Engineering plants for the phytoremediation of RDX in the presence of the co-contaminating explosive TNT

Authors


Author for correspondence:
Neil C. Bruce
Tel: +44 01904 328777
Email: neil.bruce@york.ac.uk

Summary

  • The explosive compounds hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) are widespread environmental contaminants commonly found as co-pollutants on military training ranges. TNT is a toxic carcinogen which remains tightly bound to the soil, whereas RDX is highly mobile leaching into groundwater and threatening drinking water supplies. We have engineered Arabidopsis plants that are able to degrade RDX, whilst withstanding the phytotoxicity of TNT.
  • Arabidopsis thaliana (Arabidopsis) was transformed with the bacterial RDX-degrading xplA, and associated reductase xplB, from Rhodococcus rhodochrous strain 11Y, in combination with the TNT-detoxifying nitroreductase (NR), nfsI, from Enterobacter cloacae.
  • Plants expressing XplA, XplB and NR remove RDX from soil leachate and grow on soil contaminated with RDX and TNT at concentrations inhibitory to XplA-only expressing plants.
  • This is the first study to demonstrate the use of transgenic plants to tackle two chemically diverse organic compounds at levels comparable with those found on contaminated training ranges, indicating that this technology is capable of remediating concentrations of RDX found in situ. In addition, plants expressing XplA and XplB have substantially less RDX available in aerial tissues for herbivory and potential bioaccumulation.

Introduction

The explosive compounds hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) are significant environmental pollutants, contaminating an estimated 16 million hectares of military land in the USA alone (US Defense Science Board Task Force, 1998; US General Accounting Office 2004). Contamination on training ranges mainly arises from incomplete detonation of munitions. The concentration of explosive pollutants is heterogeneous, with hot spots of between 100 and 1000 mg kg−1 (Talmage et al., 1999; Jenkins et al., 2006), although the majority is below this level. Pollution has also historically arisen from the manufacture and storage of explosives. Although RDX is less toxic than TNT (Woody et al., 1986; Burdette et al., 1988; Kucukardali et al., 2003), it is still classified as a possible human carcinogen by the Environmental Protection Agency (EPA). Within the soil, RDX is highly mobile and readily leaches into groundwater with the potential to pollute subsequent waterways. This route of pollution has led to the contamination of a sole source aquifer below Massachusetts Military Reservation on Cape Cod (USA) (Clausen et al., 2004).

Studies have shown that RDX is readily taken up and translocated to the aerial tissues of plants (Vila et al., 2007), and is reduced to hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine and hexahydro-1,3-nitroso-5-nitro-1,3,5-triazine in the leaf, with subsequent mineralization of the heterocyclic ring requiring light (Van Aken et al., 2004). However, despite high uptake rates, plants have inherently low abilities to degrade RDX (Best et al., 1999; Winfield et al., 2004). Microorganisms with the ability to degrade RDX have been isolated, including Rhodococcus rhodochrous strain 11Y (Seth-Smith et al., 2002). The RDX-degrading ability of this bacterium, encoded by xplA, has been shown to be the result of a cytochrome P450, which catalyses the aerobic degradation of RDX to 4-nitro-2,4-diazabutanal (NDAB), nitrite and formaldehyde, whereas, anaerobically, methylenedinitramine is produced instead of NDAB (Jackson et al., 2007) (Fig. 1a). Arabidopsis thaliana (Arabidopsis) plants expressing XplA have been shown to remove RDX from a saturating (180 μM) solution (Rylott et al., 2006). This concentration is more than three times that measured in wastewater from manufacturing sites (Jackson et al., 1978), suggesting that this approach could be successfully incorporated into a phytoremediation programme. Soil studies have demonstrated that plant biomass is enhanced in XplA-expressing plants growing on RDX-contaminated soil compared with uncontaminated soil, indicating that XplA-expressing plants can utilize the nitrite released from the degradation of RDX as a nitrogen source for growth (Rylott et al., 2006). Plants co-expressing XplA and XplB, the partnering reductase for XplA in Rhodococcus, exhibited an additional, up to 30-fold, increase in the rate of RDX removal (Jackson et al., 2007).

