SEARCH

SEARCH BY CITATION

Keywords:

  • acid soil;
  • aluminium resistance;
  • aluminium tolerance;
  • rhizosheath;
  • root hairs;
  • roots;
  • toxicity;
  • wheat

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • We found significant genetic variation in the ability of wheat (Triticum aestivum) to form rhizosheaths on acid soil and assessed whether differences in aluminium (Al3+) tolerance of root hairs between genotypes was the physiological basis for this genetic variation.
  • A method was developed to rapidly screen rhizosheath size in a range of wheat genotypes. Backcrossed populations were generated from cv Fronteira (large rhizosheath) using cv EGA-Burke (small rhizosheath) as the recurrent parent.
  • A positive correlation existed between rhizosheath size on acid soil and root hair length. In hydroponic experiments, root hairs of the backcrossed lines with large rhizosheaths were more tolerant of Al3+ toxicity than the backcrossed lines with small rhizosheaths.
  • We conclude that greater Al3+ tolerance of root hairs underlies the larger rhizosheath of wheat grown on acid soil. Tolerance of the root hairs to Al3+ was largely independent of the TaALMT1 gene which suggests that different genes encode the Al3+ tolerance of root hairs. The maintenance of longer root hairs in acid soils is important for the efficient uptake of water and nutrients.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Rhizosheaths consist of soil that adheres firmly to the roots of many plant species. The soil adheres to the root by a combination of root hairs which penetrate the soil and mucilage secreted from the root which binds the soil particles together (McCully, 1999). Rhizosheaths were discovered over 100 years ago on roots of desert species and their prevalence on these plants suggested an adaptation for growth on dry soils (Price, 1911). Recently, Shane et al. (2009, 2010) proposed that in Lyginia barbata (family Restionaceae) thick sand-sheaths help to keep the dormant shallow roots hydrated over dry summers. However, rhizosheaths are not restricted to plants growing in dry environments and are common to many plant species (Duell & Peacock, 1985). They are most prominent on young regions of the root where the epidermal layer is still intact. Rhizosheaths on wheat (Triticum aestivum) roots grown in the field were described by Goodchild & Myers (1987) who highlighted their potential importance in nutrient uptake. Nambiar (1976a,b) showed that the uptake of zinc (Zn) by cereal roots in a dry soil where rhizosheaths were well developed might be due to the maintenance of a greater moisture content near the root than in the surrounding soil. The finding of Young (1995) that the rhizosheath of wheat roots maintains greater water content than the surrounding bulk soil lends support to this idea.

The development of rhizosheaths is sensitive to soil properties. For example, Watt et al. (1994) found that the rhizosheaths that develop on maize (Zea mays) roots grown in dry soil are substantially larger than those that form on roots grown in moist soil. The ability to form rhizosheaths is also strongly affected by soil pH in a range of species including wheat, barley (Hordeum vulgare) and several perennial grass species (Haling et al., 2010a,b, 2011). Acid soil generally suppresses the formation of rhizosheaths but the degree of suppression varies between species. In wheat, genotypic differences in the ability to maintain a rhizosheath in acid soil appeared to be associated with differences in length of root hairs (Haling et al., 2010b) but the basis for these differences is not known. Acid soils are typified by elevated concentrations of trivalent aluminium (Al3+), manganese (Mn2+) and hydrogen (H+) ions (Foy et al., 1978) any of which could affect the development of rhizosheaths. For instance, Al3+ inhibits the growth of root hairs in Arabidopsis thaliana, soybean (Glycine max) and Limnobium stoloniferum (Brady et al., 1993; Jones et al., 1995, 1998) but to date there are no reports of genotypic variation within a species for Al3+ tolerance of root hairs. A well-studied mechanism for Al3+ tolerance of root growth in wheat is encoded by the TaALMT1 gene but it is not known if this gene also protects root hairs (Delhaize et al., 2007).

In the current study we explored wheat germplasm for genotypes able to maintain large rhizosheaths in acid soil and tested whether differences in their tolerance of root hairs to H+ and/or Al3+ toxicity underlies genotypic differences in the ability to develop rhizosheaths in acid soil.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Germplasm

Wheat (Triticum aestivum L.) lines were obtained from the Australian Winter Wheat Cereal Collection (Tamworth, Australia) or CSIRO Plant Industry (Canberra, Australia). Transgenic wheat lines expressing the wheat TaALMT1 gene for aluminium (Al3+) tolerance are described by Pereira et al. (2010). Line T2_4.4 over-expressing TaALMT1 and an azygous sister line (T2_4.13) that lacked the transgene were used to assess the effect that this major gene for Al3+ tolerance had on the formation of rhizosheaths. The parental line of the transgenic wheat was the Al3+ sensitive cv Bob White 26. The derivation of the near-isogenic wheat lines ET8 and ES8 that differ at the TaALMT1 locus is described in Delhaize et al. (1993).

