1.4) was used for image acquisition. Confocal images were captured using LSM-510 software (version 3.2; Carl Zeiss) and evaluated and further processed with LSM-510 Image Examiner (version 3.2). Concentrated stock solutions of organelle-specific dyes were made in DMSO as suggested by the manufacturer, kept at −20°C, diluted in liquid medium to the appropriate working concentration and allowed to warm up to room temperature before applying to growing hyphae. Agar blocks containing growing mycelium were inverted on to a coverslip containing a 10 µl drop of the corresponding solution. Stained cells were imaged after a 3–5 min recovery period. As a marker of Golgi equivalents and ER, we used a 5 µm brefeldin A (BFA) conjugated to bodipy 558/568 (Molecular Probes, B7449). Observations were made with a He/Ne-2 laser (excitation 558 nm, emission 568 nm).

Nucleotide sequence data

The sequences analysed in this study have been submitted to the EMBL databases under accession numbers AM905386 (Lmgpi15) and AM905387 (orf1).

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Biological and phytopathological characterization of m20.4.21

The mutant 20 showed a reduced sporulation, whereas it exhibited normal germination and mating behaviour. This trait, however, was not linked to the T-DNA integration in the m20 × v23.1.2 progeny, since no isolate in the progeny exhibited sporulation defects. Most of the subsequent steps of the study were thus performed with one progeny isolate, m20.4.21, exhibiting similar morphological and pathogenicity alterations as m20, but unaffected in its ability to sporulate. The mutant 20 was firstly identified in the ATMT collection as being reproducibly affected in its ability to infect oilseed rape cotyledons as compared with the WT isolate, inducing a morphologically unusual hypersensitive reaction (Fig. 1a,b). Plant tissues immediately surrounding the inoculation site showed a collapse typical of the susceptibility symptoms, but the lesion expansion was rapidly restricted by a dark necrotic margin (Fig. 1a,b). Scanning electron microscopy analyses indicated no difference between m20.4.21 and WT isolate conidia in their ability to germinate on the cotyledon surface (Fig. 1c). Comparison between WT and mutant isolates constitutively expressing the green fluorescent protein (GFP) confirmed these observations and further showed that hyphae of the mutant penetrated the plant tissues at the point of wounding (data not shown). Invasive growth ability was firstly evaluated by cytological observations of trypan blue-stained infected cotyledons. Hyphae of m20.4.21 were detected in intercellular spaces of both collapsed and well preserved plant tissues, but to a lesser extent than those of the WT isolate. These latter isolates showed an extensive colonization of intercellular spaces away from the initial inoculation point (data not shown). These observations were confirmed by ultrastructural studies, which showed a massive presence of the WT isolate within host cotyledons even at 3 dpi, while m20.4.21 was present to a much smaller extent. At 3 dpi, host cells and their organelles appeared mostly intact. However, many host cells in close contact with the WT isolate hyphae displayed signs of cell wall deterioration (Fig. 1d). This phenomenon was markedly increased at 14 dpi, where the WT isolate had furthermore killed most cells in the studied tissue and invasion of dead host cells by the WT isolate hyphae was regularly observed (Fig. 1d). By contrast, m20.4.21 caused almost no difference in host cell wall appearance and apparently had no effect on the viability of plant cells, either at 3 dpi or at 14 dpi. In addition, invasion of host cells was never seen with the mutant (Fig. 1d). These data suggested that the mutant was affected in its invasive growth ability following an unaffected initial penetration stage. The final stage of the disease, stem necrosis, was assessed macroscopically and showed that m20.4.21 was able to colonize the stem tissues in rare cases, and was then able to induce only a very limited and superficial necrotic symptom as compared with the WT isolate (Table 1).

image

Figure 1. Comparison of the Leptosphaeria maculans wild-type (WT) and mutant 20.4.21 isolates’ pathogenicity behaviour on Brassica napus. (a) Cotyledons of B. napus cv. Westar were inoculated with the WT and m20.4.21 isolates. Photographs were taken 21 d after inoculation. (b) Magnification of symptoms caused by the WT and m20.4.21 isolates. (c) Scanning electron micrographs of cotyledon surface of B. napus cv. Westar inoculated with the WT and m20.4.21 isolates. Photographs were taken 72 h after inoculation. Scale bars are indicated on each photograph. (d) Transmission electron micrographs of cotyledons of B. napus cv. Westar inoculated with the WT and m20.4.21 isolates. Photographs were taken 3 d (1, 2) and 14 d (3, 4) after inoculation. Large arrows and arrowheads point to degraded and unaltered host cell wall areas, respectively, and small arrows point to a hypha invading a host cell. The mutant has caused no visible alteration of the host cell wall. c, chloroplast; dH, dead host cell; er, endoplasmic reticulum; F, fungus; g, Golgi apparatus; H, host cell; m, mitochondrion; n, nucleus. Magnification, ×4800 (1); × 11200 (2, 3, 4).

Download figure to PowerPoint

Table 1.  Growth and pathogenicity of the Leptosphaeria maculans wild-type (WT), m20.4.21 and m20.4.21 isolates complemented with orf1 and its promoter (m20corf1), orf2 and its promoter (m20corf2), or both genes with their bidirectional promoter (m20corf1+2)
 Isolates
WTm20.4.21m20corf1m20corf2m20corf1+2
  • a

    Data correspond to average values ± SD obtained after analysis of 25, 20 and 20 complemented isolates of m20corf1, m20corf2 and m20corf12, respectively and of three repeats for WT and m20.4.21 isolates.

  • b

    Morphology of fungal colonies growing on V8-juice agar medium was assessed visually and compared to that of the WT isolate and m20.4.21.

  • c

    Pathogenicity was assessed on cotyledons of Brassica napus cv. Westar. Data are mean disease ratings of c. 10 inoculation sites scored according to the IMASCORE scale where 1–3 represent resistance response and 4–6 susceptibility symptoms.

  • d

    Incidence: percentage of plants with necrosis; Severity: mean length of expressed lesions.