Figure 1.

Detoxification pathways of 2,4,6-trinitrotoluene (TNT) and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). (a) Proposed pathway of RDX degradation by Rhodococcus rhodochrous strain 11Y (Jackson et al., 2007, Copyright (2007) National Academy of Sciences, USA). Dotted lines indicate cleavage sites; compounds in parentheses are hypothetical. (b) Reduction of the 4-NO2 of TNT by nitroreductases (Hannink et al., 2007).

Commonly used alongside RDX in military munitions, TNT is toxic to all organisms tested so far, including plants (Rosenblatt, 1980; Pavlostathis et al., 1998; Robidoux et al., 2003; Rocheleau et al., 2006), and is listed by the EPA as a possible human carcinogen. Unlike RDX, TNT binds tightly to the humic fraction of the soil, reducing biological availability (Hundal et al., 1997; Thorn & Kennedy, 2002). TNT is most commonly biotransformed in soil by type I bacterial nitroreductases (NRs) to hydroxylamino dinitrotoluenes (HADNTs) with subsequent reduction to amino dinitrotoluenes (ADNTs) (Fig. 1b). Within the plant, TNT is restricted predominantly to the root tissues and, although plant enzymes have been shown to transform and conjugate TNT in vivo, plants have only a limited ability to detoxify TNT (Gandia-Herrero et al., 2008; Rylott & Bruce, 2009). To overcome this, bacterial genes conferring TNT detoxification activity have been engineered into plants. The onr gene encoding pentaerythritol tetranitrate reductase and nfsI gene encoding a NR from Enterobacter cloacae have both been independently expressed in Nicotiana tabacum (tobacco) (French et al., 1999; Hannink et al., 2001). The resultant plant lines exhibited increased capacities for tolerating and detoxifying TNT. The NR enzyme transforms TNT by preferentially reducing the nitro group at the four position to produce 4-nitroso-2,6-dinitrotoluene (4-NODNT) and then 4-hydroxylamino-dinitrotoluene (4-HADNT), which is subsequently reduced by the plant to 4-amino-2,6-dinitrotoluene (4-ADNT). These reduced TNT products are then glycosylated and studies suggest they then become bound to the plant cell wall (Gandia-Herrero et al., 2008). In soil studies, NR-expressing tobacco plants were able to tolerate levels of TNT contamination toxic to untransformed plants (Hannink et al., 2001).

The high mobility of RDX means that it needs to be intercepted on military ranges before it migrates into the groundwater. Plants, with their extensive root systems, offer a potentially viable and sustainable means of attenuating this pollutant. As both RDX and TNT are often found on contaminated sites together, if RDX is to be effectively removed from contaminated sites, plants need to be engineered to tolerate the toxicity of the co-polluting TNT. Here, we present data showing that this can be achieved in Arabidopsis under laboratory conditions by engineered XplA-NR and XplA-XplB-NR transgenic plant lines.

Materials and Methods

RDX and TNT were provided by the Defence Science and Technology Laboratory (DSTL) (Fort Halstead, Kent, UK).