Rhizosheath screens

The rhizosheath was defined as the soil that remains adhered to roots when removed from the surrounding soil (Watt et al., 1994). For most experiments we used an acidic ferrosol soil obtained from the Robertson region of New South Wales, Australia (34°35′S, 150°36′E; Liao et al., 2008). In experiments where the soil pH was modified, the soil was amended with lime according to Haling et al. (2010b). The properties of the limed soils are detailed in Supporting Information Table S1. The dry soil was sieved through a 4-mm mesh then water added to a specified moisture content (220 ml to 1 kg air-dry soil to yield c. 80% of field capacity unless stated otherwise). The moistened soil was well mixed and sieved a second time through a 4-mm mesh to remove any aggregates before packing into pots (280 g for glasshouse experiments or 250 g for experiments in a growth cabinet). Initial experiments were conducted under natural light in a glasshouse with set day and night temperatures of 24 and 10°C. Subsequent experiments used a growth cabinet set at 20°C and light intensity of 100 μmol m−2 s−1 photon irradiance with an 8 h light : 16 h dark photoperiod. Unless stated otherwise data presented are derived from experiments undertaken in the growth cabinet and were structured as replicated randomized-block designs. Pre-germinated seed with emerged roots of 3–6 mm were planted into the moistened soil. For experiments in the glasshouse the pots were covered with brown paper and the paper removed after shoots had emerged. For plants grown in the cabinet, trays that held the pots were covered with transparent plastic lids and left on for the duration of the experiment. Pots were watered daily to weight and plants harvested after 3 d when grown in the cabinet or 3–5 d when grown in the glasshouse. At harvest, the contents of the pots were tipped into a tray and seedlings gently lifted out such that soil adhering to the roots was not dislodged. Roots were not shaken or subject to any treatments before being excised. The length of the three seminal roots was measured and then they were immediately weighed with the adhering soil still intact. Rhizosheaths are expressed as gram per metre of root, and included weights of both the fresh root and the moist soil. Fresh weights of roots averaged c. 0.3 g m−1 and were similar across the genotypes screened. Although the root could comprise from up to 30% of the sample weight for plants with small rhizosheaths, the relatively constant specific root weights among genotypes enabled the rapid screen to reliably identify genotypic differences in rhizosheath sizes.

Germplasm development

In order to generate wheat lines with a similar genetic background but with different rhizosheath sizes, the Brazilian cv Fronteira (large rhizosheath) was crossed to the Australian cv EGA-Burke (small rhizosheath) and the progeny backcrossed using cv EGA-Burke as the recurrent parent. At each backcross, 32–62 F1 seedlings were screened and those with the largest rhizosheaths used for the subsequent backcross. After the third backcross, one F1 seedling was selected to generate an F2 population and after screening 200 seedlings, 20 seedlings with the largest rhizosheaths and 20 with the smallest rhizosheaths were grown to generate BC3F3 sister lines. These BC3F3 lines were screened for rhizosheaths and individual seedlings from lines with the largest or smallest rhizosheaths were grown to generate BC3F4 lines. The BC3F4 lines were screened to identify lines that consistently had large or small rhizosheaths based on 18–20 seedlings. Because seed was limited, the next generation (BC3F5) of selected BC3F4 lines was used in experiments that analysed elemental composition and the efflux of organic anions.

Root hair measurements

Root hairs were measured on a root segment measuring 5 mm excised from one of the secondary seminal roots at a distance one-quarter of the total length of the root below the seed. This segment was selected as a region of root where rhizosheaths were fully developed in soil-grown plants. The same region of root was selected for analysis of root hairs in seedlings grown in hydroponic culture for 4 d. The hydroponic solution used was as described by Delhaize et al. (2004) and adjusted to pH 4.3 (unless stated otherwise) to ensure that toxic Al3+ remained in solution when added as aluminium chloride (AlCl3). Root length of the longest seminal root was used to assess the relative Al3+ tolerance of the various genotypes. Segments taken from plants grown in soil were thoroughly washed with water to remove the adhering soil and the segment stored in 50% ethanol before analysis. Segments taken from plants grown in hydroponics were stored directly in the 50% ethanol. The root segments were photographed at a magnification of ×2.5 with a digital camera attached to a dissecting microscope and the resulting image analysed with ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA). First, a grid representing squares with sides measuring 1 mm was generated over the image of the root segment which divided the root into five 1-mm regions. The longest root hair for each 1-mm region was then identified on either side of the root and its length measured using a segmented line tool and appropriate calibration based on the magnification of the image. The 10 measurements across the root segment were averaged and used as single value for each sample.

Elemental analysis

Pre-germinated seedlings were grown in pH 4.3 nutrient solution for 13 d with treatments comprising no added Al3+ or Al3+ added as 20 μM AlCl3. At harvest, roots were rinsed briefly in de-ionized water and separated from shoots. Plant tissues were dried overnight at 70°C then digested with nitric acid/ hydrogen peroxide (HNO3/H2O2) and analysed for elemental composition by inductively coupled plasma atomic emission spectrometry.

