SEARCH

SEARCH BY CITATION

Keywords:

  • arbuscular mycorrhizal fungi;
  • gene expression;
  • Glomus;
  • growth depression;
  • Hordeum vulgare (barley);
  • phosphate transporter;
  • phosphate uptake

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • • 
    Here, we used phosphorus-32 (32P) labelling in compartmented pots combined with quantitative real-time polymerase chain reaction (PCR) analysis of phosphate (Pi) transporter gene expression to investigate regulation of Pi uptake pathways in barley (Hordeum vulgare), an arbuscular mycorrhizal (AM) plant that does not show strong positive growth responses to colonization.
  • • 
    Barley was colonized well by Glomus intraradices and poorly by Glomus geosporum, but both fungi induced significant and similar growth depressions compared with nonmycorrhizal controls. The lack of correlation between per cent colonization and extent of growth depression suggests that the latter is not related to carbon drain to the fungus
  • • 
    The contribution of the AM Pi uptake pathway for the two fungi was, in general, related to per cent colonization and expression of the AM-inducible Pi transporter gene, HvPT8, but not to plant responsiveness. Glomus intraradices contributed 48% of total plant P whereas G. geosporum contributed very little.
  • • 
    The growth depression in plants where the AM uptake pathway was functional suggests that the contribution of the direct Pi uptake pathway via root hairs and epidermis was decreased. This decrease was not correlated with downregulation of the epidermal-expressed Pi transporter genes, HvPT1 and HvPT2. We hypothesize post-transcriptional or post-translational control of this transport process by AM colonization.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Arbuscular mycorrhizal (AM) symbioses are ancient and widespread, occurring in both natural and agronomic plant ecosystems. The symbioses are often considered to be mutualistic. The AM fungi are obligate symbionts dependent upon carbon (C) supplied by the plant host and, in exchange, provide the plant with mineral nutrients from the soil, in particular phosphate (Pi). However, plant responses to AM colonization are highly variable. While some plant species demonstrate considerable increases in growth and Pi uptake upon AM colonization, there are also species that demonstrate negligible or even negative growth responses. Such species have been identified in a wide variety of plant families, including both natural and agricultural species (Tawaraya, 2003). Here we call them ‘nonresponsive’ to denote lack of positive response in terms of plant phosphorus (P) and growth, while recognizing that other responses to colonization may exist. The cereals wheat (Triticum aestivum) and barley (Hordeum vulgare) are considered to be nonresponsive. Nevertheless, colonization under field conditions has been consistently reported (Jensen & Jakobsen, 1980; Graham & Abbott, 2000; Aliasgharzadeh et al., 2001; Li, 2005; Grace, 2008). It has been proposed that agricultural crops represent a great potential for improvement of growth and yield responses and/or reduction of inputs such as P fertilizer via manipulation of AM symbioses (Grace et al., 2008; Sawers et al., 2008). However, a better understanding of the interaction, particularly in nonresponsive plants, is necessary to realize this potential.

Growth depressions resulting from AM colonization are conventionally attributed to C loss to the fungal symbiont with no subsequent gain in fitness from increased access to plant nutrients (Stribley et al., 1980; Graham & Abbott, 2000). Indeed, fungal C demand has been estimated to be as high as 15–20% of plant photosynthates (Jakobsen & Rosendahl, 1990; Wright et al., 1998). However, such ‘demand’ will only be a net C drain if there are no compensatory processes, such as decreased exudation of organic C, or reduced root to shoot weight ratios in AM plants (Johnson et al., 1997). Recently, Li et al. (2008) questioned the validity of applying the ‘C demand’ analysis universally in all nonresponsive AM interactions. In wheat colonized by either of two AM fungi, an equivalent growth depression was observed despite distinct differences in the C demand, as measured by per cent AM colonization in roots and hyphal length density in soil. Similar observations have been reported previously (Hetrick et al., 1992), but have thus far received little attention. Li et al. (2008) hypothesized that regulation of Pi uptake rather than C demand may explain such growth depressions. They postulated that the suppression of plant Pi uptake pathways with no net gain via fungal uptake pathways will result in lower overall Pi uptake and hence plant growth depressions.

Arbuscular mycorrhizal plants have two pathways for uptake of Pi from the soil solution. Direct Pi uptake occurs via the root epidermis and root hairs, whereas in the AM pathway Pi is taken up by external AM hyphae and transported to intracellular symbiotic interfaces within colonized root cortical cells. Previous assumptions that plant and fungal uptake pathways were additive in their contribution to plant nutrient accumulation led to the conclusion that the AM Pi uptake pathway is nonfunctional in AM plants, which do not accumulate additional P compared with nonmycorrhizal (NM) controls (i.e. nonresponsive plants). However, this simplistic notion has been largely overturned by methodologies that enable quantification of the actual contribution of the AM pathway. Using 33P labelling and compartmented pot systems, Smith et al. (2003, 2004) calculated a 100% contribution of Glomus intraradices to both flax (Linum usitatissimum), which showed a positive mycorrhizal growth response, and tomato (Solanum lycopersicum; formerly Lycopersicon esculentum), which showed a growth depression. Using a similar calculation for wheat, the AM Pi uptake pathway contributed 80% of plant P, but there was no difference in growth or P content between AM and NM plants (Li et al., 2006). While demonstrating that the AM uptake pathway is functional in nonresponsive plants, these data also indicate that P inflow via the direct uptake pathway can be reduced.

The plant transporters involved in Pi uptake via both direct and AM pathways are Pi : H+ symporters of the Pht1 family (Bucher et al., 2001; Smith, 2002; Bucher, 2007). In the direct uptake pathway genes encoding Pht1 transporters are expressed primarily in the root epidermis and root hairs (Leggewie et al., 1997; Daram et al., 1998; Liu et al., 1998a; Chiou et al., 2001; Mudge et al., 2002). Schunmann et al. (2004) showed that HvPT1 (HORvu;Pht1;1) and HvPT2 (HORvu;Pht1;2) of barley are strongly and specifically expressed in trichoblast cells of the root epidermis and in root vascular tissue. This expression pattern suggests a role in both Pi uptake from the soil and loading into the vascular system. Studies on the uptake activity of HvPT1 demonstrated high-affinity transport activity with a Km of 9.06 µm (Rae et al., 2003), consistent with a role in the accumulation of Pi from the very low concentrations in soil solution (typically < 10 µm) (Bieleski, 1973). Genes of the Pht1 family involved in the AM uptake pathway are upregulated in AM roots. Their products have been localized to the periarbuscular membrane of colonized cortical cells where they are involved in the acquisition of Pi released by the fungus at this symbiotic interface (Rausch et al., 2001; Harrison et al., 2002; Karandashov & Bucher, 2005). Such AM-inducible Pht1 transporter genes have also been observed in cereals and include HvPT8 (HORvu;Pht1;8) in barley (Paszkowski et al., 2002; Glassop et al., 2005, 2007; Guimil et al., 2005; Nagy et al., 2006).