The xplA gene was cloned into the binary vector pMLBart (Gleave, 1992), which confers resistance to the herbicide Basta, to produce the vector pMLBart-xplA. The xplB gene was cloned into pART27 (Gleave, 1992), which confers resistance to kanamycin, to produce the vector pART27-xplB. The nfsI gene, encoding NR activity, was cloned into pART27 (Gleave, 1992) to create pNITRED3 (Hannink et al., 2001), and separately into pJo530, a pBIN19 derivative (Bevan, 1984) which confers resistance to hygromycin, to create pJo530-nfsI. All constructs expressed xplA, xplB and nfsI under the control of the CaMV35S promoter and ocs terminator. Approximately 50 independent Arabidopsis thaliana (L.) Heynh (Arabidopsis) ecotype Columbia 0 background transformants were generated for each construct using Agrobacterium-mediated floral dipping. Independent homozygous lines expressing xplA were as characterized previously (Rylott et al., 2006). Three to five independent homozygous lines containing the xplB or nfsI constructs were used for further study. These lines were selected because they had segregation ratios indicative of single insertion events and relatively high rates of RDX (for XplA and XplA-XplB) (Rylott et al., 2006; Jackson et al., 2007) or TNT (for NR-expressing) removal from liquid culture. XplA-NR plants were generated by crossing the pNITRED3 NR-expressing line with the highest rate of TNT removal from liquid culture (line B7) with the XplA-expressing line exhibiting the highest RDX removal rate from liquid culture (line 10). The triple XplA-XplB-NR lines were generated firstly by transforming line 35S::XPLA-10 (Rylott et al., 2006) with the pART27-xplB construct. The XplAB lines with the highest rates of RDX removal from liquid culture, XplAB-2 and XplAB-27 (Jackson et al., 2007), were re-transformed with pJo530-nfsI to generate XplA-XplB-NR lines. The presence of the transgenes was confirmed in all lines using PCR analysis (results not shown). Seven XplAB-2 derived homozygous lines, independently transformed with nfsI, were selected for further analyses based on the criteria outlined above. A summary of the plant lines used in this study is presented in Table 1.

Table 1.   Summary of plant lines, binary vectors and transgenes described in this study
Plant lineParent line(s)Construct(s)Marker gene(s)Transgene presentSource
barhptIInptIInsfIxplAxplB
  1. bar, encodes resistance to the herbicide bialaphos; hptII, hygromycin phosphotransferase encodes resistance to hygromycin; nptII, neomycin phosphotransferase, encodes resistance to kanamycin.

Wild type ecotype Col0--------NASC (line N1094)
35S:XPLA-10-pMLBart-xplA----Rylott et al. 2006
B7-pNITRED---- 
2G-pNITRED---- 
D2-pNITRED---- 
XplA-NR35S:XPLA-10pMLBart-xplA---- 
 B7pNITRED---- 
XplAB-235S:XPLA-10pMLBart-xplA----Jackson et al. 2007
 -pART27-xplB---- 
XplA-XplB-NRXplAB-2pMLBart-xplA---- 
-pART27-xplB---- 
-pJo530-nfsI---- 

Transgene expression analysis

Rosette leaves of 6-wk-old soil-grown plants were harvested and ground in liquid nitrogen. For transcript analysis, mRNA was extracted individually from five plants per line using the RNAesy kit and treated with DNAse to remove genomic DNA (Qiagen). One microgram of total RNA was then used to synthesize cDNA using oligo(dT) 12–18 primers (Invitrogen) and SuperScript III Reverse Transcriptase (Invitrogen). Real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed with an ABI7300 real-time PCR detection system using SYBR green (Bio-Rad, Veenendaal, the Netherlands). Primer sequences were forward TACAGTGTCTGGATCGGTGGTT and reverse CGGCCTTGGAGATCCACAT for ACTIN2, forward CGACGAGGAGGACATGAGATG and reverse GCAGTCGCCTATACCAGGGATA for xplA, forward CACCGCAATCGGTTTCG and reverse GTACAGGCCCGGAGCAAGA for xplB and forward ACACGCCGGAAGCCAAA and reverse GGTGCATGTCGGCGAAGTA for nfsI. Relative expression values were calculated using ACTIN mRNA as an internal reference.

For Western analysis, 10 μg of crude protein extract from rosette leaves was loaded per lane. Antibodies to the XplA protein, as used in Rylott et al. (2006), and NR protein were raised in rabbit, and a goat, anti-rabbit alkaline phosphatase conjugate was used as secondary antibody.

Liquid culture experiments

Liquid culture experiments were performed as described previously (Rylott et al., 2006), with the exception in the XplA-XplB-NR lines where eight, 3-wk-old plants per flask were used. Briefly, 200 1-d-old seedlings grown on agar plates containing half-strength Murashige and Skoog medium were transferred to 100-ml conical flasks containing 20 ml of half-strength Murashige and Skoog medium and 20 mM sucrose. Plants were grown under 20 μmol m−2 s−1 light on a rotary shaker.