In order to obtain a qualitative assessment of Al distribution, roots were stained with the dye morin. Morin forms a fluorescent complex with Al and the staining was based on a method by Eticha et al. (2005). Briefly, excised root segments were rinsed in water for 5 min and then stained with an aqueous solution of morin (33 μM). The segments were then examined under a microscope (Ziess Axioscope, Jena, Germany) using settings described by Eticha et al. (2005). To ensure valid comparisons between roots of different genotypes, pictures of equivalent regions of roots were taken at the same exposure and magnification.

Analysis of organic anions

Seed was surface-sterilized by a 1 min wash in 70% (v/v) ethanol and then incubation for 15 min in 5 g l−1 sodium hypochlorite (NaOCl). After the NaOCl treatment, seed was rinsed six times with sterile water before being transferred to either conical flasks or petri dishes. Seedlings were grown submerged under sterile conditions with shaking (c. 60 rpm on a rotary shaker) in 20–40 ml of 0.2 mM calcium chloride (CaCl2). For some experiments the above treatment was insufficient to suppress microbial growth and hence seeds were also treated overnight with antifungal reagents such as Vitavax (0.1 mg ml−1 active ingredient carboxin 750 g kg−1 filter-sterilized) or Thiram 80 (1.40 mg ml−1; active ingredient bis(dimethylthiocarbonyl) disulfide). The seeds were then transferred to sterile flasks or dishes containing 0.2 mM CaCl2. In some experiments Vitavax (5 μg ml−1) and the antibiotic Timentin (200 μg ml−1, active reagents ticarcillin sodium and potassium clavulanate) were included in the growth solution to prevent microbial growth. Preliminary experiments verified that neither growth of seedling nor efflux of organic anions from root segments were affected when compared to seedlings grown in the absence of the antimicrobial agents. After 4 d growth, roots were cut into segments and assayed for citrate and malate efflux as described by Ryan et al. (2009).

Analysis of TaALMT1 expression

TaALMT1 expression in various root segments of the genotype ET8 was analysed by real-time quantitative PCR as described by Ryan et al. (2009) and Delhaize et al. (2004). The primers CGTGAAAGCAGCGGAAAGCC and CCCTCGACTCACGGTACTAACAACG were used to amplify TaALMT1 transcripts. The wheat genes encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH: GenBank accession EF592180) and α-tubulin (GenBank accession DQ435671) were used as reference genes. Primer pair TGTTGAGGGTTTGATGACCAC and TCAGACTCCTCCTTGATAGC amplified GAPDH and primer pair TCCAGTTCGTCGACTGGTGC and TCCTCGTAGTCCTTCTCCAG amplified α-tubulin.

Statistical analyses

Data were analysed by one- or two-way analysis of variance using the GenStat (13th edition; VSN International Ltd, Hertz, UK) or SigmaPlot V. 11 (SysStat Software Inc., Chicago, IL, USA) software packages. Where necessary, the Tukey test was used for multiple pairwise comparisons.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Optimization of rhizosheath screen

Two wheat cultivars that differed in rhizosheath sizes were used to optimize the screen and to determine the effects that soil moisture, bulk density and pH had on rhizosheath size. Rhizosheaths on cv Fronteira were significantly larger than those on cv EGA-Burke regardless of soil moisture content (Fig. 1a). These genotypic differences were maintained across a range of soil bulk densities although differences were attenuated at the highest bulk density (Fig. 1b) which coincided with reduced root growth for both cultivars (data not shown). By contrast, soil pH had a marked effect on rhizosheath size, particularly for cv EGA-Burke (Fig. 1c). The difference between cultivars was reduced at the two highest liming rates (soil pH 4.85 and 5.35) compared to the two lowest rates (soil pH 4.36 and 4.48). For subsequent routine rhizosheath screens, seedlings were grown on soil with water added to 80% field capacity (equivalent to 220 ml kg−1 dry soil, Fig. 1a), a bulk density of c. 0.80 g cm−3 and with a soil pH of between 4.3 and 4.5. When screening the backcrossed lines cvs Fronteira (large rhizosheath) and EGA-Burke (small rhizosheath) were included as controls and the Brazilian cv Carazinho (intermediate rhizosheath) was included as a third control in a few experiments. The inclusion of these controls provided reference points for rhizosheath sizes to take into account variations in soil properties, particularly pH, between different batches of soil.