Radial growth after 2 wk (cm)6.35 ± 0.26a4.90 ± 0.394.63 ± 0.516.63 ± 0.366.52 ± 0.49
Morphologyb  m20.4.21WTWT
Pathogenicity on cotyledons (17 dpi)c4.00 ± 0.001.00 ± 0.001.01 ± 0.033.87 ± 0.283.88 ± 0.26
Pathogenicity on stems (90 dpi)     
 Incidence (%)d100.0020.0025.00100.0090.00
 Severity (cm)d6.50 ± 2.542.00 ± 0.751.56 ± 1.167.08 ± 1.487.36 ± 0.83

In addition to its pathogenicity defects, the mutant showed a markedly affected growth rate in both agar and liquid medium. In agar medium, its growth rate was reduced by up to 40%, depending on the culture medium analysed, as compared with the WT isolate (Tables 1, 2). Macroscopic examination showed specific morphological features when grown on V8-juice agar medium, with a very white, aerial mycelium and wavy edges of the colony (Fig. 2a). The growth and morphological defects segregated in all cases with both the selection marker and the altered pathogenicity in the m20 × v23.1.2 progeny. Microscopic observations of the m20.4.21 isolates expressing GFP, m20GFPa and m20GFPb showed that the mutant exhibited a very different hyphal morphology and branching pattern as compared with the WT isolate (Fig. 2b). Hyphae of the WT isolate were elongated, straight and showed very few branching points. By contrast, the m20.4.21 hyphae showed a tortuous growth and a high number of branching points, reminiscent of a spider's web (Fig. 2b).

Table 2.  Effect of osmotic stress, cell wall-perturbating agents and glucosamine on the radial growth of the Leptosphaeria maculans wild-type (WT) and m20.4.21 isolates and progeny from the m20 × v23.1.2 cross
 WTm20.4.21ProgenyStudent's testa
m20.4.21 phenotypeWT phenotype
  • a

    Student's test values are calculated between the two groups of progeny isolates from the m20 × v23.1.2 cross (i.e. isolates with the WT and m20 phenotype). P, probability; ns, not significant.

  • b

    Data are average values ± SD of four different isolates for each progeny category and of three repeats for WT and m20.4.21 isolates.

Unsupplemented media     
MMII4.50 ± 0.14b3.07 ±  0.093.28 ± 0.114.65 ± 0.21t = 10.53 (P = 0.001)
PDA3.60 ± 0.182.18 ± 0.212.30 ± 0.453.90 ± 0.28t = 5.25 (P = 0.01)
Osmotic stress     
Sorbitol 0.54M (PDA)3.30 ± 0.093.1 ± 0.063.00 ± 0.353.51 ± 0.25t = 2.06 (ns)
NaCl 0.68M (MMII)3.16 ± 0.161.59 ± 0.111.68 ± 0.163.33 ± 0.18t = 11.78 (P = 0.001)
Cell wall-perturbating agents     
SDS 0.035 mm (MMII)3.78 ± 0.041.83 ± 0.171.90 ± 0.144.00 ± 0.21t = 14.48 (P = 0.001)
Congo red 0.25 mm (MMII)3.35 ± 0.021.92 ± 0.081.78 ± 0.333.42 ± 0.13t = 8.03 (P = 0.001)
GPI biosynthesis     
Glucosamine 15 mm (MMII)4.07 ± 0.093.97 ± 0.104.07 ± 0.254.25 ± 0.12t = 1.125 (ns)
image

Figure 2. Comparison of the morphology of Leptosphaeria maculans wild-type (WT) and mutant 20.4.21 isolates. (a) Macroscopic morphology of WT and m20.4.21 isolates after 2 wk of growth on V8-juice agar medium. (b) Mycelial morphology of colonies originating from a suspension of conidia of green fluorescent protein (GFP)-expressing WT isolate, m20GFPa and m20GFPb transformants as viewed following 72 h of growth between two cellophane sheets on water agar. Upper panels, magnification ×45; lower panel, magnification ×115 of the growing edge of one colony.

Download figure to PowerPoint

The T-DNA is inserted in the overlapping promoter region of two head-to-tail genes

The sequence flanking the T-DNA integration site was recovered as a 1139 bp sequence. Six positive BAC clones were obtained following the PCR-screening of the 7× v23.1.3 partial HindIII BAC library (Gout et al., 2006), of which one was chosen for subsequent subcloning into pUC18. A 4.8 kb EcoRV fragment was fully sequenced. Four ORFs (orf0, orf1, orf2 and orf3) were predicted by ORF FINDER to occur in the region (Fig. 3). The two closest ORFs from the insertion site, orf1 and orf2, were experimentally annotated for 5′ and 3′ UTR and for the presence of introns. Their initiation codons were separated by only 313 nt, suggesting that the promoters of the two genes were overlapping (Supporting Information Fig. S1a). Southern blot analysis of L. maculans genomic DNA showed that both orf1 and orf2 were present as single-copy sequences in the genome (data not shown). The T-DNA insertion led to the loss of 104 bp of genomic DNA in the intergenic region separating the transcription start point of both ORFs without any other rearrangement. The loss of genetic material did not result in any modification of the 5′ UTR of both genes (Fig. S1a). The insertion of the T-DNA occurred 99 and 110 bp upstream of the initiation codons of orf1 and orf2, respectively, which did not allow us to resolve which gene was involved in m20 phenotype (Fig. S1a).

image

Figure 3. Location of the T-DNA insertion in the Leptosphaeria maculans mutant 20 genomic DNA and conservation of syntheny with the corresponding genomic region in Stagonospora nodorum. Genomic organization of the four L. maculans genes flanking the T-DNA insertion (indicated by a black arrowhead in the upper panel) was compared with that of its four S. nodorum orthologues (lower panel). The direction of transcription of each gene is indicated and the number of amino acids (aa) of the corresponding predicted proteins is indicated between brackets. The putative function of ORF0 and ORF3 is mentioned, as well as the percentage of identity (I) and similarity (S) between L. maculans and S. nodorum predicted proteins. Intergenic distances with their corresponding number of base pair (bp) are indicated by double arrows. Homologous genes and corresponding proteins between L. maculans and S. nodorum are connected by dotted lines.

Download figure to PowerPoint

Proteins potentially encoded by orf0 and orf3 are highly conserved in eukaryotes, with orf0 encoding a putative homologue of the tRNA pseudouridine synthase 3, and orf3 encoding a putative homologue of the DIM1 protein from Schizosaccharomyces pombe (Fig. 3) (Berry & Gould, 1997). By contrast, a BLASTP search for the predicted proteins ORF1 and ORF2 failed to identify any orthologues, although ORF1 possessed a conserved C-terminal domain referred to as a ubiquitin-like modifier, also known as HUB1 in S. pombe (Wilkinson et al., 2004).