Soil experiments

Soil leachate studies were performed as described previously (Jackson et al., 2007). For the contaminated soil studies, 30 mg ml−1 TNT and RDX solutions in acetone were aliquoted onto 50 g of dry sand in 2-l polypropylene tubs. For uncontaminated soil, a volume of acetone equivalent to that used for soil contaminated with the highest level of TNT and RDX was applied. The acetone was evaporated overnight, a 35-mm glass marble was added to each tub to aid mixing and the tubs were placed on a rotating mixer for 1 h; 450 g soil (Levington’s F2 compost) was added and the tubs were mixed overnight. Equal amounts of soil were weighed into 5-cm-high plastic pots and 5-d-old seedlings grown on agar plates containing half-strength Murashige and Skoog medium were planted into the soil and grown for 8 wk at 180 μmol m−2 s−1 light with a 12-h photoperiod with 18°C dark and 21°C light temperatures.

RDX extraction

Levels of RDX and TNT in plant extracts were determined using EPA Method 8330 (US Environmental Protection Agency 1994). Briefly, RDX and TNT were extracted from ground, freeze-dried plant tissue (maximum, 2.6 g fresh weight) using 2 × 10-ml volumes of methanol. Following solvent evaporation in a rotary vacuum, samples were resuspended in 4 ml of water : methanol (50 : 50) and analysed by HPLC (2695 Separations Module and 2996 Photodiode Array Detector; Waters, Milford, MA, USA) using a Techsphere C18 column (250 mm × 4.6 mm), isocratic conditions with water : methanol (50 : 50) and a flow rate of 1 ml min−1. RDX and TNT elutions were monitored at 230 nm, and integrations were performed using Empower software.

For statistical analysis, a one-way ANOVA followed by Dunnett’s test was used to compare the results for each of the transgenic lines against parental or wild-type lines.

Sequence data from this article can be found in GenBank/EMBL data libraries under the following accession numbers: xplA and xplB (AF449421) and nfsI (M63808).

Results

Ability of XplA-NR plants to remove RDX and TNT from liquid culture

The DNA construct originally used to create the NR-expressing tobacco plants, pNITRED3 (Hannink et al., 2001), was transformed into Arabidopsis and five independent homozygous lines were selected for further characterization. As predicted, these lines exhibited enhanced tolerance to TNT and increased uptake of TNT from liquid medium, with line B7 showing the highest rate of TNT uptake from liquid medium Fig. 2. The plant line B7 was genetically crossed into the previously published XplA-expressing line with the highest RDX uptake rate (Rylott et al., 2006) to create plants expressing both XplA and NR activities. To test whether the XplA-NR plants could remove both RDX and TNT from liquid culture, the XplA-NR plants were grown in liquid culture and dosed with 180 μM RDX and a range of TNT concentrations (75, 100, 125, 150 and 175 μM). With increasing concentrations of TNT, the rate of RDX uptake decreased, with RDX only taken up following the depletion of TNT to below 60 μM in the medium (Fig. 3a,b). Fig. 3(c) shows the corresponding levels of the TNT transformation product ADNT in the medium, which mirror the TNT depletion rates. During the course of the experiment, the photosynthetic tissues of the XplA-NR plants exhibited increased yellowing, followed by bleaching and biomass reductions, which correlated with increasing TNT concentration (Fig. 3d,e). Despite this inhibition, the XplA-NR plants were still significantly more tolerant to TNT than either XplA-only expressing plants or wild-type untransformed plants, both of which were killed by TNT concentrations of 175 μM and above (results not shown). Fig. 3(f) shows that the XplA-NR plants retained the capacity to remove RDX from liquid culture, in the absence of TNT, at a rate similar to that of the parental XplA-expressing line. Studies were then performed to monitor the tolerance of XplA-NR plants to TNT contamination in soil.

Figure 2.