image

Figure 1. Effects of soil moisture, bulk density and pH on rhizosheath formation of two contrasting wheat (Triticum aestivum) genotypes. (a) Effect of soil moisture on rhizosheaths of wheat cv Fronteira (closed circles) and cv EGA-Burke (open circles) grown on soil of pH 4.3 at a bulk density of 0.8 g cm−3 (n = 4). The bar denotes the least significant differences (P = 0.05) for the interaction of soil moisture by genotype. (b) Effect of soil bulk density on rhizosheaths of cv Fronteira (closed bars) and cv EGA-Burke (open bars) grown on soil of pH 4.3 and water added to 80% field capacity (n = 5). The effect of soil bulk density and the interaction between soil bulk density and genotype were not significant and the bar denotes the least significant difference (P = 0.05) for differences between genotypes. (c) Effect of soil pH modified by liming on rhizosheaths of cv Fronteira (closed bars) and cv EGA-Burke (open bars) grown on soil with a bulk density of 0.8 g cm−3 and water added to 80% field capacity (n = 4). There was a significant effect of liming but the interaction between liming and genotype was not significant. Pairwise multiple comparisons using the Tukey test identified significant differences (P = 0.05) between the genotypes at each liming treatment. The bar denotes the least significant difference (P = 0.05) between liming treatments.

Download figure to PowerPoint

Germplasm screen

We screened a diverse range of wheat germplasm (75 genotypes) in both the glasshouse and growth cabinet with a subset of the data shown in Fig. 2(a,b). As described previously (Haling et al., 2010b), the Brazilian cv Carazinho possessed a relatively large rhizosheath compared to other wheat cultivars. Additional cultivars of Brazilian origin also had substantial rhizosheaths (Fig. 2a). In particular, cv Fronteira had the largest rhizosheath and this cultivar was subsequently used to generate backcross lines (as described in the next paragraph). All the Brazilian cultivars screened possess the Al3+-tolerant allele of TaALMT1, a major gene for Al3+ tolerance in wheat (Raman et al., 2008). Some Australian cultivars (e.g Westonia, Yitpi, EGA-Burke and Arrino) also possess the same TaALMT1 allele and although their rhizosheaths were smaller than those of cv Fronteira, they were larger than genotypes that possess the Al3+-sensitive TaALMT1 allele (e.g. cv Chara and cv Spica; Fig. 2a,b). To determine the contribution of TaALMT1 to rhizosheath development more rigorously, near-isogenic lines of wheat (ET8 and ES8) that differ in their TaALMT1 alleles and transgenic wheat expressing TaALMT1(T2_4.4), along with a null control line (T2_4.13), were assessed for rhizosheath size. Both the near-isogenic wheat line that expresses the tolerant TaALMT1 allele and the transgenic wheat line expressing TaALMT1 had significantly larger rhizosheaths than their respective controls, although these were small compared to cv Fronteira (Fig. 2c). TaALMT1 was expressed in root segments up to at least 1 cm from the root apex in ET8, well within the root hair zone. However, malate efflux was not detected above background in segments beyond the first 3 mm of the root apex (Fig. S1).

image

Figure 2. Genotype screens for rhizosheaths on acid soil. (a) Subset of genotypes screened for rhizosheath size in a glasshouse. Maringa, Carazinho, Fronteira and Frontana are all wheat (Triticum aestivum) cultivars originating from Brazil. (b) Subset of genotypes screened for rhizosheath size in a controlled growth cabinet. The cvs Fronteira (black) and EGA-Burke (grey) were selected to generate backcrossed germplasm with contrasting rhizosheaths. (c) Effect of TaALMT1 on rhizosheath size as assessed by near-isogenic wheat lines that differ in their TaALMT1 alleles (white) and transgenic wheat overexpressing TaALMT1 (grey). For the near-isogenic lines, ES8 possesses the Al3+-sensitive TaALMT1 allele whereas ET8 possesses the Al3+-tolerant allele. The transgenic wheat is denoted as T2_4.4 and its sister ‘null’ line that lacks the transgene is denoted as T2_4.13. Other control genotypes are shown as black bars. Bars denote the least significant differences (LSD; P = 0.05) between means (n = 4 or 5).

Download figure to PowerPoint

In order to develop lines more suited for physiological studies than comparisons between unrelated cultivars, we initiated crosses between large and small rhizosheath genotypes. We chose cv EGA-Burke as a current Australian cultivar that possesses the same Al3+-tolerant TaALMT1 allele as cv Fronteira to avoid segregation of a rhizosheath component due to this gene. Furthermore, this avoided the potential confounding effects of differences in root length that could occur on acid soil due to differences in Al3+ tolerance of the genotypes. The F1 of a cross between cv Fronteira and cv EGA-Burke had an intermediate rhizosheath and this was also apparent in a cross between cv Carazinho and cv EGA-Burke (Fig. 3a). The F1 seedlings at each backcross using cv Fronteira parent as the donor had rhizosheaths that ranged from being intermediate between the parental cultivars to those that were similar to cv EGA-Burke (data not shown). At the third backcross, F2 seedlings derived from a single BC3F1 plant were screened resulting in a distribution that was skewed towards the cv EGA-Burke parental line (Fig. 3b).

