SEARCH

SEARCH BY CITATION

Keywords:

  • isoprenoids;
  • legumes;
  • lipids;
  • Medicago;
  • oomycete;
  • soil pathogen;
  • Stramenopila

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • • 
    Sterols are isoprenoid-derived molecules that have essential functions in eukaryotes but whose metabolism remains largely unknown in a large number of organisms. Oomycetes are fungus-like microorganisms that are evolutionarily related to stramenopile algae, a large group of organisms for which no sterol metabolic pathway has been reported. Here, we present data that support a model of sterol biosynthesis in Aphanomyces euteiches, an oomycete species causing devastating diseases in legume crops.
  • • 
    In silico analyses were performed to identify genes encoding enzymes involved in the conversion of the isoprenoid precursor 3-hydroxy-3-methylglutaryl coenzyme A to isoprenoids. Several metabolic intermediates and two major sterol end-products were identified by gas chromatography–mass spectroscopy.
  • • 
    We show that A. euteiches is able to produce fucosterol (a sterol initially identified in brown algae) and cholesterol (the major animal sterol). Mycelium development is inhibited by two sterol demethylase inhibitors used as fungicides, namely tebuconazole and epoxiconazole.
  • • 
    We propose the first sterol biosynthetic pathway identified in a stramenopile species. Phylogenetic analyses revealed close relationships between A. euteiches enzyme sequences and those found in stramenopile algae, suggesting that part of this pathway could be conserved in the Stramenopila kingdom.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Oomycetes are fungal-like eukaryotic microorganisms that are widely considered as major threats for agriculture and natural ecosystems. Phylogenetic studies have shown that oomycetes are distantly related to true fungi (Baldauf et al., 2000). They fall within the kingdom Straminopila, which contains saprophytic marine organisms such as diatoms and brown algae (Baldauf et al., 2000). Most oomycete pathogens are classified into two groups: the Peronosporales, comprising the potato Irish famine pathogen Phytophthora infestans and the grape downy mildew pathogen Plasmopara viticola; and the Saprolegniales, in which most animal pathogenic oomycetes are found (Dick et al., 1999; Riethmueller et al., 2002). This latter group includes devastating pathogens of aquatic organisms, fish and crustaceans (Phillips et al., 2008).

True fungi and oomycetes being phylogenically distinct, as a result, most fungicides used in medicine and agriculture are ineffective in the treatment of plant and animal disease caused by oomycete pathogens. This is particularly the case for molecules targeting enzymes involved in sterol synthesis. This class of fungicides is represented by triazoles, the most important class of fungicides, which target a sterol-demethylation step catalyzed by the CYP51 group of cytochrome P450 enzymes (Lamb et al., 1999; Odds et al., 2003). Phytophthora sp. and other oomycete species are sterol auxotrophs (Marshall et al., 2001), and accordingly lack functional CYP51 genes in their genome (Tyler et al., 2006).

As sterols are essential for mycelial development and reproduction, sterol auxotrophic oomycetes must acquire sterol precursors from their host during infection. A large family of extracellular proteins that are structurally related to lipid transfer proteins and are specifically found in oomycetes play a major role as sterol transporters during infection. These proteins were named elicitins because they were initially characterized for their high plant defence-eliciting activity (Blein et al., 2002). Elicitins are widespread in Phytophthora species and the closely related Pythium species but are absent from any other organism studied so far, leading to the hypothesis that the expansion of a large elicitin gene family originated from the requirement of oomycete organisms to acquire exogenous sterols from their environment (Vauthrin et al., 1999; Jiang et al., 2006).

Aphanomyces euteiches Drechs. is a soil-borne oomycete pathogen belonging to the Saprolegniales, which causes severe root rot of several legumes, including pea, common bean and alfalfa (Gaulin et al., 2007). The Aphanomyces genus includes animal pathogens that are involved in serious outbreaks in the aquatic environment. Aphanomyces invadans has been reported to be implicated in ulcerative mycosis affecting both wild and farmed fish, often leading to mass mortality (Vandersea et al., 2006). Aphanomyces astaci, originating from America, is the causative agent of crayfish plague that repeatedly devastated European populations of freshwater crayfish (Söderhäll & Cerenius, 1999). This parasite is now considered to be among the 100 most harmful invading species (Global Invasive Species Database, http://www.issg.org/database/).