The highest degree of homology was found with corresponding genes of the closely related species Stagonospora nodorum (Fig. 3). Gene organization was similar, with smaller intergenic regions in S. nodorum than in L. maculans (Fig. 3). A short open reading frame (µorf), located 2 bp upstream of the initiation codon of orf2, was also conserved between the two promoters and encoded a putative 4-amino-acid peptide with a MIPR sequence for L. maculans and a MWIR sequence for S. nodorum (data not shown).

Gene expression studies

Gene expression of orf1, orf2 and actin were measured relative to β-tubulin expression, considering actin as an internal control (Fudal et al., 2007) (Fig. 4). In the WT isolate, the two genes were constitutively expressed at a very low level in vitro, making it difficult to establish firmly significant difference from one condition to the other. The orf1 and orf2 genes were 1000 times less expressed than actin in mycelium or in conidia germinating under nitrogen starvation, and 2000 times less expressed than actin in conidia germinating in complete medium. Following plant inoculations, orf1 and orf2 expression was detected at 3 dpi, then increased two- to threefold with a peak at 6 dpi. Expression then slowly decreased after 6 dpi to reach a level comparable to that of the in vitro expression at 12 dpi. During stem necrosis, orf1 and orf2 were also expressed at a level similar to that of in vitro expression (data not shown). Although orf1 and orf2 expression levels were slightly different from one another, expression profiles of the two genes were very similar, both in vitro and in planta, further suggesting a co-regulation of the expression of the two genes.

image

Figure 4. Real-time PCR comparison of orf1 (a) and orf2 (b) expression in the Leptosphaeria maculans wild-type (WT) and m20.4.21 isolates during in vitro growth and infection of cotyledons of Brassica napus. The following conditions were compared: myc, 3-wk-old mycelial culture in Fries complete medium; co, 36-h-old conidia germinating in Fries complete medium (F) or under nitrogen starvation (B5); 3, 6, 9, 12, oilseed rape cotyledons 3, 6, 9 and 12 d post-inoculation. Gene expression levels are relative to β-tubulin expression. (c) Actin is included to show that the calculated expression levels were not the result of variations in the β-tubulin expression. Each data point is the average of two technical repeats and of three biological repeats. Standard error of the mean normalized expression level is indicated by error bars. WT isolate, black bars; m20.4.21, grey bars.

Download figure to PowerPoint

Quantitative RT-PCR analyses in m20.4.21 mostly showed a two to five times increased expression of both genes as compared with the WT isolate in all in vitro conditions tested. By contrast, the two genes, and mostly orf2, were less expressed than in the WT isolate during plant infection, with the level of expression of orf2 being two to six times lower than that of the WT isolate at all dates. Furthermore, the increased expression observed at 6 dpi in the WT isolate was not observed in m20.4.21, suggesting orf2 expression was not induced during plant infection in m20.4.21.

Complementation of m20.4.21 by orf2 but not orf1 restores growth and pathogenicity

Functional complementation experiments were performed by transforming m20.4.21 with three different complementation constructs, each corresponding to the entire promoter region in addition to orf1 or orf2, or both genes. Twenty-five, 20 and 20 complemented transformants were recovered, respectively, and PCR analyses indicated that all the integration sites maintained the initial T-DNA insertion and were thus ectopic (data not shown). Only isolates complemented with orf2 or both orf1 and orf2 recovered the ability to induce WT symptoms on oilseed rape cotyledons and to colonize the stems (Table 1). Furthermore, these complemented isolates showed a restored growth rate and a mycelium morphology similar to those of the WT isolate (Table 1).

orf2 encodes a putative homologue of the S. cerevisiae GPI15 protein

The orf2 gene possesses one 76 bp intron and encodes a 236 aa putative protein. Hydropathy analysis revealed the presence of two potential membrane-spanning regions located at positions 48–67 and 99–116 (Fig. S1). The first 21 aa of the protein were predicted to be a signal anchor for retention in the ER, and the C-terminal region of the protein contained two ‘KKXX’ motifs (Fig. S1). A PFAM search identified a conserved domain in the C-terminal region of ORF2, homologous to a domain present in GPI15 of S. cerevisiae (26% aa identity) and the human PIG-H (24% aa identity) (Fig. S1b).

Using the functional domain of GPI15, several other orthologues could be identified within the Ascomycetes. The corresponding domain of these putative fungal proteins were aligned together with the corresponding domain of PIG-H, ORF2 and S. nodorum homologue, and compared with the S. cerevisiae domain as a reference (Fig. S1b). The putative fungal GPI15 homologues ranged between 160 and 263 aa and exhibited homology in sequence and predicted structure. These putative homologues were also predicted to contain two transmembrane domains at similar positions, and, in most cases, to possess a N-signal anchor (Fig. S1b).

Fungal mutants affected in the GPI anchor biosynthesis pathway all exhibit moderate-to-severe defects in growth and sensibility to various reagents that affect osmotic pressure and cell wall integrity (Richard et al., 2002; Sobering et al., 2004; Bowman et al., 2006). To establish whether the product of orf2 is actually involved in GPI anchor biosynthesis, we firstly examined the sensitivity and relative alteration of growth of the WT isolate and m20.4.21 on media containing compounds modifying the osmolarity, cell wall-perturbating agents or glucosamine (Table 2). Growth defects observed in m20.4.21 were partly suppressed by the osmotic stabilizer sorbitol. Moreover, m20.4.21 exhibited a strong sensitivity to high osmolarity and to various compounds that interfere in the cross-linking of cell wall components, such as SDS or Congo red (Table 2). These results suggested that the cell wall structure and function were altered in the mutant. Finally, the growth defect of m20.4.21 was partially suppressed by glucosamine, consistently with the role of N-acetylglucosamine as a substrate for GPI anchor biosynthesis (Table 2), whereas glucose alone had no effect (data not shown). Accordingly, we named the orf2 gene Lmgpi15.