image

Figure 3. Rhizosheaths of germplasm derived from crosses between genotypes of contrasting rhizosheath size. (a) Rhizosheaths on F1Triticum aestivum seedlings (grey) derived from EGA-Burke by Fronteira (F1 EXF) and EGA-Burke by Carazinho (F1 EXC) crosses. The bar denotes the least significant difference (P = 0.05) between means (n = 10). (b) Frequency distribution for rhizosheaths of a BC3F2 population derived from an EGA-Burke by Fronteira cross. Values for rhizosheaths were allocated into ‘bins’ incrementing by 0.2 g m−1 and mean rhizosheath values for the parental genotypes are shown by the arrows (1.62 ± 0.01 and 4.74 ± 0.28 g m−1 for cv EGA-Burke and cv Fronteira respectively; means ± SE, n = 6). The data are from one of two batches each comprising 100 seedlings screened for rhizosheaths. Twenty seedlings from the tails of the distribution were selected for further analysis and used to derive contrasting BC3F4 lines.

Download figure to PowerPoint

Individual seedlings selected at the ‘tails’ of the BC3F2 distribution were self-fertilized to generate BC3F3 lines with large and small rhizosheaths. Analysis of rhizosheaths suggested that some of these lines were segregating (data not shown) so individual seedlings of each line with either the largest rhizosheath (large lines) or smallest rhizosheath (small lines) were selected to generate BC3F4 lines. Five of these lines in each category (L-BC3F4 and S-BC3F4 for large and small rhizosheaths, respectively) appeared to be homozygous for major rhizosheath alleles based on small plant-to-plant variation within a total of 18–20 seedlings across several experiments.

Rhizosheath size is associated with tolerance of root hairs to Al3+ and low pH

On acid soil the cultivars EGA-Burke and Fronteira differed markedly in both rhizosheath size and root hair length (Fig. 4). The L-BC3F4 lines had rhizosheaths and root hairs that were comparable to cv Carazinho but smaller than those of cv Fronteira (Fig. 5a,b). By contrast, rhizosheaths and root hairs of S-BC3F4 lines were similar to the recurrent parent, cv EGA-Burke. A strong positive correlation was detected between root hair length and rhizosheath size among all these lines on acid soil (Fig. 5c). When grown in limed soil with a pH near neutral (pH 6.7), cv EGA-Burke possessed a rhizosheath comparable to cv Fronteira and this was associated with an increase in root hair length compared to the acid soil (Table 1). By contrast, although rhizosheaths were marginally increased in the limed soil, root hair length of cv Fronteira was not affected by soil pH.

image

Figure 4. Rhizosheaths and root hairs on roots of Triticum aestivum (a, b) cv EGA-Burke and (c, d) cv Fronteira seedlings grown on acid soil for 3 d. For root hairs a 5-mm segment was excised from a secondary seminal root at a distance below the seed one-quarter of the total length of the root.

Download figure to PowerPoint

image

Figure 5. Root hair length and rhizosheath size of parental and backcrossed wheat (Triticum aestivum) lines. (a) Rhizosheaths of S-BC3F4 (S1 to S5; white) lines, L-BC3F4 (L1 to L5; black) lines and control lines (hatched and grey bars). (b) Root hair lengths of S-BC3F4 (S1 to S5; white) lines, L-BC3F4 (L1 to L5; black) lines and control lines (hatched and grey). (c) Relationship between root hair length and rhizosheath size (equation of line: y = 2.56x + 0.158). For panels (a) and (b) the bars denote the least significant differences (P = 0.05) between means (n = 4). Data for panel (c) are derived from individual seedling values used to generate panels (a) and (b).

Download figure to PowerPoint

Table 1.   Effects of soil pH on rhizosheaths and root hair lengths of wheat (Triticum aestivum) cultivars EGA-Burke and Fronteira
Genotype and treatmentRhizosheath (g m−1)Root hair length (mm)
  1. aThe acid soil had a pH of 4.3.

  2. bThe limed soil had a pH of 6.7.

  3. cLSD denotes the least significant differences (P = 0.05) between means (n = 4) for the interaction of soil treatment by genotype.

EGA-Burke
 Acid soila1.210.31
 Limed soilb3.880.85
Fronteira
 Acid soil3.450.90
 Limed soil4.560.95
 LSDc0.570.11

It was not possible to establish the soil component responsible for differences in root hair lengths between the various genotypes as lime application alters not only pH but also changes concentrations of other ions in the soil solution. For example, rhizosheath size was inversely correlated with the amount of extractable Al but it was not possible to identify Al3+ as the agent responsible for inhibiting rhizosheath development because the concentration of other ions such as Mn2+, H+ and Ca2+ also varied at the different liming rates (data not shown). For this reason we used hydroponic culture where the concentration of ions such as Al3+ and H+ could be controlled independently of one another.