The Pi transporter genes encoding proteins involved in the direct uptake pathway are downregulated under high P conditions and are responsive to the overall P status of the plant (Muchhal et al., 1996; Leggewie et al., 1997; Smith et al., 1997; Liu et al., 1998a,b; Rausch & Bucher, 2002; Schunmann et al., 2004). Concurrent changes in transcript abundance and protein levels indicate that regulation of these transporters is primarily transcriptional (Muchhal & Raghothama, 1999; Chiou et al., 2001). In AM plants, downregulation of Pi transporter gene expression has also been observed in response to colonization. In positively-responsive Medicago truncatula, the expression of the root epidermal Pi transporter genes, MtPT1 (MEDtr;Pht1;1) and MtPT2 (MEDtr;Pht1;2), decreased with increasing AM colonization (Liu et al., 1998b). Downregulation of MtPT2 varied with AM fungal species and it was suggested that this response is primarily a function of the improved P status of the plant (Burleigh et al., 2002). However, down-regulation of Pi transporter genes has also been observed in nonresponsive AM hosts, which do not show increases in tissue P concentrations. In nonresponsive rice (Oryza sativa), six of ten root-expressed Pi transporter genes were downregulated on AM colonization (Paszkowski et al., 2002). In barley, HvPT1 and HvPT2 were down-regulated in AM roots despite similar shoot and root P concentrations (Glassop et al., 2005). In contrast to data from responsive Medicago, these results suggest an AM-specific signalling pathway involved in downregulation of root-expressed Pi transporter genes that is independent of the P response pathways in the plant.

Overall, the data for transporter gene expression are consistent with the finding that P inflow via the direct pathway is reduced in nonresponsive AM plants where the AM Pi uptake pathway is functioning. In the present study, we used a combined physiological and molecular approach to further investigate the link between the contribution of the AM Pi uptake pathway and the expression of Pi transporter genes in the nonresponsive AM host, barley, in association with two AM fungi that differ significantly in colonization of the plant.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Plant growth conditions

Seeds of H. vulgare L. (barley) cv. Golden Promise were surface-sterilized in 4% sodium hypochlorite for 10 min, rinsed thoroughly and germinated on moist filter paper for 4 d before planting singly in experimental pots. Plants were grown in an autoclaved soil–sand mixture consisting of 10% soil (fine sandy loam) obtained from Mallala, South Australia, and 90% fine quartz sand. The resulting substrate had a resin-extractable P content of 1.3 mg kg−1 (Kouno et al., 1995) and pH(CaCl2) 7.4. Mineral nutrients were mixed thoroughly into the 1:9 soil–sand mix at the following rates (mg kg−1 dry soil); NH4NO3, 85.7; CaCl2.2H2O, 75.0; K2SO4, 75.0; MgSO4.7H2O, 45.0; MnSO4.H2O, 10.5; ZnSO4.7H2O, 5.4; CuSO4.5H2O, 2.1; CoSO4.7H2O, 0.39; NaMoO4.2H2O, 0.18. Phosphorus was added as CaHPO4 with thorough mixing at either 25 mg kg−1 (P1) or 50 mg kg−1 (P2), providing an additional 5.7 or 11.4 mg resin-extractable P kg−1, respectively. Experimental pots received 1400 g of this growth medium. Experiments were conducted under Osram 1000 W growth lights in a glasshouse with semi-controlled conditions on the Waite Campus of the University of Adelaide, South Australia. The light intensity ranged from 400 to 900 µmol m−2 s−1 depending on weather conditions. The average daytime temperature in the glasshouse ranged from 22 to 30°C. Pots were watered to 10% w : w with reverse osmosis water every 2 d.

Production of AM fungal inoculum

Inoculum of either Glomus geosporum (Nicolson & Gerdemann) Walker (BEG154) or Glomus intraradices Schenck & Smith (DAOM181602) was propagated on Allium porrum L. (leek) in the same soil–sand mix without additional P. The degree of colonization of leeks was high for both fungi (> 50%) and the presence of spores was confirmed by sieving. Soil for mycorrhizal pots was inoculated by mixing dry soil from these pot cultures containing hyphae, spores and colonised root fragments at a rate of 15% (w : w) into the growth medium. Soil for NM control pots did not receive any additional amendments.

Experimental design

There were two experiments. Experiment 1 investigated the AM response of barley during a time-course. There were three AM fungal treatments – NM or inoculated with G. geosporum or G. intraradices– one P treatment (P1 as described earlier) and harvests at 2, 4 and 6 wk. There were three replicate pots per treatment. An additional 30 mg N was applied as NH4NO3 between the harvests at 4 wk and 6 wk. Experiment 2 investigated the actual contribution of the AM pathway to P uptake. The experiment had three AM fungal treatments; NM or inoculated with G. geosporum or G. intraradices, and two P treatments (P1 or P2) as described above. There were five replicates per treatment. P application rates were selected to ensure that NM and AM plants could be matched for tissue P concentration. Plants were grown for 5 wk in a compartmented pot system comprising a small hyphal compartment (HC) within a second larger root + hyphal compartment (RHC), as described previously (Smith et al., 2003, 2004). The HC was a small plastic vial filled with 40 g NM growth medium, labelled with carrier-free H332PO4 to provide 19.8 kBq g−1 and topped up with 14 g nonlabelled NM growth medium as a buffer zone to prevent 32P uptake by root hairs and diffusion of 32P out of the HC. The open end of the HC was capped with a 30 µm mesh which restricted access to AM hyphae only. The HC was placed 5 cm below the rim of the pot with the mesh facing inwards and the pot was filled with 1349 g growth medium. In total, experimental pots contained 1403 g growth medium of which 3.8% was contained in the HC. The AM inoculum was only added to the RHC of mycorrhizal pots. The appearance of 32P in the shoots was followed nonquantitatively with a hand-held Geiger counter, and an additional 10 mg N as NH4NO3 was applied to the RHC three times during the final 2 wk of growth.

Harvest and sampling

At harvest, shoots were removed and the total fresh weight was recorded. Roots were gently washed free from soil, blotted, weighed and a random subsample was taken for AM colonization or, in Experiment 2 only, gene expression. Shoots and remaining root material were oven-dried (24 h, 80°C). In Experiment 2, soil from the RHC or HC was mixed thoroughly and sampled for determination of plant-available P.