Recently, a large expressed sequence tag (EST) collection was developed on A. euteiches (Madoui et al., 2007). Comparative analyses revealed that most A. euteiches genes absent in Phytophthora sojae and Phytophthora ramorum were predicted to be involved in sterol biosynthesis (Gaulin et al., 2008). As no sterol biosynthetic pathway was described for any oomycete, we undertook the characterization of sterol metabolism in A. euteiches. Initially, genes involved in sterol biosynthesis were detected through data mining, using AphanoDB, a database for A. euteiches ESTs (Madoui et al., 2007). Then, biochemical analyses were performed to identify major sterols and some of their intermediates. Finally, results showing that the sterol pathway could be an efficient target for controlling Saprolegniale pathogens are also provided.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Strains, media and culture conditions

A. euteiches strain ATCC201684 is a Danish pea isolate that was kindly provided by Dr F. Krajinski (Hannover University, Germany). A. euteiches was maintained on 1.7% corn meal agar (CMA; Sigma-Aldrich) by routine subculture in the dark at 24°C. For long-term storage, mycelium explants were kept under sterilized source water (Volvic®; France) at 15°C in the dark. Zoospores were obtained as previously described (Badreddine et al., 2008). Briefly, 20 mycelium explants were transferred from a 10–15-d-old CMA plate to an Erlenmeyer flask containing 50 ml of sterile peptone glucose (PG) broth (peptone, 20 g l−1; glucose, 5 g l−1) and incubated for 3 d in the dark. The PG broth was then removed under sterile conditions and the mycelial mats were rinsed twice for 2 h, and once for 16–20 h, with 30 ml of sterilized source water. Motile zoospores were counted using a Malassez haemocytometer and diluted with distilled water to the concentration required for the various experiments. To measure the effect of triazoles on A. euteiches, PG medium containing 10 mg l−1 of triazoles were distributed into the wells of a 96-well microtiter plate (100 µl per well) and subsequently inoculated with 5000 zoospores per well. Eight replicates were prepared for each condition. The plates were incubated in the dark at 24°C for 5 d and the hyphal density was determined by measuring the optical density (OD) at 595 nm. For some conditions, the medium was supplemented with β−sitosterol (Sigma) at 20 mg l−1.

Statistical analyses

Inhibition bioassay data analyses were performed using R 2.8.1 language and environment (R Core Team, 2008). The effects of three biological replicates and six treatments (sterols or/and inhibitors) on mycelial growth (measured by the OD) were evaluated using a two-way ANOVA. The residue distribution values were tested for normality using the Shapiro–Wilk test (P > 0.05) and also by a graphical view of the residue distributions on a Q-Q plot (data not shown). The variance homogeneity of the residue values was tested using Levene's test (P > 0.05). To compare each treatment with each other, the treatment significancy effect was tested using the Tukey honestly significant difference method (P > 0.05).

Rapid amplification of cDNA ends–polymerase chain reaction

Specific primers were designed from ESTs available in the AphanoDB databank. 5′-Rapid amplification of cDNA ends (RACE) was performed using the Invitrogen GeneRacer Kit. Gene-specific primers for 5′-RACE were designed using unigene sequences available in AphanoDB: Ae_5AL7244 for AeCYP51. 5′-RACE on AeCYP51 was performed using the gene-specific primer ATAGGTTCGGAGCGACGTACG-c and the nested gene-specific primer TCCAGGGCCGAACACTGGCGTCATA. 5′-RACE on AeSMT was performed using the gene-specific primer CAAGGGCAGCAGCGATGGCACCC and the nested gene-specific primer GCAGCGACTGAGTAGAAGATCGCC.

Bioinformatics analyses

Data mining of Aphanomyces sequences was performed using AphanoDB (Madoui et al., 2007). CYP51 sequences were obtained from the NCBI (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/) and the databases dedicated to genome sequences of the corresponding organisms. For diatoms and brown algae sterol methyl transferase (SMT) sequences, the gene prediction on their genomes was performed locally using the fgenesh+ algorithm (Salamov & Solovyev, 2000). Multiple alignments were performed by ClustalW V2.0 (Larkin et al., 2007) using the PAM weight matrix. For CYP51, sequences corresponding to the IPR001128 cytochrome P450 domain were used for alignment. For SMTs, alignment was performed on the concatenation of the IPR013216 methyltransferase type 11 and the IPR013705 sterol methyltransferase c-terminal domains. We used mrbayes 3.1 (Huelsenbeck et al., 2001) to infer phylogenetic trees from protein alignments. For bayesian trees inference, the approximation of clade posterior probabilities is allowed by the Metropolis-coupled Markov chain Monte Carlo (or MC3) algorithm of MrBayes that runs multiple Markov chains. For CYP51 and SMT trees, a run with two chains (one cold chain and one heated chain) was performed for 100 000 generations under a Whelan and Golding amino acid substitution matrix model (Whelan & Goldman, 2001). The burnin gave a convergence diagnostic of < 0.01 for the CYP51 tree and of < 0.001 for the SMT tree. The customized tree was drawn using mega 3.1 (Kumar et al., 2004) from the newick output file of MrBayes. For the CYP51s analysis, the tree was rooted by the Methylococcus CYP51 sequence. For the SMTs, the tree was rooted by the Arabidopsis SMT1.