The LmGPI15 protein is localized into the ER

We investigated the subcellular localization of LmGPI15 by the use of a GFP fusion protein. We firstly tried to express the Lmgpi15 transcript and then the corresponding protein under the control of the endogenous Lmgpi15 promoter, but attempts to detect GFP fluorescence in the numerous transformants obtained were unsuccessful, consistent with the low expression level of the target gene (data not shown). We thus expressed the LmGPI15-GFP fused protein under the control of the promoter of the Lmpma1 gene, a strong constitutive promoter of L. maculans (Remy et al., 2008). The fusion protein was introduced into m20.4.21, and among the 40 GFP-expressing transformants recovered, 34 recovered the ability to induce WT symptoms on oilseed rape cotyledons. Four transformants (GFP4, GFP8, GFP12 and GFP16) were selected because they strongly expressed GFP and behaved as the WT isolate for growth and pathogenicity, thus demonstrating the functionality of the hybrid protein (data not shown). Using confocal scanning laser microscopy, ER was vizualized by a specific inhibitor, Brefeldin A, which interferes with Golgi-dependent secretion and also with endosomal, post-Golgi trafficking (Satiat-Jeunemaitre et al., 1996). In L. maculans, the ER was shown to form a dense network containing brighter nodes, which extended throughout the cell, as described for Aspergillus sp. (Maruyama et al., 2006) (Fig. 5b,e). In all hyphae examined, the stained ER structures also shared a strong GFP fluorescence (Fig. 5c,f), yielding a yellow colour, suggesting that the LmGPI15-GFP-fused protein was directed to the ER network (Fig. 5d,g). In addition, strong GFP fluorescence accumulated in large vacuoles that developed in some basal cellular compartments of hyphae, and which were not stained by the ER tracker (Fig. 5a,c,f). The formation of vacuoles, originating from membrane recycling of organelles, in older or basal segments of hyphae is suggested to play a role in apical extension (Seiler et al., 1999). In this respect, the presence of LmGPI15-GFP in these vacuoles is consistent with its location within the ER membrane used as a recycled material for the formation of vacuoles.

image

Figure 5. Subcellular localization of the LmGPI15-GFP fused protein examined by confocal laser scanning microscopy. (a) Distribution of LmGPI15-GFP fluorescence at the apex and subapex of a hypha of the GFP8 transformant of m20.4.21 isolate. (b–g) Co-localization of LmGPI15-GFP with endoplasmic reticulum (ER) as revealed after staining with 5 µm Brefeldin A-bodipy 558/568 conjugate. (b, e) Bodipy 558/568 fluorescence; (c, f) GFP fluorescence; (d, g) overlay. After a short variable time (5–20 min), the dye stained the ER (arrowheads in b, e). LmGPI15-GFP fluorescence was prominent at the ER (arrowheads in c, f) and at vacuoles (arrow in c, f). Bars, 10 µm.

Download figure to PowerPoint

Silencing of Lmgpi15 expression

In order to confirm the role of LmGPI15 in pathogenicity, we first attempted to disrupt the endogenous Lmgpi15 gene in L. maculans. None of the 240 transformants recovered carried a homologous recombination event, even when large genomic fragments (> 13 kb) were employed (data not shown). We then performed Lmgpi15 silencing experiments on the WT isolate. Of 60 transformants recovered, only three were reproducibly affected in their growth and pathogenicity and were thus analysed for Lmgpi15 expression level, in addition to two unaffected transformants (Table 3). The two most severely affected, Sil25 and Sil32, induced a typical hypersensitive reaction on cotyledons, whereas Sil55, which was less affected, induced a larger dark necrotic symptom which never expanded away from the dark necrotic reaction of the plant (Table 3). These three transformants exhibited a mycelium morphology similar to that of m20.4.21 and various amounts of growth defects, with Sil25 and Sil32 exhibiting the slower growth rates (Table 3). As in the case of m20.4.21, pathogenicity and growth defects were associated with a reduced expression of Lmgpi15 at 6 dpi in planta (Table 3). Moreover, both pathogenicity and growth defects seemed to be correlated to the level of Lmgpi15 expression, as Sil55, which exhibited an intermediate phenotype between m20.4.21 and Sil25, and Sil32 also showed an intermediate level of Lmgpi15 expression (Table 3).

Table 3.  Effect of RNA interference silencing of LmGPI15 on growth and pathogenicity of Leptosphaeria maculans
IsolatesRadial growtha (%)MorphologybPathogenicity on cotyledonscExpression leveld (×103)Relative expression levele (%)
14 dpi17 dpi
  • a

    Results were expressed as the percentage of growth relative to the wild-type (WT) isolate as measured after 2 wk of growth.

  • b

    Morphology of fungal colonies growing on V8-juice agar medium was assessed visually and compared with that of the WT isolate and m20.4.21.

  • c

    Pathogenicity was assessed on cotyledons of Brassica napus cv. Westar. Data are mean disease ratings of c. 10 inoculation sites scored according to the IMASCORE scale, where 1–3 represent resistance response and 4–6 represent susceptibility symptoms.

  • d

    Lmgpi15 expression was assessed by qRT-PCR with RNA isolated from infected oilseed rape cv. Westar cotyledons at 6 dpi. Gene expression levels are relative to β-tubulin expression.

  • e

    Relative expression level compared with the WT isolate.

  • f

    Data are average values ± SD of three repeats for each isolate.

  • g

    Sil28 is a nonsilenced transformant included as a control.

Controls      
WT100.00fWT4.00 ± 0.004.00 ± 0.0011.4 ± 0.3100
m20.4.2169.56m20.4.211.00 ± 0.001.00 ± 0.001.7 ± 0.2 15
Transformans      
Sil28g100.70WT4.00 ± 0.004.00 ± 0.0010.9 ± 0.1 96
Sil5571.25m20.4.213.00 ± 0.003.00 ± 0.006.4 ± 0.4 56
Sil2537.94m20.4.211.00 ± 0.001.00 ± 0.005.6 ± 0.5 49
Sil3222.22m20.4.211.00 ± 0.001.00 ± 0.003.3 ± 0.3 33

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In this paper, we describe identification of the L. maculans orthologue of the yeast gpi15 gene and human PIG-H, termed Lmgpi15, thus providing the first report on a functional characterization of a PIG-H/GPI15 orthologue in a filamentous fungus. We further show that a deregulation of its expression has drastic effects on fungal morphogenesis, cell wall integrity and pathogenicity. The GPI anchor biosynthesis pathway has already been demonstrated to be involved in overall morphogenesis and virulence of human pathogenic fungi such as in Candida albicans and Aspergillus fumigatus (Richard et al., 2002; Li et al., 2007). Here, we report for the first time that a GPI anchor biosynthetic component-encoding gene is also instrumental in determining pathogenicity to plants, consistent with the known importance of GPI-anchored proteins in fungal virulence.