Tissue and soil P concentrations and scintillation counting

The P concentration and content of dried shoot or root material was determined by digestion in nitric–perchloric acid (6 : 1) and measured colorimetrically by the phosphovanado-molybdate method (Hanson, 1950). Plant-available P in soil samples was determined by the resin extraction method (Kouno et al., 1995) with omission of the steps related to fumigation-extraction with chloroform. Anion-exchange resin membranes (#55164) were obtained from BDH Laboratory supplies (Poole, UK). The concentration of P in soil extracts was measured colorimetrically (Murphy & Riley, 1962). In Experiment 2, the activity of 32P in plant tissue digests or soil extracts was measured by Cerenkov 32P counting in a LKB 1215 Rackbeta II liquid scintillation counter (LKB, Mt Waverley, Australia) and corrected for isotopic decay.

AM colonization

Root samples for determination of AM colonization were cleared (10% KOH, 70°C, 15 min; 0.1 m HCl, room temperature, 5 min) (Phillips & Hayman, 1970) and stained in 5% Schaeffer black ink in white vinegar (G. intraradices 70°C, 1 h; G. geosporum 70°C, 2.5 h) (Vierheilig et al., 1998). The percentage root length colonized, and frequency of arbuscules and vesicles in colonized segments was determined according to McGonigle et al. (1990).

Calculations

The mycorrhizal growth response (MGR) (Baon et al., 1993) and mycorrhizal P response (MPR) (Li et al., 2008) were quantified in order to compare plant responses associated with AM colonization by the two fungi. Both MGR and MPR were calculated according to Eqn 1 where MR is mycorrhizal response (i.e. MGR or MPR) and AM and NM refer to either dry matter or total plant P, respectively.

  • image(Eqn 1)

The 32P specific activity (SA) of soil or plant tissue extracts was calculated by dividing the 32P activity by the total P content of the extract. The contribution of the AM pathway to plant Pi uptake was calculated from the SA of 32P in shoots and HC soil and the plant-available P in the RHC and HC according to Eqn 2. The use of shoot SA rather than the whole plant SA avoids overestimation of hyphal P transfer by inclusion of 32P retained in the intraradical hyphae.

  • image(Eqn 2)

This calculation assumes that: (1) hyphal length density is equal in the RHC and HC and that hyphae access P equally in the two compartments; (2) that colonization is rapidly established and that AM fungi rapidly penetrate the HC. Hyphal length density was not obtained in this experiment.

Real-time quantitative polymerase chain reaction

Total RNA was extracted from roots of four replicates per treatment with the RNeasy Plant mini kit (Qiagen, Doncaster, Australia) and treated with DNase I using the Ambion DNA-free kit (Applied Biosystems, Scoresby, Australia) to remove contaminating genomic DNA. cDNA synthesis was performed according to the coapplication-reverse transcription method of Zhu & Altmann (2005). This strategy combines an 18s rRNA specific primer with an oligo(dT) primer in the reverse transcription reaction, allowing for 18s to be used as a control gene. Ribosomal RNA was selected as the real-time quantitative PCR (Q PCR) control following preliminary investigations in which the expression of various house-keeping genes was found to vary with AM fungal treatment. The cDNA synthesis reaction was performed on 1 µg of purified RNA using oligo(dT) primer (2.5 µm), Hv18s RNA reverse primer (0.2 µm) and a Superscript III First Strand Synthesis kit (Invitrogen, Mount Waverley, Australia). The Q PCR analysis was performed essentially as described previously by Burton et al. (2004). Transcript levels of HvPT1 (GenBank Accession No. AF543197), HvPT2 (AF187019) and HvPT8 (AY187023) were monitored and normalized according to expression of the barley 18s RNA control gene (AK251731). The primers used in this study were: HvPT1 forward 5′ CGATGATGGCATCGATGCTTA and reverse 5′ GCACCATCAGAAAATTGCAATCTC; HvPT2-forward 5′ GAGCTCTCCAAGGAGAACGTTG and reverse 5′ AATTACAGCAACAAAACAAGCCG; HvPT8-forward 5′ GGCAGCAACGAGGTGAAAAGTG and reverse 5′ CTGTTTGAACGTAGGCTGTGCG; and 18S-forward 5′ CAGTTATAGTTTGTTTGATGGTACGTG andreverse 5′ TCATGAATCATCGGATCAGC. Data are presented as normalized transcript copies per µl of cDNA.

Statistical analysis

Data were analysed by two-way analysis of variance (anova) using genstat 8th Edition (Lawes Agricultural Trust, Rothamsted Experimental Station, Harpenden, UK). Significant differences between means were tested using a post-hoc Tukey test at P < 0.05.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Experiment 1: AM colonization

No colonization was observed in NM control plants. In plants inoculated with AM fungi, colonization increased over the 6-wk growth period to 19% in roots colonized by G. geosporum and 72% in those colonized by G. intraradices (Table 1). Total colonization for G. geosporum was significantly lower than G. intraradices at all three harvests. Both AM species formed Arum-type colonization structures with intercellular hyphae and normal arbuscules, and there was no difference in the proportion of colonized roots, which contained arbuscules (Table 1). Vesicles, lipid-rich storage structures, were only observed once in roots colonized by G. geosporum, whereas vesicles were observed with increasing frequency at each harvest in roots colonised by G. intraradices.

Table 1.  Experiment 1: arbuscular mycorrhizal (AM) colonization, growth and phosphorus (P) response of barley (Hordeum vulgare) inoculated with Glomus geosporum, Glomus intraradices or nonmycorrhizal and grown for 2, 4 or 6 wk at P1 (5.7 mg kg−1 additional P)
AM treatmentHarvest (wk)% ColonizationTotal DW1 (g per plant)MGR2 (%)P content1 (mg per plant)MPR2 (%)
Total1Arbuscular1Vesicular1
  • Colonization data presented as total percentage root length colonized and percentage of total colonization as arbuscular colonization or vesicular colonization.

  • 1

    Values are means ± SEM of three replicates. Values with the same letter in each column are not significantly different (P < 0.05).

  • 2

    Mycorrhizal response (MGR, mycorrhizal growth response; MPR, mycorrhizal P response) calculated from DW or P content according to Eqn 1; MR = (AM − NM)/NM × 100.

  • *

    *Values not significantly different from zero.