Uptake of 2,4,6-trinitrotoluene (TNT) by Arabidopsis thaliana grown in liquid culture. Levels of TNT in liquid medium containing 200 10-d-old wild-type (WT) and nitroreductase (NR)-expressing plants dosed with (a) 100, (b) 250 and (c) 500 μM TNT. WT, open circles; NR, closed circles. Results are the mean ± SE of five replicate flasks.

Figure 3.

Uptake of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) by XplA-NR-expressing Arabidopsis thaliana grown in liquid culture. Levels of (a) RDX, (b) TNT and (c) amino dinitrotoluene (ADNT) in liquid media containing 10-d-old XplA-NR-expressing plants dosed with 180 μM RDX and a range of TNT concentrations. (d) Appearance and (e) fresh weight (FW) of XplA-NR plants 7 d post-dosing. (f) Levels of RDX in liquid media containing 10-d-old WT, XplA- and XplA-NR-expressing plants dosed with 180 μM RDX only. WT, wild-type; NR, nitroreductase. Results are the mean ± SE of five replicate flasks with 200 seedlings per flask. *Significantly different (< 0.05) from value for untreated plants.

Ability of XplA-NR plants to grow in RDX- and TNT-contaminated soil

Plants were grown in soil contaminated with either 250 or 500 mg kg−1 of RDX and TNT for 6 wk. In uncontaminated soil, the XplA-NR plants produced similar shoot biomasses and appearances to untransformed XplA and NR plants (Fig. 4a,d). In the presence of RDX and TNT, the growth of all the plants was reduced significantly. As expected, the NR-expressing plants had higher shoot biomasses than wild-type plants: three- and seven-fold higher at 250 and 500 mg kg−1 concentrations, respectively (Fig. 4b,c). However, the shoot biomasses of the NR-XplA plants were significantly higher than those of the NR-expressing lines: six-fold higher at the 250 mg kg−1 concentration (Fig. 4b). At these concentrations, only the NR- and XplA-NR-expressing plants produced sufficient biomass to support seed set (results not shown).

Figure 4.

Growth of XplA-NR-expressing Arabidopsis thaliana plants in hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)- and 2,4,6-trinitrotoluene (TNT)-contaminated soil. Shoot fresh weights (FW) of 6-wk-old plants grown in (a) uncontaminated soil, (b) 250 mg kg−1 RDX and TNT and (c) 500 mg kg−1 RDX and TNT. (d) Appearance of plants after 6 wk of growth in soil contaminated with both RDX and TNT. WT, wild-type; NR, nitroreductase. Results are the mean ± SE of five replicate pots.

Ability of XplA-XplB-NR lines to remove RDX and TNT from liquid culture

We have shown previously that the expression of the Rhodococcal reductase, XplB, together with XplA in Arabidopsis increases RDX uptake from liquid culture by 30-fold (Jackson et al., 2007). To produce Arabidopsis plants with this ability, in concert with increased tolerance to TNT, we transformed the previously published XplA-XplB line that had the fastest RDX removal rate (line 2; Jackson et al., 2007) with the nfsI gene to produce XplA-XplB-NR lines. Seven lines, homozygous for all three transgenes, were subsequently characterized for RDX uptake and ability to grow in the presence of TNT. When the plant lines were grown in liquid culture and dosed with RDX and TNT together, the XplA-XplB-NR plants removed all the RDX from the medium within 3 d, whereas the XplA-XplB parental line removed only two-thirds of the RDX in this time (Fig. 5a). The XplA-XplB-NR lines also removed TNT more quickly than the XplA-XplB lines. Fig. 5(c) demonstrates that, 17 h after dosing, four of the five XplA-XplB-NR lines tested had removed significantly more TNT from the medium than the XplA-XplB parental line.

Figure 5.

Uptake of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) by XplA-XplB-NR-expressing Arabidopsis thaliana plants grown in liquid culture. Plants were dosed with 180 μM RDX and 250 μM TNT. Levels of (a) RDX and (b) TNT in the culture medium. (c) Levels of TNT in the medium 17 h after dosing. NPC, no plant control; WT, wild-type; NR, nitroreductase; n/d, not detected. Results are the mean ± SE of four replicate flasks. *Significantly different (< 0.05) from value for XplA-XplB plants.