The homology of LmGPI15 with the human PIG-H and the yeast GPI15 was suggested here via bioinformatics analyses, cell biology experiments and functional studies. Bioinformatics searches for homologues and putative function were initially uninformative, with only part of a C-terminal region of LmGPI15 showing limited, but significant, homology with a domain present in GPI15 and PIG-H. However, the weak sequence similarity between organisms seems to be the rule for this gene, with 26% identity at the amino acid level between LmGPI15 and GPI15 being consistent with the low 20% identity between PIG-H and GPI15. Even when comparing LmGPI15 with homologous proteins in more closely related filamentous fungi, sequence identities only range between 38 and 46% for Neurospora crassa and Aspergillus terreus homologues, respectively, and reach 54% with the closely related species S. nodorum. This low sequence conservation probably explains why efforts to complement the inducible null mutant of gpi15 from S. cerevisiae (Yan et al., 2001) with Lmgpi15 were unsuccessful (P. Orlean, pers. comm.). This lack of cross-complementation has already been observed for some of the genes encoding other components of the GPI anchor biosynthesis pathway in unrelated species. For instance, the S. pombe and C. albicans gpi3 homologue genes were inefficient in restoring the phenotype of the corresponding S. cerevisiae mutant, whereas the fission yeast gpi1 homologue complemented the corresponding S. cerevisiae mutant (P. Orlean, pers. comm.). Whereas sequence conservation was low between all fungal GPI15 homologues, the overall topography of the proteins showed conserved features, including the presence of two transmembrane domains at a similar position and the presence of a N-signal anchor.

The GPI anchor biosynthetic pathway takes place into the ER membrane in all organisms examined so far (Orlean & Menon, 2007). In addition, PIG-A/GPI3, PIG-C/GPI2, PIG-H/GPI15 and PIG-P/GPI19 have been shown to form a complex localized in the ER membrane (Tiede et al., 2000; Newman et al., 2005). Bioinformatics analysis predicted that LmGPI15 is an ER-targeted protein. In addition, the ‘KKXX’ motif identified at the C-terminal region of LmGPI15 is common to the C-terminal region of many membrane proteins known either to reside or to cycle through the ER or the Golgi complex (Jackson et al., 1993). Cell biology experiments aiming at identifying the subcellular location of the LmGPI15 protein substantiated localization of a LmGPI15-GFP fusion protein in the ER. Additional localization of LmGPI15-GFP fluorescence in large vacuoles throughout the fungal cell could be attributed to recycling of ER material (Seiler et al., 1999), but also to a possible more rapid turnover of the fusion protein as a result of overexpression of the LmGPI15 protein under the control of the strong promoter of the Lmpma1 gene (Remy et al., 2008).

Functional studies included biological analysis of the effect of deregulation of expression as well as analysis of the effect of (bio)chemical agents known to interact with cell wall morphogenesis or used as a substrate for GPI anchor biosynthesis. The mutant was affected in its growth rate, as are most of fungal GPI-anchoring mutants thus far characterized (Richard et al., 2002; Sobering et al., 2004; Bowman et al., 2006; Li et al., 2007). Screens designed to isolate cell wall-defective fungal mutants often identify genes encoding either GPI-anchoring components or GPI-anchored proteins (Bowman et al., 2006). In this respect, the product of Lmgpi15 gene is also involved in overall morphogenesis in L. maculans. Similar morphological defects were observed in GPI anchor biosynthesis mutants of N. crassa, C. albicans and A. fumigatus (Richard et al., 2002; Bowman et al., 2006; Li et al., 2007). Additionally, the mutant possesses a weakened cell wall as compared with the WT isolate, since it exhibits an enhanced sensibility to hyperosmotic conditions. Consistent with this hypothesis, the growth defect was relieved by the osmotic stabilizer sorbitol (Sobering et al., 2004). The higher sensitivity to Congo red displayed by m20.4.21 also suggests that its cell wall integrity is affected, since this dye binds to the cell wall glucan network and disturbs the assembly of microfibrils of β-1,3-glucan (Kopeckà & Gabriel, 1992). Based on the assumption that the GPI anchor biosynthesis pathway plays a similar role as in other fungi in cell wall integrity and morphology in L. maculans, we thus propose that Lmgpi15 encodes for the functional orthologue of Scerevisiae GPI15. Consistently, addition of glucosamine to the culture medium, suggested to increase the intracellular concentration of UDP-N-acetylglucosamine, also suppressed the growth defect of the mutant. At least two GPI anchor biosynthesis mutants of S. cerevisiae have also been shown to complement growth defect with exogenous glucosamine, which assists the mutants in their effort to increase GPI-anchor production (Sobering et al., 2004; Newman et al., 2005).

Whereas intrinsic function of the altered gene could be easily established and validated, it was less clear how the T-DNA insertion affected its expression or regulation, and how the altered expression resulted in pathogenicity defects. The T-DNA was inserted in a short bidirectional promoter, which substantiates the postulate that most of the integrations take place in regulatory regions rather than within coding sequences in the genome of L. maculans (Blaise et al., 2007), as previously established for yeast, fungi and plants (Bundock et al., 2002; Michielse et al., 2005; Pan et al., 2005; Choi et al., 2007). In this respect, ATMT is a powerful tool to study the incidence of lethal genes on biological traits. gpi15 in S. cerevisiae, and more generally the GPI anchor biosynthesis pathway in S. cerevisiae and N. crassa are required for viability (Leidich et al., 1995; Yan et al., 2001; Bowman et al., 2006). In this study, both unsuccessful attempts to create a null mutant for Lmgpi15 by homologous recombination and the very low rate of silenced transformants recovered following the Lmgpi15 RNA silencing experiment (usually more efficient in L. maculans (Fudal et al., 2007; Remy et al., 2008)) could indicate that Lmgpi15 is also essential for L. maculans viability. The T-DNA integration event led to a complex deregulation of Lmgpi15 expression, thus suggesting that the T-DNA integration has modified or suppressed some still uncharacterized regulatory motifs present in the overlapping promoter region, such as those responding to environmental signals. However, promoter sequence analysis did not allow us to detect such previously characterized motifs. The apparent overexpression detected in vitro could be attributed to the very low level of expression in these conditions, thus causing ‘background noise’ in the real-time PCR analysis. In addition, overexpression of the gene under control of the strong Lmpma1 promoter did not lead to pathogenicity defects, as complementation of the mutant by the LmGPI15-GFP fusion protein restores full pathogenicity. During the infection process, the Lmgpi15 expression is significantly reduced in such a way that there is no induction of expression during the first days of plant infection. This suggests a special need for induced GPI anchor biosynthesis (either a special target or a generally high amount of GPI anchoring activity) during the first stages of tissue colonization.