Nonmycorrhizal20.4 ± 0.08a0.8 ± 0.1a
46.9 ± 0.56d7.9 ± 0.5c
68.7 ± 0.30e9.8 ± 0.3d
Glomus geosporum23 ± 2a50 ± 19a0a0.3 ± 0.03a−21*0.8 ± 0.2a −4*
42 ± 0.3a56 ± 22a0a3.8 ± 0.20b−455.2 ± 0.5b−35
619 ± 6b38 ± 13a1 ± 2a5.8 ± 0.65cd−345.8 ± 0.1b−41
Glomus intraradices257 ± 2c64 ± 3a8 ± 2ab0.3 ± 0.07a−17*0.8 ± 0.1a −4*
461 ± 5cd62 ± 10a15 ± 5b4.5 ± 0.38bc−365.1 ± 0.6b−35
672 ± 4d78 ± 2a26 ± 3c5.6 ± 0.44cd−365.8 ± 0.2b−40

Growth and P response  There were no significant differences in growth at the 2 wk harvest among the treatments (Table 1). At the 4 wk and 6 wk harvests, growth of AM plants was similar regardless of AM fungal species, but was significantly reduced compared with NM control plants. The mean MGR at the 4 wk and 6 wk harvests was −41% and −35%, respectively (Table 1). Shoot and root P concentrations decreased over time, and there was no significant difference between AM and NM plants at any harvest (data not shown). Total P content of barley plants mirrored the pattern observed for growth at all three harvests, with AM plants taking up significantly less P than NM plants at both the 4 wk and 6 wk harvests and no difference between AM treatments (Table 1). The mean MPR for both the 4 wk and 6 wk harvests was −38%. The strong correlation between plant growth and P uptake is illustrated in Fig. 1 (y = 1.03x + 0.38, R2 = 0.92); this demonstrates that plant P concentrations (mg P g−1 DW) were quite similar throughout.

image

Figure 1. Experiments 1 and 2: relationship between total dry weight (DW) and phosphorus (P) content of barley (Hordeum vulgare) inoculated with Glomus geosporum (squares), Glomus intraradices (triangles) or without inoculation (circles). Data from both Experiments 1 and 2 are included; Experiment 1 (closed symbols), plants were grown for 2, 4, or 6 wk at P1 (5.7 mg kg−1 additional P); Experiment 2 (open symbols), plants were grown for 5 wk at either P1 or P2 (11.4 mg kg−1 additional P).

Download figure to PowerPoint

Experiment 2: AM colonization

No colonization was observed in NM control plants. As observed in Experiment 1, there was a significant difference in the degree of colonization achieved by G. geosporum and G. intraradices (Table 2). Colonization by G. geosporum was minimal, reaching only 2–4% regardless of P supply. By contrast, colonization by G. intraradices reached 55% of total root length at P1, and was significantly reduced with increased P to 43% at P2. However, the percentage of colonized root containing arbuscules or vesicles did not change between P treatments.

Table 2.  Experiment 2: colonization of barley (Hordeum vulgare) inoculated with Glomus geosporum or Glomus intraradices and grown at P1 (5.7 mg kg−1 additional phosphorus (P)) or P2 (11.4 mg kg−1 additional P) for 5 wk
AM treatmentP treatment% Total colonization1% Arbuscular colonization1% Vesicular colonization1
  • Colonization data are presented as total percentage root length colonized and percentage of total colonization as arbuscular colonization or vesicular colonization.

  • 1

    Values are means ± SEM of five replicates. Values with the same letter in each column are not significantly different (P < 0.05).

Glomus geosporumP12 ± 1a49 ± 19a5 ± 5a
P24 ± 1a48 ± 5a3 ± 2a
Glomus intraradicesP155 ± 3b64 ± 4a14 ± 3a
P243 ± 6c54 ± 5a12 ± 1a

Growth and P response  The growth response of barley to AM colonization was similar for both fungi (Fig. 2, Table 3). Shoot DW was significantly reduced by AM colonization, and there was no difference between plants colonized by G. geosporum or G. intraradices (Fig. 2). Root DW was also significantly reduced by AM colonization, except for plants colonized by G. intraradices at P2 (Fig. 2). Increased P supply did not significantly alter the growth of plants for any treatment at P2 compared with that at P1. The MGR was −46% for plants colonized by G. geosporum and plants colonized by G. intraradices at P1, and −38% for plants colonized by G. intraradices at P2 (Table 3).

image

Figure 2. Experiment 2: shoot and root dry weight (DW) of barley (Hordeum vulgare) inoculated with Glomus geosporum (G. geosp), Glomus intraradices (G. intra), or without inoculation (NM) and grown at P1 (5.7 mg kg−1 additional phosphorus (P), closed bars) or P2 (11.4 mg kg−1 additional P, open bars) for 5 wk. Bars are means of five replicates ± SEM; bars with the same letter are not significantly different (P < 0.05).

Download figure to PowerPoint

Table 3.  Experiment 2: phosphorus (P) content, mycorrhizal growth response (MGR) and mycorrhizal P response (MPR) of barley (Hordeum vulgare) plants inoculated with Glomus geosporum, Glomus intraradices, or without inoculation and grown at P1 (5.7 mg kg−1 additional P) or P2 (11.4 mg kg−1 additional P) for 5 wk
AM treatmentP treatmentP content1 (mg per plant)MGR2 (%)MPR2 (%)
  • 1

    Values are means ± SEM of five replicates. Values with the same letter in each column are not significantly different (P < 0.05).

  • 2

    Mycorrhizal response (MGR, mycorrhizal growth response; MPR, mycorrhizal P response) calculated from DW or P content according to Eqn 1; MR = (AM − NM)/NM × 100.

NonmycorrhizalP16.2 ± 0.2a  
P28.0 ± 0.5b  
Glomus geosporumP13.4 ± 0.2c−45−46
P23.8 ± 0.2c−46−52
Glomus intraradices P13.4 ± 0.2c−46−46
P24.1 ± 0.2c−38−49

There was no difference in shoot or root P concentrations of plants grown at P1 (see the Supporting Information, Table S1). The shoot P concentration of plants colonized by G. geosporum did not change with higher P and while there was a trend for G. intraradices and NM plants at P2 to have higher shoot P concentrations than those at P1, this was only significant for NM plants. Consequently, the total P content of NM plants at P2 was significantly greater than at P1 (Table 3). The two P application rates resulted in production of AM and NM plants that had very similar tissue P concentrations (Table S1). As was observed for plant growth, both AM fungi significantly decreased the total P content of barley compared with NM control plants and there was no difference in total P content between plants grown with G. geosporum or G. intraradices. The mean MPR of AM plants was −48%.

32P uptake and contribution of the AM pathway 32P was first detected in the shoots of plants colonized by G. intraradices 11 d after planting using a hand-held monitor. At harvest, negligible levels of 32P were detectable in NM plants and no 32P was detectable in soil adjacent to the HC mesh, indicating the effectiveness of the buffer zone in preventing leakage of 32P. Low levels of 32P were detected in plants colonized by G. geosporum except for one of the five replicates at P2. High levels of 32P were detected in plants colonized by G. intraradices grown at both P1 and P2, as indicated by the shoot specific activities (Fig. 3). However, there was no significant difference between the two P treatments. The calculated contribution of the AM Pi uptake pathway was 5% for G. geosporum at P2 and 48% for G. intraradices (Fig. 3). The variation between replicates within each treatment was not significantly correlated with either total colonization or arbuscular colonization.

image

Figure 3. Experiment 2: shoot specific activity of barley (Hordeum vulgare) inoculated with Glomus geosporum (G. geosp), Glomus intraradices (G. intra), or without inoculation (NM) and grown at P1 (5.7 mg kg−1 additional phosphorus (P), closed bars) or P2 (11.4 mg kg−1 additional P, open bars) for 5 wk. The calculated per cent contribution of the arbuscular mycorrhizal (AM) pathway is indicated above each bar. Bars are means of five replicates ± SEM; bars with the same letter are not significantly different (P < 0.05).