Characterization of XplA-XplB-NR lines

To monitor transgene transcript levels, quantitative real-time PCR was conducted on the XplA-XplB-NR-expressing Arabidopsis lines. Lines 7 and 16 had xplA and xplB transcript levels comparable with those of the parental XplA-XplB line, whereas the remaining XplA-XplB-NR lines exhibited two- to ten-fold increases in xplA and xplB transcripts relative to the parental line XplA-XplB. The NR (nfsI) transcript levels were more variable, with expression levels between one and 585-fold higher than XplA-XplB-NR line 4, the line with the lowest nfsI expression (Supporting Information Fig. S1a). The results are described in more detail in Supporting Information.

The results of the Western blot analysis (Fig. S1b and Notes S1) broadly matched the results of quantitative real-time PCR. Levels of XplA in the XplA-XplB-NR lines were further enhanced relative to the XplA-XplB parental line and the levels of NR protein varied in the triple transgenic lines, as expected for lines independently transformed with nfsI. We were unable to measure XplA or NR activities in plant extracts; however, to investigate the relative contribution of the bacterial NR to TNT transformation in the XplA-XplB-NR lines, we measured the levels of the 2- and 4-ADNT isomers in the shoots from the plants grown in soil contaminated with 100 mg kg−1 TNT. The bacterial NR favours the reduction of the 4-nitro group, producing predominantly the 4-ADNT isomer, whereas the combined endogenous NR activities in Arabidopsis result in no isomer bias. The ratios of 4-ADNT to 2-ADNT were 0.9 for the wild-type and 0.7 for XplA-XplB, but much higher (16.1) for the NR line B7. The XplA-XplB-NR lines exhibited ratios intermediate (0.6–6.1) between those of the wild-type and NR line, indicating that the bacterial NR was active in these lines.

Ability of XplA-XplB-NR lines to remove RDX from contaminated soil leachate

To test whether the XplA-XplB-NR lines were able to remove RDX migrating through the soil column, soil leachate levels of plants watered with RDX were measured (Fig. 6). The decrease in RDX levels observed in the unplanted controls can be attributed to differences in soil properties in the absence of plant roots, enabling liquid to travel more quickly through the soil column. All the XplA-XplB-NR lines, with the exception of line 5, removed RDX from soil leachate at rates comparable with the XplA-XplB parental line. The concentration of RDX in the soil leachate after 7 d from pots in which XplA-XplB-NR and XplA-XplB lines were growing was significantly less (< 0.001) than the level of RDX in leachate from pots in which wild-type plants were growing (Fig. 6a). To examine whether the XplA-XplB-NR lines were still able to remove RDX from soil leachate in the presence of the co-pollutant and phytotoxin, TNT, the soil leachate experiment was repeated using plants grown in soil contaminated with 100 mg kg−1 TNT (Fig. 6b). Seven days after dosing, the level of RDX in the soil leachate from pots containing the XplA-XplB-NR lines was significantly less (> 0.001) than the level of RDX in soil leachate from wild-type plants.

Figure 6.

Levels of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) in soil leachate from 6-wk-old Arabidopsis thaliana plants watered with 180 μM RDX. Leachate was collected following watering (t = 0, closed bars), and then plants were flushed with an equal volume of water after 7 d (t = 7, open bars). Plants were grown in (a) uncontaminated soil or (b) soil contaminated with 100 mg kg−1 TNT. NPC, no plant control; WT, wild-type; NR, nitroreductase. For all groups, the results are the mean ± SE of eight replicate pots.

To test whether the expression of xplA and xplB in the shoots, the site of RDX accumulation (Vila et al., 2007), reduced the amount of RDX in the shoot, the XplA-XplB-NR plants were grown in uncontaminated soil and soil contaminated with 100 or 200 mg kg−1 RDX and TNT. Measurements on the aerial parts of the plants (Fig. 7a,b) revealed that the levels of RDX in the XplA-XplB plant shoots were dramatically reduced compared with those in the wild-type and NR-only expressing plants: 34- to 94-fold less than the wild-type for the XplA-XplB-NR lines grown in soil contaminated with 100 mg kg−1 RDX and TNT, and between 38- and 115-fold less in soil containing 200 mg kg−1 RDX and TNT.