Sterol analyses

Sterol was extracted from fresh A. euteiches mycelium. After homogenization in methanol/5 mM EGTA (3 ml, 2 : 1, v/v) with FAST-PREP (MP BioMedicals, Solon, CA, USA), lipids (corresponding to 400 mg of dry mycelium) were extracted according to Bligh & Dyer (1959) in chloroform/methanol/water (2.5 : 2.5 : 2.1, v/v/v) with 5αcholestane (5 µg) as the internal standard. Aliquots (100 µl) were evaporated and dry pellets were dissolved in 0.25 ml of NaOH (0.1 m) overnight. Total proteins were measured by Bradford using the Bio-Rad protein assay kit (CA, USA). The dried lipid extracts were submitted to alkaline hydrolysis treatment in 0.1 N methanolic KOH (1.5 ml) for 1 h at 60°C, and then water was added (1 ml). Sterols were extracted three times with hexane (2 ml) and evaporated to dryness. Sterols were silylated in N,O-Bis(trimethylsilyl)trifluoroacetamide (1% trimethylchlorosilane-pyridine) (80 µl, 1 : 1, v/v) for 1 h at 55°C. The products (1 µl) were directly analyzed using gas–liquid chromatography on a 5890 Hewlett Packard system using RTX-50 fused silica capillary columns (30 m × 0.32 µm internal diameter, 0.1 µm film thickness, Restek, Lisses, France). The oven temperature was programmed from 180 to 225°C (1 min), at a rate of 0.5°C min−1, and the carrier gas was hydrogen (0.5 bar). The injector and the detector were at temperatures of 260°C and 300°C, respectively. The sterol structures were checked by gas chromatography–mass spectrometry (GC-MS) with silylated fraction analysis, using a Trace Thermo finnigan gas chromatograph (Thermo Scientific, Waltham, MA, USA), equipped with a programmed vaporization injection system (PTV), in combination with a Quadripole Thermo Finnigan Mass detector and a Varian (Varian Inc, Palo Alto, CA, USA) fused-silica capillary column FACTOR FOUR VF-17 ms (30 m, 0.25 mm internal diameter, 0.15 µm film thickness). The temperature in the injector was 50–260°C for the transfer phase. The oven temperature was programmed from 230 to 280°C (2 min) at a rate of 1°C min−1 with a helium constant pressure of 50 kPa. The electroionization–mass spectrometry (EI-MS) conditions used were an ionization voltage of 70 eV, an ion current of 150 µA and an ion source temperature of 250°C.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Identification of A. euteiches sterol biosynthetic genes

Data mining of a large collection of A. euteiches ESTs (Madoui et al., 2007) led to the identification of 10 unigenes (putatively involved in the biosynthesis of isoprenoids), from the precursor 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) (Table 1). As expected, no ortholog for these genes was found in other oomycete species (Phytophthora sp., Hyaloperonospora arabidopsidis), except for a sequence encoding a putative Δ7 sterol reductase (Table 1). Mining of a Saprolegnia parasitica EST collection (Torto-Alalibo et al., 2005) did not give a positive result, indicating that sterol genes are missing from this collection. Data mining on the two fully sequenced diatom genomes, Thalassiosira pseudonana (Armbrust et al., 2004) and Phaeodactylum tricornutum (Bowler et al., 2008) allowed the identification of orthologous genes for most of the enzymatic steps, except for the squalene epoxidase, the Δ4 methyl sterol oxidase and the Δ24 sterol reductase (Table 1).

Table 1. Aphanomyces euteiches sequences involved in sterol biosynthesis
GenBank accession numberBest-hit SwissProtBest-hit organismAccession numberId/Sim (%)e-valueP. sojaeId/Sim (%)P. tricornutumId/Sim (%)
  1. GenBank accession numbers of A. euteiches sequences encoding putative sterol biosynthesis enzymes are indicated in the first column. Each sequence was blasted using the blastp program to the Swiss Prot database and to the proteomes of Phytophthora sojae (oomycete) and Phaeodactylum tricornutum (diatom). The accession or identity numbers for the best hits are indicated as well as the percentages of identity and similarity (Id/Sim %).