Initial hydroponic experiments were aimed at establishing the effects of Al3+ and pH on root hair length of the three control genotypes (all Al3+-tolerant) and on cv Egret, an Al3+-sensitive cultivar. The cv Fronteira had the longest root hairs in basal solution (no Al3+) and addition of Al3+ further stimulated root hair length (Fig. 6a). The cv Carazinho showed a similar trend but root hairs were always shorter than those of cv Fronteira at all treatments. The length of root hairs in cv EGA-Burke were not stimulated by Al3+ and declined by c. 50% at the highest Al3+ treatment. Root hairs were inhibited on cv Egret at the lowest Al3+ concentration and this was also reflected in the sensitivity of the genotype to Al3+ based on root growth (Fig. 6a,b). Root hair length was affected by pH and genotypic differences disappeared at the highest pH tested where the lengths of all genotypes were increased when compared to plants grown at pH 4.3 (Fig. 6c).

image

Figure 6. Effects of Al3+ and pH on root hair length of various wheat (Triticum aestivum) genotypes grown in hydroponic culture. Effect of Al3+ on (a) length of root hairs and (b) root growth of four wheat genotypes varying in Al3+ tolerance and ability to form rhizosheaths. (c) Effect of pH on root hair length of the four wheat genotypes. Pre-germinated seedlings were grown for 4 d in hydroponic culture with the indicated treatments after which root hair and root lengths were measured. For (a) and (b) the solution had a pH of 4.3 to ensure the presence of toxic Al3+. Bars denote the least significant differences (P = 0.05) between means (n = 4) for the interactions of (a) Al treatment by genotype, (b) pH by genotype and (c) pH by genotype. The absence of columns for the two highest treatments of Egret in panel (a) indicates that no root hairs were apparent on the roots.

Download figure to PowerPoint

In low pH solution (pH 4.3) without added Al3+, root hair lengths of all BC3F4 lines were similar to cv EGA-Burke (Fig. 7). The BC3F4 lines behaved similarly to one another in the absence of Al3+ but differed markedly when grown in the 20 μM AlCl3 treatment. All L-BC3F4 lines along with cv Fronteira maintained their root hairs in the presence of Al3+ whereas root hairs were severely inhibited in all S-BC3F4 lines and similarly in cv EGA-Burke (Fig. 7). Seedlings were grown in the same solutions over 13 d to establish whether there were genotypic differences in the uptake of mineral nutrients that could be attributed to differences in root hair length. Only root Mn concentrations consistently differed between the large rhizosheath and small rhizosheath BC3F5 lines when grown with Al3+ (Tables S2,S3). The L-BC3F5 lines had c. 20% greater Mn concentration than the S- BC3F5 lines whereas the content in cv Fronteira was more than twofold greater than all other genotypes. A significant interaction between Al3+ treatment and genotype was also evident in concentrations of root Mg and, again, cv Fronteira differed most markedly from the other genotypes. In addition there were significant treatment effects on a range of elemental concentrations in roots and shoots such as Al3+ treatment resulting in decreased Mg and increased Al concentrations in both tissues (Tables S2,S3).

image

Figure 7. Effect of Al3+ on root hair lengths of backcrossed wheat (Triticum aestivum) lines grown in hydroponic culture. Wheat lines were grown in solution of pH 4.3 either in the absence of Al3+ (open bars) or in solution that contained 20 μM AlCl3 (closed bars) for 4 d before root hairs were measured. L1 to L4 denotes four L-BC3F4 lines and S1 and S2 denotes two S-BC3F4 lines. Because of non-homogeneous variances, the data (n = 3 or 4) were natural log transformed before a two-way ANOVA was undertaken. An asterisk denotes where a significant difference between treatments for a given genotype was apparent from pair-wise multiple comparisons using the Tukey test (*, P = 0.05).

Download figure to PowerPoint

Root Al concentrations did not differ between the genotypes but differences in accumulation of Al by root hairs may have been masked by the Al accumulated into other root cells. To address this problem, we used the fluorescent stain morin to qualitatively assess the accumulation of Al in root hairs for the various lines. Compared to other lines, cv Fronteira had less intense fluorescence but no obvious differences between large and small rhizosheath BC3F5 lines were apparent over a range of Al3+ treatments (Fig. S2).