Download figure to PowerPoint

Expression of the plant Pi transporter genes  The expression of the root epidermal Pi transporter genes, HvPT1 and HvPT2, and the AM-inducible Pi transporter gene, HvPT8, was examined in barley root tissue. HvPT1 transcripts did not respond to either P or AM colonization and were variably but consistently expressed across all treatments (Fig. 4a). Similarly, there was no significant difference in the expression of HvPT2, although there was a trend towards increased expression of HvPT2 at P2 in NM roots only (Fig. 4b). HvPT8 was significantly upregulated in roots colonized by G. intraradices only. Transcripts of HvPT8 were detectable at very low levels in roots colonized by G. geosporum and in NM roots (Fig. 4c). In general, the variation between replicates within a treatment could not be explained by the extent of colonization or P content and was not statistically correlated with 32P data, although in roots colonized by G. geosporum, the highest level of expression occurred in the single replicate for which substantial 32P transfer was detected.

image

Figure 4. Experiment 2: normalized expression level of (a) HvPT1, (b) HvPT2 and (c) HvPT8, in roots of barley (Hordeum vulgare) inoculated with Glomus geosporum (G. geosp), Glomus intraradices (G. intra), or without inoculation (NM) and grown at P1 (5.7 mg kg−1 additional P) (closed bars) or P2 (11.4 mg kg−1 additional P) (open bars) for 5 wk. Transcript levels are presented as normalized transcript copies per microlitre of cDNA. Bars are means of four replicates ± SEM; bars with the same letter are not significantly different (P < 0.05); ns, no significant difference between treatments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Growth depressions are not related to extent of AM colonization

Colonization of barley progressed at different rates that were dependent upon the fungal species. Colonization by G. intraradices was rapid and reached 72% by 6 wk in Experiment 1. This is in agreement with previous reports in barley colonized by this fungal species (Plenchette & Morel, 1996; Zhu et al., 2003). By contrast, colonization by G. geosporum was slow to develop and only reached 19% by 6 wk. The inoculum potential of leek pot cultures was high for both species of AM fungi (as described in the Materials and Methods section) and it is not clear why colonization by G. geosporum was so low, particularly in Experiment 2; nevertheless, large variability in colonization dependent on the AM fungal species is entirely consistent with previous reports from cereals (Jensen, 1982; Graham & Abbott, 2000).

The growth and P content of AM plants was significantly reduced at low P compared with NM controls (approx. values were −40% for MGR and MPR). These depressions were observed consistently in two separate experiments. The magnitude of the depression was not related to AM fungal species or extent of colonization; equivalent depressions were observed with G. intraradices (c. 49% colonization) and G. geosporum (c. 3% colonization) (Experiment 2). A similar phenomenon has been reported previously in wheat (Hetrick et al., 1992; Graham & Abbott, 2000; Li et al., 2008). In the experiment reported by Hetrick et al. (1992), the growth depressions caused by Glomus versiforme or Glomus mosseae were equal (MGR −50%), but these fungi colonized 61% and 5% of the root length, respectively. Such disparate colonization suggests that the C demand of these AM fungi is likely to be very different. In the current work, this suggestion is further supported by the production of vesicles (lipid-rich storage structures) in roots colonized by G. intraradices but not by G. geosporum. These data again suggest that the conventional explanation of growth depressions resulting from C drain to the fungal symbiont does not hold in all cases (see Li et al., 2008). In the present study, the tissue P concentrations were below the reported critical concentration for barley (Reuter & Robinson, 1997), and the correlation between tissue P content and growth (Fig. 1) strongly suggests that P was the limiting factor in plant growth. However, the higher P addition (P2) in Experiment 2 did not increase plant biomass, despite an increased P concentration in NM plants. Although there is no obvious explanation for the lack of growth response in NM plants at P2, it is consistent with previous findings in other barley cultivars (Baon et al., 1993) over the soil P range used here.

The AM Pi uptake pathway contributes significantly to plant P and is not quantitatively related to growth depression

The inclusion of a radiolabelled HC in Experiment 2 enabled us to quantify the contribution of the AM pathway to P uptake for the first time in barley. The results with G. intraradices confirm and extend previous work of Zhu et al. (2003) who demonstrated hyphal 32P transfer by G. intraradices to barley cultivars Clipper and Sahara, despite significant growth depressions. In our experiment, measurement of soil specific activity in the HC enabled quantification of the contribution of the AM pathway to plant P using the method of Smith et al. (2003). The application of Eqn 2 is based on the assumption that colonization of roots is rapid, that hyphal distribution is uniform in both the RHC and HC, and that hyphae remove P from the RHC and HC equally. The results presented in Experiment 1 indicate that G. intraradices rapidly colonized barley during the first 2 wk of growth and, although hyphal length density was not measured in this experiment, the uniform development of G. intraradices hyphae in the RHC and HC has been reported previously (Smith et al., 2004; Li et al., 2006). The calculation of AM contribution in barley colonized by G. intraradices suggests that 41–55% of plant P was acquired via the AM uptake pathway. This is in agreement with Li et al. (2006) who demonstrated a 50–80% contribution of G. intraradices to Pi uptake by wheat.

In contrast to G. intraradices, G. geosporum apparently did not make a significant contribution to Pi uptake by barley. Although there are no data for hyphal development of G. geosporum in this system, the very low degree of colonization by G. geosporum in Experiment 2 suggests that only a small hyphal length density would be expected in the RHC and HC. However, the detection of 32P in one of the plants colonized by G. geosporum indicates that this fungus is capable of growing into the HC and transferring some P even at very low levels of colonization. This suggestion is supported by the presence of arbuscules in G. geosporum-colonized roots and the expression of HvPT8, which are independent of hyphal penetration into the HC. Nevertheless, the contribution of the AM Pi uptake pathway was clearly not related to the growth and P response of plants colonized by either AM fungus. These results add to the mounting evidence that AM function cannot necessarily be correlated with plant growth responses (Pearson & Jakobsen, 1993; Smith et al., 2003, 2004; Poulsen et al., 2005).