  2. HMG-CoA, 3-hydroxy-3-methylglutaryl coenzyme A; NA, not applicable; ND, not determined.

CU360127HMG-CoA reductaseGossypium hirsutumO6496752/693e-117NDNA16 87058/73
CAQ55982Squalene synthaseRattus norvegicusQ0276943/607e-67NDNA36 29154/70
CAQ55983Squalene epoxidasePanax ginsengO4865143/552e-70NDNANDNA
CAQ55984Oxidosqualene cyclaseDictyostelium discoideumQ55D8547/631e-152NDNA13 50744/60
CAQ5597714α-demethylase (CYP51)Sorghum bicolorP9384643/608e-104NDNA41 56649/61
CAQ55985Δ14 sterol reductaseMus musculusQ71KT553/686e-77NDNA42 20564/74
CAQ55986Δ4 methyl oxydaseSus scrofaQ6UGB250/673e-69NDNANDNA
CAQ55978Δ24 methyltransferaseOryza sativaQ6ZIX246/642e-85NDNA33 87049/79
CAQ55988Δ24 reductaseTribolium castaneumQ1539256/751e-123NDNANDNA
CAQ55987Δ7 reductaseArabidopsis thalianaQ9LDU657/708e-9312786173/8323 33855/64

A euteiches growth is inhibited by specific sterol inhibitors

To test whether A. euteiches was indeed able to synthesize its own sterols, mycelial growth was quantified in sterol-free media and in media supplemented with a mix of plant sterols (sitosterol, stigmasterol and campesterol). No significant difference (Tukey test, P > 0.05) on mycelial development was observed between the two types of media (Fig. 1). The addition of molecules known to inhibit the demethylation step catalyzed by the CYP51 enzymes, epoxiconazole and tebuconazole, inhibits growth (Tukey test, P < 0.05) at a final concentration of 10 mg l−1 (Fig. 1), corresponding to the concentration used for the inhibition of growth of true fungi. The effect of the inhibitors was partially reversed by the addition of β-sitosterol (Tukey test, P < 0.05), confirming the specific effect of these chemicals on sterol biosynthesis.

image

Figure 1. Effect of sterol biosynthesis inhibitors on Aphanomyces growth. Aphanomyces euteiches zoospores were incubated in wells of enzyme-linked immunosorbent assay (ELISA) plates containing a sterol-free medium as control, a β-sitosterol-containing medium or a triazole-containing medium (tebuconazole or epoxiconazole, respectively), as indicated, and the optical density (OD) was measured at 595 nm. The SD was calculated using three biological replicates and statistical analyses were performed as described in the Materials and Methods section.

Download figure to PowerPoint

Fucosterol and cholesterol are synthesized through the production of lanosterol

Sterol composition in A. euteiches mycelia grown in sterol-free media was analysed using gas–liquid chromatography (Fig. 2). Fucosterol (70%) and, to a lesser extent, cholesterol (15%) were identified as the two major sterols. Identification of these sterols was established by comparison with the mass spectra of true standards. Two cholesterol precursors – lathosterol and 7-dehydrocholesterol – were also identified as well as a small amount of lanosterol (2% of the total sterol extract).

image

Figure 2. Identification of Aphanomyces sterols by gas–liquid chromatography and mass spectrometry. Sterols were extracted from Aphanomyces euteiches mycelia cultivated in the absence (Control) or the presence of the CYP51 enzyme inhibitor tebuconazole (10 mg l−1). Tebuconazole was added after 5 d of growth on a sterol-free medium and the mycelia were harvested 2 d after addition of the inhibitor. (a) The gas chromatography–mass spectrometry (GC-MS) profile of A. euteiches. Sterols were separated and analysed as described in the Materials and Method section. The positions corresponding to fucosterol and cholesterol are indicated, as well as the metabolic intermediates, lathosterol and lanosterol (IS, internal standard). Sterols were identified by MS using the corresponding standards. The formula of fucosterol is shown. (b) Identification of A. euteiches sterols by GC-MS. The bar chart illustrates the percentage of different sterols identified by GC-MS. The control (black bars) corresponds to the sterol content of mycelia grown for 7 d on a sterol-free medium. The tebuconazole-treated condition (grey bars) corresponds to the sterol content of mycelia grown for 5 d on a sterol-free medium and then for 2 d on a sterol-free medium containing 10 mg l−1 of tebuconazole. The SD was calculated using two biological replicates.

Download figure to PowerPoint

Lanosterol is a substrate for animal and fungal CYP51 enzymes, whereas plant enzymes use obtusifoliol. It has been shown that substrate preference is linked to the amino acid sequence of an essential recognition site (the B’ helix) present in the N-terminal region of CYP51 enzymes (Gotoh, 1992; Lepesheva et al., 2006). Alignment of the AeCYP51 B’ helix with 44 CYP51 sequences from plant, animal, fungi, trypanosomatids and bacteria revealed the presence of a Leu residue (Leu114) that is also present in all the enzymes using lanosterol as a substrate, whereas in plant enzymes a Phe residue is present at that position (Supporting Information Fig. S1).