Efflux of organic anions

The efflux of organic anions could conceivably protect root hairs from Al3+ toxicity and be the underlying mechanism for the rhizosheath phenotype. To investigate this hypothesis we measured the efflux of malate and citrate in root segments of the parental cultivars along with cv Carazinho both in the presence and absence of Al3+. The cultivars EGA-Burke and Fronteira did not differ in malate efflux from any root segment either in the presence or absence of Al3+ (Fig. S3). Al3+ activated the efflux of malate from the root apex of all three cultivars (0–5 mm segment; compare Fig. S3a,b) as expected for genotypes that possess the tolerant allele of the TaALMT1 gene. The cv Carazinho had a markedly greater constitutive citrate efflux from the root apex compared to the two other genotypes (Fig. S4) and relatively low efflux was observed in more mature segments of all genotypes. The cv Fronteira had a tendency for greater citrate efflux than EGA-Burke regardless of Al3+ treatment particularly from the more mature segments (Fig. S4a,b). When cv EGA-Burke and cv Fronteira were analysed in isolation, cv Fronteira consistently maintained a greater constitutive citrate efflux with the 5–15 mm segments showing the most pronounced difference (Fig. S4c). Analysis of citrate efflux from this 5–15-mm segment of BC3F5 rhizosheath and parental lines showed that cv Fronteira had the greatest efflux whereas the four BC3F5 lines, regardless of their rhizosheath phenotypes, had similar efflux to cv EGA-Burke (Fig. 8). Despite the enhanced citrate efflux from cv Fronteira, internal citrate concentrations in the 5–15-mm segment were similar for both cv Fronteira and cv EGA-Burke (cv Fronteira: 23.1 ± 0.9 μM; cv EGA-Burke 19.3 ± 1.4 μM; means ± SE, n = 4, ns for a t-test at P < 0.05).

image

Figure 8. Citrate efflux from root segments of Triticum aestivum BC3F5 and parental lines differing in rhizosheath size. After seedlings were grown in 0.2 mM CaCl2 under sterile culture for 4 d, root segments (5–15-mm region measured from the root apex) were excised and assayed for citrate efflux. L1 and L4 denote two L-BC3F5 lines and S1 and S2 denote two S-BC3F5 lines. The bar denotes the least significant differences (P = 0.05) between means (n = 6) and the asterisk indicates that Fronteira differed from all other genotypes.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Of the soil parameters tested, pH had the greatest effect on the rhizosheaths of the wheat genotypes. Experiments in hydroponic solutions were able to separate the effects of H+ stress from those of Al3+ toxicity. These results showed that the genotypic variation in rhizosheath size on acid soil was primarily due to differences in the Al3+ tolerance of root hairs. Genotypes able to maintain the largest rhizosheaths in acid soil were all derived from Brazilian germplasm that possessed an Al3+-tolerant allele of TaALMT1. Analysis of near-isogenic wheat lines differing at the TaALMT1 locus and transgenic wheat expressing TaALMT1 indicated that this gene contributes towards maintaining a rhizosheath in acid soil.

TaALMT1 encodes an Al3+-activated transport protein that is responsible for the efflux of malate from apical root cells (Sasaki et al., 2004). Malate binds phytotoxic Al3+ as a harmless chelate and serves to protect the sensitive cells of the root apex allowing roots to grow in acid soil. Although malate is secreted predominately by the terminal 2–3 mm of the root tip where root hairs are absent (Ryan et al., 1995), a low level of efflux into the apoplast in more mature parts of the root may have contributed towards protecting root hairs from Al3+ toxicity and helped to maintain a small rhizosheath. This is likely as TaALMT1 continued to be expressed in root segments well back from the apex in regions where root hairs are present (Fig. S1). Previous experiments with transgenic barley lines expressing TaALMT1 and the near-isogenic wheat lines did not consistently identify a positive contribution of TaALMT1 towards forming a rhizosheath in acid soil (Delhaize et al., 2009; Haling et al., 2010b). The current experiments differed from those previous experiments in that plants were grown under controlled conditions in a cabinet instead of a glasshouse and harvested after 3 d instead of 7 d growth to avoid the variability associated with measuring rhizosheaths on roots that had already developed laterals. In addition, the soil was sieved after it was moistened whereas aggregates likely contributed to the variability of the earlier experiments where the soil was not sieved after being moistened.

Although TaALMT1 confers a rhizosheath in acid soil, on its own it does not explain the large rhizosheaths found on cultivars such as Carazinho and Fronteira nor does it explain the differences in rhizosheath size in the backcross lines because parental genotypes possessed the same TaALMT1 allele. The presence of other genes that contribute towards formation of rhizosheaths is apparent from the analysis of progeny derived from crosses between genotypes differing in rhizosheaths. The F1 generation from crosses between large and small rhizosheath genotypes were intermediate between the parental lines indicative of additive alleles for rhizosheath size. Analysis of a BC3F2 population derived from cv EGA-Burke by cv Fronteira backcrosses showed rhizosheaths to be distributed between the parental lines without a clear segregation suggesting that several genes likely contributed to the phenotype. Although no individual of the BC3F2 population recovered the full phenotype of cv Fronteira, we show that it is possible to substantially increase rhizosheath sizes of a current wheat cultivar by a series of backcrosses with selection using a relatively simple phenotypic screen.