On these bases, two nonexclusive effects can explain altered pathogenicity to oilseed rape in the mutant. First, slow progress of m20.4.21 and silenced transformants in host tissues, along with an altered cell wall, can lead to an increased sensitivity to plant defence reactions. Second, a fungus-specific algorithm, based on sequence characteristics of known GPI-anchored proteins from various Ascomycetes, recently revealed 66, 104, 33 and 97 putative GPI-anchored proteins in whole genome sequences of S. cerevisiae, C. albicans, S. pombe and N. crassa, respectively (De Groot et al., 2003). In these species, GPI-anchored proteins are mainly involved in cell wall biosynthesis and remodelling (Yin et al., 2005). The cell wall perturbations generated by their inactivation can in turn lead to a loss of cell wall-associated enzymatic activities. In addition, a subset of GPI-anchored proteins of Ascomycete pathogenic fungi have been reported to play a role in virulence, both in human pathogenic fungi, such as A. fumigatus (Mouyna et al., 2005) and C. albicans (Richard et al., 2002), and in phytopathogenic fungi, such as Magnaporthe grisea (Ahn et al., 2004) and Fusarium oxysporum (Caracuel et al., 2005). As GPI anchors are involved in cell wall targeting of a number of proteins, including pathogenicity determinants, failure of GPI anchoring could thus be responsible for reduced virulence as a result of a reduction of available pathogenicity determinants (De Sampaïo et al., 1999). We thus suggest that pathogenicity defects of m20 and silenced transformants can, in part, be the result of a reduced amount of cell surface or secreted proteins implicated in pathogenicity of L. maculans, in addition to cell wall and growth defects. The mutant m20 thus constitutes a unique resource for proteomic approaches aiming at comparing cell wall and secreted protein profiles between m20 and WT isolate, therefore allowing a critical assessment of GPI-anchored proteins as pathogenicity or virulence factors in L. maculans and other pathogenic fungi.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