To determine the effect of azole inhibitors on sterol composition, A. euteiches mycelia were grown for 5 d on sterol-free media and transferred to a medium containing tebuconazole. Analysis of the sterol composition showed that this treatment led to an accumulation of lanosterol and a significant decrease of the end sterols fucosterol and cholesterol (Fig. 2a). Quantification of these products confirmed the dramatic increase of the amount of lanosterol obtained in mycelium treated with tebuconazole, reaching c. 50% of total sterols (Fig. 2b).

From this inhibition assay and in silico analyses, we concluded that lanosterol is the major substrate of the A. euteiches CYP51, leading to the demethylated product 4,4-dimethylcholesta-8,14,24-trienol.

Sterol biosynthesis in A. euteiches: an evolutionary perspective

The demethylation step catalyzed by CYP51 enzymes has been found in all biological kingdoms (Lepesheva & Waterman, 2007) because it is a key step in sterol biosynthesis. CYP51 enzymes are thus particularly well-suited for use in phylogenetic analyses. We used a protein sequence derived from a full-length complete cDNA of a putative A. euteiches sterol demethylase CYP51 (CAQ55977; AeCYP51), obtained by RACE-PCR, to align the deduced protein sequence to CYP51 sequences from Stramenopiles, plants, animals and fungi (Fig. S2). The phylogenetic tree (Fig. 3a) shows that AeCYP51 clustered with sequences from brown algae (Ectocarpus siliculosus) and diatoms (P. tricornutum). This result indicates that AeCYP51 evolved from a common Straminopila ancestor CYP51 gene.

image

Figure 3.  Thephylogenetic tree of CYP51 and sterol methyl transferase (SMT) proteins. Full protein sequences of different kingdoms were aligned using ClustalW2 and the trees were inferred using the Bayesian method (MrBayes; Huelsenbeck et al., 2001); values above the nodes are clades posterior probabilities. The CYP51 tree (a) was rooted by specifying the Methylococcus capsulatus CYP51 sequence as an outgroup. The SMT tree (b) was rooted by the Arabidopsis SMT1 sequence.

Download figure to PowerPoint

Plant and fungal sterols differed from mammalian sterols by the presence of an extra alkyl group at C24 (Schäller, 2003) and the addition of alkyl groups is catalyzed by sterol methyl transferases. Because the addition of an ethyl group at C24 is required to synthesize fucosterol, an SMT sequence was studied in more detail. The complete sequence of an SMT (CAQ55978; AeSMT) was obtained by RACE-PCR. By contrast to SMT found in plants, yeast or fungi, tmhmm searches on AeSMT revealed the presence of two transmembrane domains located in the N-terminus of the protein (data not shown). Transmembrane domains were also detected in the SMTs of the diatom T. pseudonana. A phylogenetic tree inferred with AeSMT and SMT sequences from plant, fungi and trypanosomatid parasites showed that the Stramenopiles SMTs form a monophyletic group (Fig. 3b). Two regions involved in sterol and S-adenosyl methionine binding are conserved in the AeSMT sequence, and alignment with other SMTs shows stronger homology to fungal SMTs than to plant SMTs, supporting the hypothesis that AeSMT is able to methylate zymosterol to produce fecosterol (Fig. S3) in order to obtain fucosterol.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The sterol biosynthesis pathway described here is the first oomycete sterol pathway characterized. Integration of genomic and biochemical analyses allowed us to propose an A. euteiches sterol pathway (Fig. 4) that shows several homologies to sterol biosynthesis in animals and protozoa and provides novel insights into the evolution of Stramenopiles.

image

Figure 4. An oomycete sterol biosynthetic pathway. Genes encoding sterol biosynthetic enzymes detected in Aphanomyces euteiches are indicated in italic and bold characters. Sterols identified by gas chromatography–mass spectrometry (GC-MS) are on a grey background. Orthologous sequences detected in the diatom Phaeodactylum tricornutum are indicated with dots, and genes present in metazoan genomes are shown with squares. The demethylation step inhibited by azole fungicides is indicated.

Download figure to PowerPoint

The identification of an HMG-CoA reductase sequence suggests that synthesis of isoprenoid compounds occurs via the mevalonate route, leading to the synthesis of isopentenyl phosphate. It has been recently shown that isopentenyl phosphate can also be synthesized by a nonmevalonate route in diatoms (Massé et al., 2004); however, this alternative pathway is preferentially used for nonsterol metabolites such as terpenoids or chloroplastic isoprenoids in higher plants and green algae (Lichtenthaler et al., 1997), and is thus unlikely to occur in A. euteiches.