Contribution of the AM Pi uptake pathway is related to differences in AM-inducible Pi transporter gene expression between fungi

It has been suggested that expression of AM-induced Pi transporters can be used as a marker of symbiotic function or even to provide a measure of symbiotic activity (Isayenkov et al., 2004; Poulsen et al., 2005; Javot et al., 2007). These suggestions are based on the correlation between expression of AM-inducible Pi transporter genes and formation of arbuscules, which are considered to be the primary site for nutrient exchange in Arum-type AM symbioses (Karandashov & Bucher, 2005). In the current work the expression of the AM-inducible Pi transporter gene, HvPT8, was observed in all AM-colonized root samples. In general terms, across the fungal species, colonization was linked to HvPT8 expression and 32P transfer. However, there was no statistically significant correlation between replicates within a species. HvPT8 was greatly upregulated in roots colonized by G. intraradices, but HvPT8 expression was not correlated with the contribution of the AM Pi uptake pathway, as measured by 32P transfer. In addition, HvPT8 expression was not correlated with either total or arbuscular colonization. Our data suggest that HvPT8 expression alone does not provide a reliable quantitative marker for symbiotic activity in terms of the amount of P transferred via the AM pathway in individual AM fungal–plant associations. Whether this reflects an inherent difference between the AM-inducible Pi transporters which are specifically expressed in AM roots and those, such as HvPT8 which are simply up-regulated, remains to be determined and will require more detailed investigation.

The contribution of the direct Pi uptake pathway is reduced by colonization and is not related to epidermal Pi transporter gene expression

Taken together with the MPR of −50%, our measurements of the AM contribution in barley raise significant issues regarding the role of the direct Pi uptake pathway. The contribution of the direct pathway was clearly reduced in AM plants, and it can be inferred from the measurement of AM contribution that direct Pi uptake was reduced to a greater extent in barley when colonized by G. intraradices than when colonized by G. geosporum (assuming that hyphae of G. geosporum reached the HC). This difference in direct Pi uptake is particularly significant because root growth was similar in these AM plants and, assuming no change in the length to weight ratio, this indicates an equivalent surface area was presented to the soil.

Experiment 2 tested the hypothesis that decreased Pi uptake via the direct pathway resulted from downregulation of the Pi transporter genes involved in this pathway. This study provides new data integrating measurements of AM contribution to plant Pi uptake with molecular characterization and quantification of Pi transporter expression in an AM plant that is not positively responsive. There was no significant difference in the expression of the root epidermal Pi transporters genes, HvPT1 and HvPT2, among treatments. Although both HvPT1 and HvPT2 are P-responsive (Smith et al., 1999), it is not surprising that they did not respond to increased P supply at P2 in Expt 2. The two P levels applied in this experiment were selected to produce NM and AM plants of similar P concentrations and were not high enough to induce a P response in gene expression. Plants grown at either P level had low tissue P concentrations (Table S1). In addition, neither HvPT1 nor HvPT2 were down-regulated in AM roots colonized by either G. intraradices or G. geosporum (Fig. 4). This lack of down-regulation contradicts previous findings of Glassop et al. (2005) showing a P-independent down-regulation of HvPT1 and HvPT2 in AM barley roots. At this time there is no obvious explanation for this discrepancy. Nevertheless, the data presented here suggest that the decrease in contribution of the direct pathway was not correlated with decreased expression of the Pi transporter genes involved in Pi uptake via this pathway. However, there remains the possibility that other (unknown) Pi transporters may be involved in Pi uptake into barley (whether NM or AM).

Poulsen et al. (2005) also observed a lack of correlation between expression of root Pi transporters and contribution of the direct uptake pathway in tomato. In that case, AM colonization resulted in increases in plant growth and Pi uptake. Interestingly, in the interaction between tomato and G.  intraradices BEG 87, the AM pathway accounted for only 20% of plant Pi uptake, indicating that the MPR of 116% was caused by an increase in Pi uptake via the direct pathway. However, there was no clear correlation between the contribution of the direct uptake pathway and changes in expression of the Pi transporter genes. A similar observation of enhanced direct Pi uptake by AM roots has been reported for nonresponsive cucumber (Cucumis sativus) colonized by Scutellospora calospora (Pearson & Jakobsen, 1993). Data from both investigations emphasize that there can be considerable changes in the relative contributions of direct and AM Pi uptake pathways, whether up or down. The mechanisms for these changes remain to be elucidated but do not appear to result from changes in expression of genes involved in the direct Pi uptake pathway.

An alternative explanation for decreased Pi uptake via the direct pathway suggests that competition between fungal hyphae and plant roots leads to an increased rate of depletion of soil Pi adjacent to AM roots, compared with NM roots (Poulsen et al., 2005). This explanation would be consistent with observations from studies comparing 32P uptake by roots of AM and NM tomato (Cress et al., 1979) and clover (Schweiger et al., 1999), which demonstrated that AM roots had a significantly lower Km than NM roots. However, it cannot satisfactorily explain the large growth depression of barley when colonized by G. geosporum, which would be expected to have a small degree of external hyphal development and hence present minimal competition with roots compared with G. intraradices.

Although transcriptional regulation has been identified as an important primary control point for plant Pi transport, recent advances suggest that post-translational modification of regulatory components is also important in determining plant Pi uptake (Fujii et al., 2005; Miura et al., 2005; Chiou et al., 2006). It seems likely that AM regulation of the direct uptake pathway occurs through modification of regulatory components rather than direct regulation of Pi transporter gene expression. The role of post-translational processes in determining Pi fluxes via both the direct and AM uptake pathways in an AM plant remain to be determined, and will be a critical area for future research. Differential ability among AM fungi to regulate plant Pi uptake pathways may be pivotal to understanding the observed diversity in plant responses to AM colonization.