The strong, positive correlation between root hair length and rhizosheath size suggests that genotypic differences in tolerance of root hairs to acid soil are responsible for the differences in rhizosheath size. This was validated by the observation that the L-BC3F4 lines all possessed longer root hairs than their sister S-BC3F4 lines when grown on acid soil where selections at each generation were based entirely on rhizosheath size. We conclude that rhizosheath size is a reliable surrogate for root hair length in wheat seedlings grown on these soils. Rhizosheaths are easier to measure than root hair length and this method can be adopted by breeding programmes aimed at increasing the acid-soil tolerance of root hairs in selected cultivars. Although root hair length appeared to be the main factor underlying the genetic variation in rhizosheath size in the germplasm studied here, it is likely that the hairs provide both structural support as well as mucilage to bind soil particles. Variation in ability to produce mucilage could also contribute towards variation in rhizosheath size in other genotypes and species. For instance, mucilage is known to adhere strongly to soil particles and is thought to be important for formation of a stable rhizosheath (McCully, 1999). Although the chemical components that provide this adhesion are not known and can even be of microbial origin, they are likely to comprise high molecular weight polysaccharides in contrast to the low molecular weight organic anions implicated in Al3+ tolerance mechanisms for root growth.

When grown in hydroponic culture, root hairs of the genotypes tested differed significantly in their tolerance to Al3+ and low pH. The L-BC3F4 lines and cv Fronteira maintained longer root hairs than S-BC3F4 lines and cv EGA-Burke when exposed to Al3+ reflecting the differences observed when seedlings were grown in acid soil. The cv Fronteira also maintained longer root hairs than all other genotypes when grown in low pH solution without added Al3+. The positive effect of Al3+ on root hair length observed for some genotypes grown in hydroponics (Fig. 6a) can be explained by an alleviation of proton toxicity by Al3+ as occurs for root growth (Kinraide, 1993). Enhanced tolerance of root hairs to low pH might be another contributing factor responsible for the particularly large rhizosheaths of cv Fronteira. Root hairs in wheat lines we tested appeared to be generally sensitive of low pH with a four- to fivefold increase in length at pH 5.8 when compared to pH 4.3 (Fig. 6c). The relatively large increase in root hair length of all wheat genotypes at pH 5.8 compared to pH 4.3 in hydroponics was not observed in soil-grown plants. The length of root hairs in cv Fronteira was the same in soil of pH 4.3 and pH 6.7 (Table 1) indicating that effects of pH in hydroponics do not necessarily reflect effects of pH in the more complex environment of a soil.

The citrate efflux from mature root segments of cv Fronteira where root hairs proliferated could conceivably have protected the hairs from Al3+ toxicity. However, the BC3F5 lines did not differ in citrate efflux regardless of their rhizosheath phenotype and therefore this mechanism does not explain the differences in Al3+ tolerance of root hairs for these backcrossed lines. The cv Carazinho had a constitutive efflux of citrate from its root apices which confers a degree of Al3+ tolerance to root growth (Fig. S4 and Ryan et al., 2009). The parents of the backcrossed lines do not possess this trait which discounts its involvement in the Al3+ tolerance of root hairs. Therefore, neither of two previously characterized mechanisms conferring Al3+ tolerance in wheat (malate and citrate efflux from root apices) appear to be protecting root hairs in the rhizosheath lines (Delhaize et al., 2004; Ryan et al., 2009). Morin staining supports this conclusion as there were no obvious differences in Al accumulated by root hairs between genotypes as would be expected if Al was being excluded by organic anion efflux. However, results obtained from staining with morin need to be interpreted with caution as not all forms of Al, such as Al bound to cell walls, are accessible to the dye (Eticha et al., 2005).

While it is likely that rhizosheaths are important for nutrient uptake and in maintaining soil moisture around roots in dry soil, these roles are largely speculative owing to the absence of defined experimental systems. The elemental composition of BC3F5 lines did not differ markedly between the large and small rhizosheath lines in the Al3+ treatment consistent with root hair length being of minor importance for uptake of nutrients from hydroponic culture. Direct effects of root hair lengths on nutrient uptake are more likely to be found in soil-grown plants when poorly mobile nutrients limit growth. For example, the role of root hairs in the uptake of zinc and phosphate from soil has been established by comparing barley and Arabidopsis mutants that lack root hairs with their respective wild types under nutrient-limited conditions (Bates & Lynch, 2000a,b; Gahoonia et al., 2001; Gahoonia & Nielsen, 2003; Genc et al., 2007). The development here of backcrossed wheat germplasm differing in rhizosheath size provides a useful experimental system for quantifying the effect that natural variation in root hair length has on the mineral nutrition and water relations of wheat grown on acid soil.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Dr Alan Richardson of CSIRO Plant Industry for helpful advice in relation to soils and experimental procedures.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1 TaALMT1 expression and malate efflux from root segments of the wheat genotype ET8.

Fig. S2 Roots stained for Al distribution with the dye morin.

Fig. S3 Malate efflux from root segments of various wheat cultivars.

Fig. S4 Citrate efflux from root segments of various wheat cultivars.

Table S1 Chemical properties of a ferrosol soil with and without addition of lime

Table S2 Elemental composition of roots

Table S3 Elemental composition of shoots

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

FilenameFormatSizeDescription
NPH_4183_sm_FigS1-S4-TableS1-S3.docx13643KSupporting info item