A key step in the production of sterols is the demethylation reaction catalyzed by CYP51 enzymes. The 14α-demethylated products of the CYP51-catalyzed reaction are intermediates in the pathway leading to cholesterol in animals, ergosterol in fungi and a variety of 24-alkylated sterols in plants, algae and protozoa. The preferred substrate of animal and fungal CYP51 enzymes is the C4-double methylated intermediate lanosterol, whereas plant CYP51 enzymes demethylate preferentially the C4-monomethylated substrate obtusifoliol. The biochemical and molecular evidence presented here strongly support lanosterol as a substrate for an A. euteiches sterol demethylase and an intermediate in fucosterol biosynthesis because (1) addition of a specific demethylase inhibitor led to a dramatic increase of lanosterol in A. euteiches mycelium and (2) the A. euteiches CYP51 sequence shows specific amino acid residues involved in lanosterol substrate specificity and that are also found in animal and fungal enzymes. Identification of a CYP51 enzyme in A. euteiches has several important implications in terms of evolution of the sterol biosynthesis pathway and potential development of anti-oomycete chemicals because CYP51 enzymes are the major target for developing molecules affecting this pathway (Waterman & Lepesheva, 2005).

A first branch of the A. euteiches sterol pathway leads to the production of cholesterol, probably through the production of zymosterol. This part of the pathway is supported by the identification of cholesterol as one of the major end-sterols, a finding supported by the identification of two metabolic intermediates (lathosterol and 7-dehydrocholesterol) and by the identification of a sequence encoding a putative dehydrocholesterol Δ24 sterol reductase with strong similarities to an insect sequence (Tribolium castaneum) and other animal sequences. This enzyme catalyzes the formation of 5α-cholest-8-en-3β-ol from zymosterol, namely the first step of the conversion of zymosterol to cholesterol. No ortholog of this gene was detected in the diatom P. tricornutum (Table 1) or by mining the draft of the E. silicolosus genome sequence. Thus, the branch leading to cholesterol in A. euteiches may be absent in diatoms and brown algae. Accordingly, only trace amounts of cholesterol were detected in diatoms (Cvejic & Rohmer, 2000). Additionally, this branch of the pathway can be involved in specific oomycete steroid hormones because it is known that these organisms need steroid compounds to induce sexual and asexual reproduction (Riehl & Toft, 1985).

A second branch involves an enzymatic step catalyzed by a Δ24 sterol methyltransferase (AeSMT) leading to the major product, fucosterol. Sterols with an alkyl substitution at C24 are present in plant, fungal and parasitic protozoa, but absent in animals (Bouvier-Nave et al., 1998; Diener et al., 2000; Roberts et al., 2003). In higher plants, the presence of 24-ethyl sterols results from two distinct methyl transfers from S-adenosyl-l-methionine. It is generally assumed that cycloartenol is the substrate of the first methylation reaction, resulting in 24-methylene cycloartenol, whereas 24-methylenelophenol is the preferred substrate for the second methylation reaction, resulting in 24-ethylidene lophenol. In Saccharomyces cerevisiae, the methyltransferase catalyzes the transfer of the methyl group from S-adenosyl-l-methionine, converting zymosterol to fecosterol. As zymosterol is a precursor of cholesterol, we favour the hypothesis that fucosterol is synthesized through the production of fecosterol resulting from the methylation of zymosterol. This hypothesis is strengthened by the homology of AeSMT to fungal SMT. Further studies are needed to firmly identify the substrate used by this enzyme and to clarify the possibility that the two methylation steps required to obtain the C24-ethyl group present in fucosterol can be catalyzed by a single enzyme.

Phylogenetic analyses using CYP51 and sterol methyltransferase sequences strongly support the presence of the sterol pathway very early in the evolution of Stramenopiles. The A. euteiches sterol pathway displays similarities to those found in diatoms, but the final sterol composition could be different in these organisms. Epibrassicasterol was found to be the major sterol in the diatom P. tricornutum (Cvejic & Rohmer, 2000), whereas fucosterol is the major end sterol found in A. euteiches. This stramenopile sterol pathway was probably lost in plant pathogenic oomycetes, such as Phytophthora sp., during a transition to a parasitic lifestyle. A massive loss of genes playing a role in basic metabolic processes has been recently observed in parasitic species belonging to the chromoalveolates, a large group of organisms that includes the parasitic apicomplexans, the plastid-less ciliates, the dinoflagellate algae and the stramenopiles (Martens et al., 2008). This loss was probably compensated by the expansion of the elicitin or elicitin-like genes in parasitic oomycete genomes (Jiang et al., 2006). It has been proposed that these extracellular proteins can play a role of sterol transporters (Blein et al., 2002). In accordance with the ability of A. euteiches to synthesize its own sterols, only one very divergent elicitin gene was found in the A. euteiches transcriptomes (Gaulin et al., 2008). However, inhibition of sterol biosynthesis in A. euteiches by a CYP51 inhibitor can be partially complemented by added plant sterols in the growth medium, suggesting that A. euteiches is also able to acquire and to metabolize exogenous sterols. Further studies will aim to clarify this point, which will be of primary importance for the effect of specific sterol inhibitors on plant infection.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