This work was partly funded by Centre Technique des Oléagineux Métropolitains (CETIOM, Paris, France). E. Remy was funded by a fellowship from the French Ministry of Research. We thank E. Mendes-Pereira and A. Gautier (INRA-BIOGER, France) for sequencing assistance, L. Coudard (INRA-BIOGER) for plant management, J. Roux and J. P. Narcy (INRA-BIOGER) for technical assistance, O. Grandjean (INRA-IJPB, France) for his help with confocal microscopy, N. Wolff (INRA-PESSAC, France) for her help with scanning electron microscopy, K. Plummer (Horticulture and Food Research Institute, New Zealand) and B. J. Howlett (University of Melbourne, Australia) for pJK11 and pNAT1 plasmids, respectively, and Y. J. Huang (Rothamstedt Research, UK) for the GFP isolate.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Ahn N, Kim S, Choi W, Im KH, Lee YH. 2004. Extracellular matrix protein gene, EMP1, is required for appressorium formation and pathogenicity of the rice blast fungus, Magnaporthe grisea. Molecular Cell 17: 166173.
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403410.
  • Ansan-Melayah D, Balesdent MH, Buée M, Rouxel T. 1995. Genetic characterization of AvrLm1, the first avirulence gene of Leptosphaeria maculans. Phytopathology 85: 15251529.
  • Attard A, Gout L, Ross S, Parlange F, Cattolico L, Balesdent MH, Rouxel T. 2005. Truncated and RIP-degenerated copies of the LTR retrotransposon Pholy are clustered in a pericentromeric region of the Leptosphaeria maculans genome. Fungal Genetics and Biology 42: 3041.
  • Balesdent MH, Attard A, Ansan-Melayah D, Delourme R, Renard M, Rouxel T. 2001. Genetic control and host range of avirulence toward Brassica napus cultivars Quinta and Jet Neuf in Leptosphaeria maculans. Phytopathology 91: 7076.
  • Balesdent MH, Jedryczka M, Jain L, Mendes-Pereira E, Bertrandy J, Rouxel T. 1998. Conidia as a substrate for internal transcribed spacer-based PCR identification of members of the Leptosphaeria maculans species complex. Phytopathology 88: 12101217.
  • Balzergue S, Dubreucq B, Chauvin S, Le-Clainche I, Le Boulaire F, De Rose R, Samson F, Biaudet V, Lecharny A, Cruaud C et al . 2001. Improved PCR-walking for large scale isolation of plant T-DNA borders. BioTechniques 30: 496504.
  • Berry LD, Gould KL. 1997. Fission yeast dim1(+) encodes a functionally conserved polypeptide essential for mitosis. The Journal of Cell Biology 137: 13371354.
  • Blaise F, Remy E, Meyer M, Zhou L, Narcy JP, Roux J, Balesdent MH, Rouxel T. 2007. A critical assessment of Agrobacterium tumefaciens-mediated transformation as a tool for pathogenicity gene discovery in the phytopathogenic fungus Leptosphaeria maculans. Fungal Genetics and Biology 44: 123138.
  • Bowman SM, Piwowar A, Al Dabbous M, Vierula J, Free SJ. 2006. Mutational analysis of the glycosylphosphatidylinositol (GPI) anchor pathway demonstrates that GPI-anchored proteins are required for cell wall biogenesis and normal hyphal growth in Neurospora crassa. Eukaryotic Cell 5: 587600.
  • Bundock P, Van Attikum H, Den Dulk-Ras A, Hooykaas PJJ. 2002. Insertional mutagenesis in yeasts using Agrobacterium tumefaciens. Yeast 19: 529536.
  • Caracuel Z, Martinez-Rocha AL, Di Pietro A, Madrid MP, Roncero MI 2005. Fusarium oxysporum gas1 encodes a putative beta-1,3-glucanosyltransferase required for virulence on tomato plants. Molecular Plant–Microbe Interactions 18: 11401147.
  • Choi J, Park J, Jeon J, Chi MH, Goh MH, Yoo SY, Park J, Jung K, Kim H, Park SY et al . 2007. Genome-wide analysis of T-DNA integration into the chromosomes of Magnaporthe grisea. Molecular Microbiology 66: 371382.
  • De Groot PW, Hellingwerf KJ, Klis FM. 2003. Genome-wide identification of fungal GPI proteins. Yeast 20: 781796.
  • De Sampaïo G, Bourdineaud JP, Lauquin GJ. 1999. A constitutive role for GPI anchors in Saccharomyces cerevisiae: cell wall targeting. Molecular Microbiology 34: 247256.
  • Elliott CE, Howlett BJ. 2006. Overexpression of a 3-ketoacyl-CoA thiolase in Leptosphaeria maculans causes reduced pathogenicity on Brassica napus. Molecular Plant–Microbe Interactions 19: 588596.
  • Fitt BD, Brun H, Barbetti MJ, Rimmer SR. 2006. Worldwilde importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). European Journal of Plant Pathology 114: 315.
  • Fitzgerald A, Van Kan JAL, Plummer KM. 2004. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats. Fungal Genetics and Biology 41: 963971.
  • Fudal I, Ross S, Gout L, Blaise F, Kuhn ML, Eckert MR, Cattolico L, Bernard-Samain S, Balesdent MH, Rouxel T. 2007. Heterochromatin-like regions as ecological niches for avirulence genes in the Leptosphaeria maculans genome: map-based cloning of AvrLm6. Molecular Plant–Microbe Interactions 20: 459470.
  • Gall C, Balesdent MH, Robin P, Rouxel T. 1994. Tetrad analysis of acid phosphatase, soluble protein patterns, and mating type in Leptosphaeria maculans. Phytopathology 84: 12991305.
  • Gardiner DM, Jarvis RS, Howlett BJ. 2005. The ABC transporter gene in the sirodesmin biosynthetic gene cluster of Leptosphaeria maculans is not essential for sirodesmin production but facilitates self-protection. Fungal Genetics and Biology 42: 257263.
  • Gout L, Fudal I, Kuhn ML, Blaise F, Eckert M, Cattolico L, Balesdent MH, Rouxel T. 2006. Lost in the middle of nowhere: the AvrLm1 avirulence gene of the dothideomycete Leptosphaeria maculans. Molecular Microbiology 60: 6780.
  • Hammond KE, Lewis BG. 1986. Ultrastructural studies of the limitation of lesions caused by Leptosphaeria maculans in stems of Brassica napus var. oleifera. Physiological and Molecular Plant Pathology 28: 251265.
  • Hickey PC, Swift SM, Roca MG, Read ND. 2005. Live-cell imaging of filamentous fungi using vital fluorescent dyes. Methods in Microbiology 34: 6387.
  • Huang X, Madan A. 1999. CAP3: a cDNA sequence assembly program. Genome Research 9: 868877.
  • Huang YJ, Evans N, Li ZQ, Eckert M, Chevre AM, Renard M, Fitt BD. 2006. Temperature and leaf wetness duration affect phenotypic expression of Rlm6-mediated resistance to Leptosphaeria maculans in Brassica napus. New Phytologist 170: 129141.
  • Idnurm A, Howlett BJ. 2002. Isocitrate lyase is essential for pathogenicity of the fungus Leptosphaeria maculans to canola (Brassica napus). Eukaryotic Cell 1: 719724.
  • Idnurm A, Howlett BJ. 2003. Analysis of loss of pathogenicity mutants reveals that repeat-induced point mutations can occur in the Dothideomycete Leptosphaeria maculans. Fungal Genetics and Biology 39: 3137.
  • Inoue N, Watanabe R, Takeda J, Kinoshita T. 1996. PIG-C, one of the three human genes involved in the first step of glycosylphosphatidylinositol biosynthesis is a homologue of Saccharomyces cerevisiae GPI2. Biochemical and Biophysical Research Communications 226: 193199.
  • Jackson MR, Nilsson T, Peterson PA. 1993. Retrieval of transmembrane proteins to the endoplasmic reticulum. The Journal of Cell Biology 121: 317333.
  • Kamitani T, Menon AK, Hallaq Y, Warren CD, Yeh ETH. 1993. Correction of the Class H defect in glycosylphosphatidylinositol anchor biosynthesis in Ltk- cells by a human cDNA clone. Journal of Biological Chemistry 268: 2073320736.