Conclusion

In this paper, the role of Pi transporters in governing Pi uptake in an AM plant was investigated using both physiological and molecular approaches. This combined approach is critical to furthering our understanding of symbiotic Pi transfer processes, particularly in nonresponsive hosts. The similar growth depression resulting from very different extents of colonization by two species of mycorrhizal fungi suggests that conventional explanations which relate growth depressions solely to C drain to the fungus require reassessment. Furthermore, the contribution of these AM fungi to Pi uptake was not related to plant responsiveness. Thus, the inhibition of growth by AM colonization of barley appears to be caused by more than just the direct effects of colonization on availability of C for plant growth and plant P acquisition. We were able to examine Pi transporter gene expression in plants which had similar growth and P concentrations. We conclude that decreased Pi uptake via the direct pathway cannot be explained by changes in expression of the Pi transporter genes that were investigated here. Investigation of post-translational regulation of Pi transport and plant–fungal signalling is required to further understand the role of the symbiotic partner in regulating plant Pi uptake. Such investigations will be a crucial step towards manipulation of the symbiosis to maintain activity of the direct Pi uptake pathway, with the aim of improving productivity of nonresponsive plants.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Alastair Fitter and the anonymous referees for helpful comments. We are also thankful to Dr Neil Shirley for Q PCR analyses and Dr Chunyuan Huang for providing Q PCR primers. E.G. is grateful for a Commonwealth Hill postgraduate research scholarship. This research was supported by the Australian Centre for Plant Functional Genomics and the Australian Research Council.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Aliasgharzadeh N, Rastin NS, Towfighi H, Alizadeh A. 2001. Occurrence of arbuscular mycorrhizal fungi in saline soils of the Tabriz Plain of Iran in relation to some physical and chemical properties of soil. Mycorrhiza 11: 119122.
  • Baon JB, Smith SE, Alston AM. 1993. Mycorrhizal responses of barley cultivars differing in P-efficiency. Plant and Soil 157: 97105.
  • Bieleski RL. 1973. Phosphate pools, phosphate transport, and phosphate availability. Annual Review of Plant Physiology and Plant Molecular Biology 24: 225252.
  • Bucher M. 2007. Functional biology of plant phosphate uptake at root and mycorrhiza interfaces. New Phytologist 173: 1126.
  • Bucher M, Rausch C, Daram P. 2001. Molecular and biochemical mechanisms of phosphorus uptake into plants. Journal of Plant Nutrition and Soil Science 164: 209217.
  • Burleigh SH, Cavagnaro TR, Jakobsen I. 2002. Functional diversity of arbuscular mycorrhizas extends to the expression of plant genes involved in P nutrition. Journal of Experimental Botany 53: 15931601.
  • Burton RA, Shirley NJ, King BJ, Harvey AJ, Fincher GB. 2004. The CesA gene family of barley. Quantitative analysis of transcripts reveals two groups of co-expressed genes. Plant Physiology 134: 224236.
  • Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF, Su CL. 2006. Regulation of phosphate homeostasis by microRNA in Arabidopsis. The Plant Cell 18: 412421.
  • Chiou TJ, Liu H, Harrison MJ. 2001. The spatial expression patterns of a phosphate transporter (MtPT1) from Medicago truncatula indicate a role in phosphate transport at the root/soil interface. Plant Journal 25: 281293.
  • Cress WA, Throneberry GO, Lindsey DL. 1979. Kinetics of phosphorus absorption by mycorrhizal and nonmycorrhizal tomato roots. Plant Physiology 64: 484487.
  • Daram P, Brunner S, Persson BL, Amrhein N, Bucher M. 1998. Functional analysis and cell-specific expression of a phosphate transporter from tomato. Planta 206: 225233.
  • Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK. 2005. A miRNA involved in phosphate-starvation response in Arabidopsis. Current Biology 15: 20382043.
  • Glassop D, Godwin RM, Smith SE, Smith FW. 2007. Rice phosphate transporters associated with phosphate uptake in rice roots colonised with arbuscular mycorrhizal fungi. Canadian Journal of Botany 85: 644651.
  • Glassop D, Smith SE, Smith F. 2005. Cereal phosphate transporters associated with the mycorrhizal pathway of phosphate uptake into roots. Planta 222: 688698.
  • Grace EJ. 2008. Functional characterisation of phosphorus uptake pathways in a nonresponsive arbuscular mycorrhizal host. PhD thesis, University of Adelaide, Australia.
  • Grace EJ, Smith FA, Smith SE. 2008. Deciphering the arbuscular mycorrhizal pathway of P uptake in nonresponsive hosts. In: Azcón-Aguilar C, Barea JM, Gianinazzi S, Gianinazzi-Pearson V, eds. Mycorrhizas: functional processes and ecological impact: Berlin, Germany: Springer, 89106.
  • Graham JH, Abbott LK. 2000. Wheat responses to aggressive and nonaggressive arbuscular mycorrhizal fungi. Plant and Soil 220: 207218.
  • Guimil S, Chang HS, Zhu T, Sesma A, Osbourn A, Roux C, Ionnidis V, Oakeley EJ, Docquier M, Descombes P et al . 2005. Comparative transcriptomics of rice reveals an ancient pattern of response to microbial colonization. Proceedings of the National Academy of Sciences, USA 102: 80668070.
  • Hanson WC. 1950. The photometric determination of phosphorus in fertilizers using the phosphovanado-molybdate complex. Journal of the Science of Food and Agriculture 1: 172173.
  • Harrison MJ, Dewbre GR, Liu JY. 2002. A phosphate transporter from Medicago truncatula involved in the acquisition of phosphate released by arbuscular mycorrhizal fungi. The Plant Cell 14: 24132429.
  • Hetrick BAD, Wilson GWT, Cox TS. 1992. Mycorrhizal dependence of modern wheat varieties, landraces, and ancestors. Canadian Journal of Botany 70: 20322040.
  • Isayenkov S, Fester T, Hause B. 2004. Rapid determination of fungal colonization and arbuscule formation in roots of Medicago truncatula using real-time (RT) PCR. Journal of Plant Physiology 161: 13791383.
  • Jakobsen I, Rosendahl L. 1990. Carbon flow into soil and external hyphae from roots of mycorrhizal cucumber plants. New Phytologist 115: 7783.
  • Javot H, Pumplin N, Harrison MJ. 2007. Phosphate in the arbuscular mycorrhizal symbiosis: transport properties and regulatory roles. Plant, Cell & Environment 30: 310322.
  • Jensen A. 1982. Influence of four vesicular–arbuscular mycorrhizal fungi on nutrient-uptake and growth in barley (Hordeum vulgare). New Phytologist 90: 4550.
  • Jensen A, Jakobsen I. 1980. The occurence of vesicular–arbuscular mycorrhiza in barley and wheat grown in some Danish soils with different fertilizer treatments. Plant and Soil 55: 403414.
  • Johnson NC, Graham JH, Smith FA. 1997. Functioning of mycorrhizal associations along the mutualism–parasitism continuum. New Phytologist 135: 575586.
  • Karandashov V, Bucher M. 2005. Symbiotic phosphate transport in arbuscular mycorrhizas. Trends in Plant Science 10: 2229.
  • Kouno K, Tuchiya Y, Ando T. 1995. Measurement of soil microbial biomass phosphorus by an anion-exchange membrane method. Soil Biology & Biochemistry 27: 13531357.