Figure 7.

Levels of hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) in shoot tissue of Arabidopsis thaliana plants grown in RDX- and 2,4,6-trinitrotoluene (TNT)-contaminated soil: (a) 100 mg kg−1 and (b) 200 mg kg−1 of both RDX and TNT. DW, dry weight; WT, wild-type; NR, nitroreductase; n/d, not detected. Results are the mean ± SE of five replicate measurements.

Discussion

To effectively phytoremediate RDX from soil and groundwater on military training ranges, plants need to be able to withstand the phytotoxic effects of the co-contaminant TNT. With this aim, we engineered XplA and XplA-XplB-expressing plants with TNT-detoxifying NR activity by the introduction of the nfsI gene. In liquid culture, the uptake of RDX by XplA-NR and XplA-XplB-NR plants was reduced in the presence of TNT, a known inhibitor of XplA activity (Jackson et al., 2007). However, once the transgenic plant lines had removed the TNT, they were able to take up and degrade the RDX. Furthermore, because the TNT-detoxifying ability conferred by the NR in the XplA-XplB-NR lines enabled them to remove TNT significantly more quickly than either wild-type or XplA-XplB control lines, the XplA-XplB-NR lines were also able to remove RDX significantly more quickly than the control lines from liquid culture. It is known that, following uptake, TNT is localized almost entirely within the root tissues, whereas RDX is taken up to the aerial parts of the plant (Vila et al., 2007). Thus, in liquid culture, where the aerial parts of the submerged plant are exposed to TNT, inhibition of RDX degradation by XplA-expressing plants is not unexpected. Given that the growth of plants in liquid culture is far removed from more natural growth conditions, studies were performed to measure the removal of RDX by plants from soil contaminated with TNT. These studies demonstrated that the XplA-XplB-NR plants were able to remove significantly more RDX from soil leachate than either wild-type or NR-only plants. In addition, XplA-NR plants grown in soil contaminated with both RDX and TNT had higher biomasses than plants expressing NR alone, indicating that RDX can be utilized as a nitrogen source by XplA-expressing plants.

In this study, we have demonstrated the first successful use of transgenic plants to withstand the toxicity of TNT and remediate RDX, two chemically diverse organic compounds. The levels of TNT and RDX contamination tested here also reflect the concentrations found on contaminated training ranges (Talmage et al., 1999; Jenkins et al., 2006), and indicate that this technology is capable of remediating concentrations of RDX found in situ. In addition to the obvious benefits of remediating RDX and TNT from soil and groundwater, our studies show that the levels of RDX in the shoot tissue of transgenic plants expressing XplA were dramatically lower (34- to 94-fold less) than in wild-type, untransformed tissue. This would reduce the availability of this toxin for herbivory and subsequent bioaccumulation in the food chain (Sarrazin et al., 2009; Zhang et al., 2009). Furthermore, the remediation of TNT-contaminated soil by plants expressing NR has been shown to significantly increase microbial community biomass and genetic diversity in the soil rhizosphere (Travis et al., 2007).

These studies were performed in Arabidopsis, an annual plant species with a relatively small root system penetrating only the top few centimetres of soil, and unsuitable for phytoremediation application. Perennial grass species, such as wheatgrass species (Pascopyrum smithii, Elymus trachycaulus and Agropyron fragile), which are native to military training ranges in temperate regions and produce dense root systems extending over a metre below the soil surface (Frank & Bauer, 1991), would be suitable. In addition, these species are low growing, fire resistant and capable of withstanding and recovering rapidly from disruption by heavy equipment (Asay et al., 2001; Palazzo et al., 2005), all traits advantageous for the phytoremediation of explosives from military training ranges.

Acknowledgements

This work was funded by the Strategic Environmental Research and Development Program of the US Department of Defense.

Ancillary