M.-A. M. was supported by a predoctoral fellowship from the Centre National de la Recherche Scientifique (CNRS). We thank Hubert Schaller (IBMP-CNRS Strasbourg, France) for helpful discussions, Marc Cock (Roscoff, France) for access to unpublished Ectocarpus siliculosus genomic data and Marie-Pascale Latorse (Bayer CropScience, France) for the generous gift of demethylase inhibitors.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH, Zhou S, Allen AE, Apt KE, Bechner M et al . 2004. The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism. Science 306: 7986.
  • Badreddine I, Lafitte C, Heux L, Skandalis N, Spanou Z, Martinez Y, Esquerré-Tugayé MT, Bulone V, Dumas B, Bottin A. 2008. Cell wall chitosaccharides are essential components and exposed patterns of the phytopathogenic oomycete Aphanomyces euteiches. Eukaryotic Cell 7: 19801993.
  • Baldauf SL, Roger AJ, Wenk-Siefert I, Doolittle WF. 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290: 972977.
  • Blein JP, Coutos-Thevenot P, Marion D, Ponchet M. 2002. From elicitins to lipid-transfer proteins: a new insight in cell signalling involved in plant defence mechanisms. Trends in Plant Science 7: 293296.
  • Bligh EG, Dyer WJ. 1959. A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 37: 911917.
  • Bouvier-Nave P, Husselstein T, Benveniste P. 1998. Two families of sterol methyltransferases are involved in the first and the second methylation steps of plant sterol biosynthesis. European Journal of Biochemistry 256: 8896.
  • Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A, Maheswari U, Martens C, Maumus F, Otillar RP et al . 2008. The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature. 456: 239244.
  • Cvejic JH, Rohmer M. 2000. CO2 as main carbon source for isoprenoid biosynthesis via the mevalonate-independent methylerythritol 4-phosphate route in the marine diatoms Phaeodactylum tricornutum and Nitzschia ovalis. Phytochemistry 53: 2128.
  • Dick M, Vick M, Gibbings J, Hedderson T, Lopez-Lastra C. 1999. 18s rDNA for species of Leptolegnia and other Peronosporomycetes: justification for the subclass taxa Saprolegniomycetidae and Peronosporomycetidae and division of the Saprolegniaceae sensu lato into the Leptolegniaceae and Saprolegniaceae. Mycological Research 103: 11191125.
  • Diener AC, Li H, Zhou W, Whoriskey WJ, Nes WD, Fink GR. 2000. Sterol methyltransferase 1 controls the level of cholesterol in plants. The Plant Cell 12: 853870.
  • Gaulin E, Jacquet C, Bottin A, Dumas B. 2007. Root rot disease of legumes caused by Aphanomyces euteiches. Molecular Plant Pathology 8: 539548.
  • Gaulin E, Madoui MA, Bottin A, Jacquet C, Mathé C, Couloux A, Wincker P, Dumas B. 2008. Transcriptome of Aphanomyces euteiches: new oomycete putative pathogenicity factors and metabolic pathways. PLoS ONE 3: e1723.
  • Gotoh O. 1992. Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. The Journal of Biological Chemistry 267: 8390.
  • Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP. 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 23102314.
  • Jiang RH, Tyler BM, Whisson SC, Hardham AR, Govers F. 2006. Ancient origin of elicitin gene clusters in Phytophthora genomes. Molecular Biology of Evolution 23: 338351.
  • Kumar S, Tamura K, Nei M. 2004. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Bioinformatics 5: 150163
  • Lamb D, Kelly D, Kelly S. 1999. Molecular aspects of azole antifungal action and resistance. Drug Resistance Update 2: 390402.
  • Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R et al . 2007. Clustal W and Clustal X version 2.0. Bioinformatics. 23: 29472948.
  • Lepesheva GI, Waterman MR. 2007. Sterol 14α-demethylase cytochrome P450 (CYP51), a P450 in all biological kingdoms. Biochimistry and Biophysical Acta 1770: 467477.
  • Lepesheva GI, Zaitseva NG, Nes WD, Zhou W, Arase M, Liu J, Hill GC, Waterman MR. 2006. CYP51 from Trypanosoma cruzi: a phyla-specific residue in the B’ helix defines substrate preferences of sterol 14α-demethylase. The Journal of Biological Chemistry 281: 35773585.