  • Leggewie G, Willmitzer L, Riesmeier J. 1997. Two cDNAs from potato are able to complement a phosphate uptake-deficient yeast mutant: identification of phosphate transporters from higher plants. Plant Cell 9: 381392.
  • Li H. 2005. Roles of mycorrhizal symbiosis in growth and phosphorus nutrition of wheat in a highly calcareous soil. PhD thesis, University of Adelaide, Australia.
  • Li H, Smith FA, Dickson S, Holloway RE, Smith SE. 2008. Plant growth depressions in arbuscular mycorrhizal symbioses: not just caused by carbon drain? New Phytologist 178: 852862.
  • Li HY, Smith SE, Holloway RE, Zhu YG, Smith FA. 2006. Arbuscular mycorrhizal fungi contribute to phosphorus uptake by wheat grown in a phosphorus-fixing soil even in the absence of positive growth responses. New Phytologist 172: 536543.
  • Liu C, Muchhal US, Uthappa M, Kononowicz AK, Raghothama KG. 1998a. Tomato phosphate transporter genes are differentially regulated in plant tissues by phosphorus. Plant Physiology 116: 9199.
  • Liu H, Trieu AT, Blaylock LA, Harrison MJ. 1998b. Cloning and characterization of two phosphate transporters from Medicago truncatula roots: regulation in response to phosphate and response to colonization by arbuscular mycorrhizal (AM) fungi. Molecular Plant–Microbe Interactions 11: 1422.
  • McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA. 1990. A new method which gives an objective measure of colonization of roots by vesicular–arbuscular mycorrhizal fungi. New Phytologist 115: 495501.
  • Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D, Koo YD, Jin JB, Bressan RA et al . 2005. The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses. Proceedings of the National Academy of Sciences, USA 102: 77607765.
  • Muchhal US, Pardo JM, Raghothama KG. 1996. Phosphate transporters from the higher plant Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 93: 1051910523.
  • Muchhal US, Raghothama KG. 1999. Transcriptional regulation of plant phosphate transporters. Proceedings of the National Academy of Sciences, USA 96: 58685872.
  • Mudge SR, Rae AL, Diatloff E, Smith FW. 2002. Expression analysis suggests novel roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant Journal 31: 341353.
  • Murphy J, Riley J. 1962. A modified single solution method for the determination of phosphate in natural waters. Analytica Chimica Acta 27: 3136.
  • Nagy R, Vasconcelos MJV, Zhao S, McElver J, Bruce W, Amrhein N, Raghothama KG, Bucher M. 2006. Differential regulation of five Pht1 phosphate transporters from maize (Zea mays L.). Plant Biology 8: 186197.
  • Paszkowski U, Kroken S, Roux C, Briggs SP. 2002. Rice phosphate transporters include an evolutionarily divergent gene specifically activated in arbuscular mycorrhizal symbiosis. Proceedings of the National Academy of Sciences, USA 99: 1332413329.
  • Pearson JN, Jakobsen I. 1993. The relative contribution of hyphae and roots to phosphorus uptake by arbuscular mycorrhizal plants measured by dual labelling with 32P and 33P. New Phytologist 124: 489494.
  • Phillips JM, Hayman DS. 1970. Improved procedures for clearing roots and staining parasitic and vesicular–arbuscular mycorrhizal fungi for rapid assessment of infection. Transactions of the British Mycological Society 55: 158161.
  • Plenchette C, Morel C. 1996. External phosphorus requirement of mycorrhizal and nonmycorrhizal barley and soybean plants. Biology and Fertility of Soils 21: 303308.
  • Poulsen KH, Nagy R, Gao L-L, Smith SE, Bucher M, Smith FA, Jakobsen I. 2005. Physiological and molecular evidence for Pi uptake via the symbiotic pathway in a reduced mycorrhizal colonization mutant in tomato associated with a compatible fungus. New Phytologist 168: 445454.
  • Rae AL, Cybinski DH, Jarmey JM, Smith FW. 2003. Characterization of two phosphate transporters from barley; evidence for diverse function and kinetic properties among members of the Pht1 family. Plant Molecular Biology 53: 2736.
  • Rausch C, Bucher M. 2002. Molecular mechanisms of phosphate transport in plants. Planta 216: 2337.
  • Rausch C, Daram P, Brunner S, Jansa J, Lalol M, Leggewie G, Amrhein N, Bucher M. 2001. A phosphate transporter expressed in arbuscule-containing cells in potato. Nature 414: 462466.
  • Reuter DJ, Robinson JB, eds. 1997. Plant analysis: an interpretation manual. Collingwood, Australia: CSIRO Publishing.
  • Sawers RJH, Gutjahr C, Paszkowski U. 2008. Cereal mycorrhiza: an ancient symbiosis in modern agriculture. Trends in Plant Science 13: 9397.
  • Schunmann PHD, Richardson AE, Smith FW, Delhaize E. 2004. Characterization of promoter expression patterns derived from the Pht1 phosphate transporter genes of barley (Hordeum vulgare L.). Journal of Experimental Botany 55: 855865.
  • Schweiger PF, Thingstrup I, Jakobsen I. 1999. Comparison of two test systems for measuring plant phosphorus uptake via arbuscular mycorrhizal fungi. Mycorrhiza 8: 207213.
  • Smith FW. 2002. The phosphate uptake mechanism. Plant and Soil 245: 105114.
  • Smith FW, Cybinski DH, Rae AL. 1999. Regulation of expression of genes encoding phosphate transporters in barley roots. In: Gissel-Nielsen G, Jensen A, eds. Plant nutrition – molecular biology and genetics. Dordrecht, the Netherlands: Kluwer Academic Publishers, 145150.
  • Smith FW, Ealing PM, Dong B, Delhaize E. 1997. The cloning of two Arabidopsis genes belonging to a phosphate transporter family. Plant Journal 11: 8392.
  • Smith SE, Smith FA, Jakobsen I. 2003. Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth responses. Plant Physiology 133: 1620.
  • Smith SE, Smith FA, Jakobsen I. 2004. Functional diversity in arbuscular mycorrhizal (AM) symbioses: the contribution of the mycorrhizal P uptake pathway is not correlated with mycorrhizal responses in growth or total P uptake. New Phytologist 162: 511524.
  • Stribley DP, Tinker PB, Rayner JH. 1980. Relation of internal phosphorus concentration and plant weight in plants infected by vesicular–arbuscular mycorrhizas. New Phytologist 86: 261266.
  • Tawaraya K. 2003. Arbuscular mycorrhizal dependency of different plant species and cultivars. Soil Science and Plant Nutrition 49: 655668.
  • Vierheilig H, Coughlan AP, Wyss U, Piche Y. 1998. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Applied and Environmental Microbiology 64: 50045007.
  • Wright DP, Read DJ, Scholes JD. 1998. Mycorrhizal sink strength influences whole plant carbon balance of Trifolium repens L. Plant, Cell & Environment 21: 881891.
  • Zhu LJ, Altmann SW. 2005. mRNA and 18S-RNA coapplication-reverse transcription for quantitative gene expression analysis. Analytical Biochemistry 345: 102109.
  • Zhu YG, Smith FA, Smith SE. 2003. Phosphorus efficiencies and responses of barley (Hordeum vulgare L.) to arbuscular mycorrhizal fungi grown in highly calcareous soil. Mycorrhiza 13: 93100.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Table S1 Experiment 2: shoot and root phosphorus (P) concentrations in barley inoculated with Glomus geosporum, Glomus intraradices or without inoculation and grown for 5 wk at P1 (5.7 mg kg−1 additional P) or P2 (11.4 mg kg−1 additional P).

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

FilenameFormatSizeDescription
NPH_2720_sm_TableS1.doc51KSupporting info item