  • Keogh RC, Deverall BJ, McLeod S. 1980. Comparison of histological and physiological-responses to Phakopsora pachyrhizi in resistant and susceptible soybean. Transactions of the British Mycological Society 74: 329333.
  • Kopeckà M, Gabriel M. 1992. The influence of Congo red on the cell wall and (1,3)-β-D-glucan microfibril biogenesis in Saccharomyces cerevisae. Archae Microbiology 158: 115126.
  • Krogh A, Larsson B, Von Heijne G, Sonnhammer EL. 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of Molecular Biology 305: 567580.
  • Leidich SD, Kostova Z, Latek RR, Costello LC, Drapp DA, Gray W, Fassler JS, Orlean P. 1995. Temperature-sensitive yeast GPI anchoring mutants gpi2 and gpi3 are defective in the synthesis of N-acetylglucosaminyl phosphatidylinositol. Cloning of the GPI2 gene. Journal of Biological Chemistry 270: 1302913035.
  • Leidich SD, Orlean P. 1996. Gpi1, a Saccharomyces cerevisiae protein that participates in the first step in glycosylphosphatidylinositol anchor synthesis. Journal of Biological Chemistry 271: 2782927837.
  • Li H, Zhou H, Luo Y, Ouyang H, Hu H, Jin C. 2007. Glycosylphosphatidylinositol (GPI) anchor is required in Aspergillus fumigatus for morphogenesis and virulence. Molecular Microbiology 64: 10141027.
  • Maruyama J, Kikuchi S, Kitamoto K. 2006. Differential distribution of the endoplasmic reticulum network as visualized by the BipA-EGFP fusion protein in hyphal compartments across the septum of the filamentous fungus, Aspergillus oryzae. Fungal Genetics and Biology 43: 642654.
  • Michielse CB, Hooykaas PJ, Van Den Hondel CA, Ram AF. 2005. Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Current Genetics 48: 117.
  • Miyata T, Takeda J, Iida Y, Yamada N, Inoue N, Takahashi M, Maeda K, Kitani K, Kinoshita T. 1993. The cloning of PIG-A, a component of the early step of GPI-anchor biosynthesis. Science 259: 13181320.
  • Mouyna I, Morelle W, Val M, Monod M, Léchenne B, Fontaine T, Beauvais A, Sarfati J, Prévost MC, Henry C, Latgé JP. 2005. Deletion of GEL2 encoding for a β(1-3)glucanosyltransferase affects morphogenesis and virulence in Aspergillus fumigatus. Molecular Microbiology 56: 16751688.
  • Muller PY, Janovjak H, Miserez AR, Dobbie Z. 2002. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32: 13721378.
  • Murakami Y, Siripanyaphinyo U, Hong Y, Tashima Y, Maeda Y, Kinoshita T. 2005. The initial enzyme for glycosylphosphatidylinositol biosynthesis requires PIG-Y, a seventh component. Molecular Biology of the Cell 16: 52365246.
  • Newman HA, Romeo MJ, Lewis SE, Yan BC, Orlean P, Levin DE. 2005. Gpi19, the Saccharomyces cerevisiae homologue of mammalian PIG-P, is a subunit of the initial enzyme for glycosylphosphatidylinositol anchor biosynthesis. Eukaryotic Cell 4: 18011807.
  • Nicholas KB, Nicholas JHB. 1997. GeneDoc: a tool for editing and annotating multiple sequence alignments. Distributed by the authors.
  • Nielsen H, Engelbrecht J, Brunak S, Von Heijne G. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 16.
  • Orlean P, Menon AK 2007. GPI anchoring of protein in yeast and mammalian cells or: how we learned to stop worrying and love glycophospholipids. Journal of Lipid Research 48: 9931011.
  • Pan X, Li Y, Stein L. 2005. Site preferences of insertional mutagenesis agents in Arabidopsis. Plant Physiology 137: 168175.
  • Pontecorvo G, Roper JA, Hemmons LM, MacDonald KD, Bufton AW. 1953. The genetics of Aspergillus nidulans. Advanced Genetics 5: 141238.
  • Remy E, Meyer M, Blaise F, Chobirand M, Wolff N, Balesdent MH, Rouxel T. 2008. The Lmpma1 gene of Leposphaeria maculans encodes a plasma membrane H+-ATPase isoform essential for pathogenicity towards oilseed rape. Fungal Genetics and Biology, doi: 10.1016/j.fgb.2008.04.008
  • Richard M, Ibata-Ombetta S, Dromer F, Bordon-Pallier F, Jouault T, Gaillardin C. 2002. Complete glycosylphosphatidylinositol anchors are required in Candida albicans for full morphogenesis, virulence and resistance to macrophages. Molecular Microbiology 44: 841853.
  • Rombel IT, Sykes KF, Rayner S, Johnston SA 2002. ORF-FINDER: a vector for high throughput gene identification. Gene 282: 3341.
  • Rouxel T, Balesdent MH. 2005. The stem canker (blackleg) fungus, Leptosphaeria maculans, enters the genomic era. Molecular Plant Pathology 6: 225241.
  • Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn . Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press.
  • Satiat-Jeunemaitre B, Cole L, Bourett T, Howard R, Hawes C. 1996. Brefeldin A effects in plant and fungal cells: something new about vesicle trafficking? Journal of Microscopy 181: 162177.
  • Schönbächler M, Horvath A, Frassler J, Riezman H. 1995. The yeast spt14 gene is homologous to the human PIG-A gene and is required for GPI anchor synthesis. The EMBO Journal 14: 16371645.
  • Seiler S, Plamann M, Schliwa M. 1999. Kinesin and dynein mutants provide novel insights into the roles of vesicle traffic during cell morphogenesis in Neurospora. Current Biology 9: 779795.
  • Sobering AK, Watanabe R, Romeo MJ, Yan BC, Specht CA, Orlean P, Riezman H, Levin DE. 2004. Yeast Ras regulates the complex that catalyses the first step in GPI-anchor biosynthesis at the ER. Cell 117: 637648.
  • Sonnhammer ELL, Eddy SR, Birney SR, Bateman A, Durbin R. 1998. Pfam: multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Research 26: 320322.
  • Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 46734680.
  • Tiede A, Daniels RJ, Higgs DR, Mehrein Y, Schmidt RE, Schubert J. 2001. The human GPI1 gene is required for efficient glycosylphosphatidylinositol biosynthesis. Gene 271: 247254.
  • Tiede A, Nischan C, Schubert J, Schmidt RE. 2000. Characterization of the enzymatic complex for the first step in glycosylphosphatidylinositol biosynthesis. The International Journal of Biochemistry & Cell Biology 32: 339350.
  • Watanabe R, Murakami Y, Marmor MD, Inoue N, Maeda Y, Hino J, Kangawa K, Julius M, Kinoshita T. 2000. Initial enzyme for glycosylphosphatidylinositol biosynthesis requires PIG-P and is regulated by DPM2. The EMBO Journal 19: 44024411.
  • Wilkinson CRM, Dittmar GAG, Ohi MD, Uetz P, Jones N. 2004. Ubiquitin-like protein Hub1 is required for pre-mRNA splicing and localization of an essential splicing factor in fission yeast. Current Biology 14: 22832288.
  • Yan BC, Westfall A, Orlean P. 2001. Ynl038wp (Gpi15p) is the Saccharomyces cerevisiae homologue of human Pig-Hp and participates in the first step in glycosylphosphatidylinositol assembly. Yeast 18: 13831389.
  • Yin QY, De Groot PWJ, Dekker HL, De Jong L, Klis FM, De Koster CG. 2005. Comprehensive proteomic analysis of Saccharomyces cerevisiae cell walls. Journal of Biological Chemistry 290: 20 89420 901.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1 (a) Nucleotide sequence of the 2080 nt region encompassing the T-DNA insertion and amino acid sequences of the corresponding predicted proteins, ORF1 and ORF2. (b) Alignment of the amino acid sequences of the human PIG-H, Saccharomyces cerevisiae GPI15 and their putative fungal orthologues.

Please note: Blackwell Publishing are not responsible for the content or functionality of any Supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

FilenameFormatSizeDescription
NPH_2522_sm_legend to Fig S1.doc26KSupporting info item
NPH_2522_sm_Fig S1.pdf130KSupporting info item