  • Lichtenthaler HK, Schwender J, Disch A, Rohmer M. 1997. Biosynthesis of isoprenoids in higher plant chloroplasts proceeds via a mevalonate-independent pathway. FEBS Letters 400: 271274.
  • Madoui MA, Gaulin E, Mathé C, San Clemente H, Couloux A, Wincker P, Dumas B. 2007. AphanoDB: a genomic resource for Aphanomyces pathogens. BMC Genomics 8: 471.
  • Marshall JA, Dennis AL, Kumazawa T, Haynes AM, Nes WD. 2001. Soybean sterol composition and utilization by Phytophthora sojae. Phytochemistry 58: 423428.
  • Martens C, Vandepoele K, Van de Peer Y. 2008. Whole-genome analysis reveals molecular innovations and evolutionary transitions in chromalveolate species. Proceedings of the National Academy of Sciences, USA 105: 34273432.
  • Massé G, Belt ST, Rowland SJ, Rohmer M. 2004. Isoprenoid biosynthesis in the diatoms Rhizosolenia setigera (brightwell) and Haslea ostrearia (simonsen). Proceedings of the National Academy of Sciences, USA 101: 44134418.
  • Odds FC, Brown AJ, Gow NA. 2003. Antifungal agents: mechanisms of action. Trends in Microbiology 11: 272279.
  • Phillips AJ, Anderson VL, Robertson EJ, Secombes CJ, van West P. 2008. New insights into animal pathogenic oomycetes. Trends in Microbiology 16: 1319.
  • R Core Team. 2008. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Available from http://www.r-project.org.
  • Riehl RM, Toft DO. 1985. Effect of culture medium composition on pheromone receptor levels in Achlya ambisexualis. Journal of Steroid Biochemistry 23: 483489.
  • Riethmueller A, Voglmayr H, Goeker M, Weiss M, Oberwinkler F. 2002. Phylogenetic relationships of the downy mildews (Peronosporales) and related groups based on nuclear large subunit ribosomal DNA sequences. Mycologia 94: 834849.
  • Roberts CW, McLeod R, Rice DW, Ginger M, Chance ML, Goad LJ. 2003. Fatty acid and sterol metabolism: Potential antimicrobial targets in apicomplexan and trypanosomatid parasitic protozoa. Molecular and Biochemical Parasitology 126: 129142.
  • Salamov A, Solovyev V. 2000. Ab initio gene finding in Drosophila Genomic DNA. Genome Research 10: 516522.
  • Schäller H. 2003. The role of sterols in plant growth and development. Progress in Lipid Research 42: 163175.
  • Söderhäll K, Cerenius L. 1999. The crayfish plague fungus: history and recent advances. Fresh Cray. 12: 1135.
  • Torto-Alalibo T, Tian M, Gajendran K, Waugh ME, van West P, Kamoun S. 2005. Expressed sequence tags from the oomycete fish pathogen Saprolegnia parasitica reveal putative virulence factors. BMC Microbiology 5: 46.
  • Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RH, Aerts A, Arredondo FD, Baxter L, Bensasson D, Beynon JL et al . 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313: 12611266.
  • Vandersea MW, Litaker RW, Yonnish B, Sosa E, Landsberg JH, Pullinger C, Moon-Butzin P, Green J, Morris JA, Kator H et al . 2006. Molecular assays for detecting Aphanomyces invadans in ulcerative mycotic fish lesions. Applied and Environmental Microbiology 72: 15511557.
  • Vauthrin S, Mikes V, Milat ML, Ponchet M, Maume B, Osman H, Blein JP. 1999. Elicitins trap and transfer sterols from micelles, liposomes and plant plasma membranes. Biochimistry and Biophysical Acta 1419: 335342.
  • Waterman MR, Lepesheva GI. 2005. Sterol 14α-demethylase, an abundant and essential mixed-function oxidase. Biochemistry and Biophysical Research Communications 338: 418422.
  • Whelan S, Goldman N. 2001. A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach. Molecular Biology and Evolution 18: 691699.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1 Alignment of CYP51 orthologs in the region of the B’ helix.

Fig. S2 Alignement of AeCYP51 protein sequence to plant, fungal, animal, and stramenopiles CYP51 sequences.

Fig. S3 Alignment of sterol methyltransferase amino acid sequences.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

FilenameFormatSizeDescription
NPH_2895_sm_FigS1.pdf32KSupporting info item
NPH_2895_sm_FigS2.pdf83KSupporting info item
NPH_2895_sm_FigS3.pdf43KSupporting info item