SEARCH

SEARCH BY CITATION

Keywords:

  • copy number variation;
  • gene expression;
  • plant height;
  • tandem segmental duplication (TSD);
  • wheat (Triticum aestivum)

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Rht-D1c (Rht10) carried by Chinese wheat (Triticum aestivum) line Aibian 1 is an allele at the Rht-D1 locus. Among the Rht-1 alleles, little is known about Rht-D1c although it determines an extreme dwarf phenotype in wheat.
  • Here, we cloned and functionally characterized Rht-D1c using a combination of Southern blotting, target region sequencing, gene expression analysis and transgenic experiments.
  • We found that the Rht-D1c allele was generated through a tandem segmental duplication (TSD) of a > 1 Mb region, resulting in two copies of the Rht-D1b. Two copies of Rht-D1b in the TSD were three-fold more effective in reducing plant height than a single copy, and transformation with a segment containing the tandemly duplicated copy of Rht-D1b resulted in the same level of reduction of plant height as the original copy in Aibian 1.
  • Our results suggest that changes in gene copy number are one of the important sources of genetic diversity and some of these changes could be directly associated with important traits in crops.

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Semi-dwarfing genes in wheat made a significant contribution to the ‘Green revolution’ in the 1960s and are now deployed in most modern wheat varieties. Twenty-one reduced height genes in wheat, Rht1 to Rht21, have been described (http://wheat.pw.usda.gov/GG2/Triticum/wgc/2008/GeneSymbol.pdf). Among them, four genes, originally named Rht1, Rht3, Rht2 and Rht10, were re-designated as Rht-B1b, Rht-B1c, Rht-D1b and Rht-D1c, respectively, when they were shown to be alleles at two loci. The dwarfing alleles were gibberellic acid (GA) insensitive whereas the wild-type alleles were sensitive. The ‘Green revolution’ genes Rht-B1b and Rht-D1b were mapped on the short arms of chromosomes 4B and 4D, respectively, and were extensively used for improving wheat yields. These genes were cloned by Peng et al. (1999) using a comparative genomics cloning approach. Both Rht-B1b and Rht-D1b encode DELLA proteins truncated in the region responsible for the GA response, relative to the wild type alleles Rht-B1a and Rht-D1a present in tall wheat such as Chinese Spring. DELLA proteins are negative regulators of GA-induced growth. In the absence of GA, DELLA proteins repress expression of GA response genes resulting in slow growth, whereas with GA, there is induced phosphorylation of DELLA proteins via an unidentified kinase. The SCFSLY1 complex interacts with the GRAS domain of DELLA proteins and targets their polyubiquitination and degradation via the ubiquitin–26S proteasome pathway (Dill et al., 2004). Small deletions of the DELLA protein that interfere with degradation (Itoh et al., 2002, 2005; Liu et al., 2010), such as a gai mutant of the Arabidopsis DELLA domain that lacks 17 amino acids near the N terminus, cause dwarf stature (Fleck & Harberd, 2002) due to constant gene repression even in the presence of GA. Similarly, a T-to-G substitution converts the E61 codon (GGA) to a translational stop codon (TGA) in the Rht-D1b allele and the resultant N-terminally truncated product confers short stature (Peng et al., 1999). Overexpression of DELLA proteins is also a powerful way to reduce stature. Low-level gai expression caused relatively mild height reduction, whereas high-level gai expression resulted in more severe dwarfism in Arabidopsis (Fu et al., 2001).

Gene duplication has long been recognized as an important source of genetic variation (Ohno, 1970; Taylor & Raes, 2004) and is considered to have a large influence on both protein (Pal et al., 2006) and morphological evolution (Carroll, 2005). Duplications are classified into three types: segmental, tandem and dispersed. Bailey et al. (2002) estimated that at least 5% of the human genome consists of segmental duplications, and a number of human genetic disorders are known to be associated with the increased transcript level of duplicate genes (Lynch, 2002). In plants, only a few traits have been associated with segmental gene duplication and in these cases the segmental duplication sizes vary from tens to hundreds of kilobase pairs. Examples include heavy metal resistance in Arabidopsis halleri (Hanikenne et al., 2008), boron tolerance in barley (Sutton et al., 2007), and submergence tolerance (Xu et al., 2006) and durable panicle blast resistance in rice (Hayashi et al., 2010).

Aibian 1, a hexaploid wheat accession with a plant height of only 25–30 cm, discovered in Shanxi province, China, carries the dominant dwarfing gene, Rht10 (later renamed Rht-D1c) on chromosome 4DS (Izumi et al., 1981, 1983; Börner & Mettin, 1988). Among all the wheat dwarfing genes, Rht-D1c exhibits complete dominance and the strongest plant height reduction. In addition to its scientific value for understanding the regulation of plant growth, Rht-D1c is also useful in wheat breeding. A completely dominant male sterility gene ms2 occurs in the same region of chromosome 4D (Deng & Gao, 1982, 1987; Liu & Deng, 1986). Liu (2001) estimated that the genetic distance between the ms2 and Rht-D1c loci is 0.18 cM. Liu (1987) bred wheat line Aibai, in which ms2 and Rht-D1c are so tightly linked that nearly all short plants are sterile and nearly all tall plants are fertile. Because the sterile plants are shorter and easily recognized, they can be selectively pollinated in breeding programmes, and are especially valuable for recurrent selection. Forty-two wheat varieties were bred using these materials, and some of which have been widely cultivated in China. Despite its major impact on breeding, the gene structure and mechanism of height reduction in Aibai remained unknown. In this paper, we provide evidence showing that Rht-D1c is caused by a segmental duplication, resulting in the increased expression of the Rht gene and further reduction of plant height.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Plant materials

Materials included wheat (Triticum aestivum L.) Aibai carrying the tightly linked dominant genes – male sterile gene ms2 and reduced height gene Rht-D1c– and an Aibai/15*CS NIL, which was generated by backcrossing the ‘dwarf and sterility’ donor cultivar Aibai with the recurrent parent Chinese Spring carrying Rht-D1a for 14 generations. The ms2 allele is completely dominant; and both Rht-D1c and ms2 are heterozygous in Aibai/15*CS NIL. Two plant height populations were used in this study: a dwarf NIL population of c. 60 cm and a semi-dwarf NIL population of c. 85 cm.

Aibian 1 with Rht-D1c, Youbao carrying Rht-D1b, Norin 10 with Rht-B1b and Rht-D1b, Chinese Spring with Rht-D1a and Chinese Spring nullisomic-tetrasomic lines for homeologous group 4 chromosomes (N4AT4B, Mono4BT4A, N4DT4B) were also used.

Cosegregation analysis

Rht-D1b gene-specific primers were designed as follows: 5′-ACGTGGCGCAGAAGCTGT-3′ and 5′-CAGGACTCGTAGAAGTGCGCGT-3′, which correspond to 164–181 bp position and 941–920 bp position of the Rht-D1b coding region. The primers were used for the segregation analysis in Aibai/CS NILs.

Southern blot analysis

DNA isolation and Southern blots were performed as described by Chao et al. (1989) with minor modifications. Twenty micrograms of genomic DNA was used to make each blot. Probes used in the study were designed according to the collinearity in the Rht-D1b region of rice and wheat. These rice genes were LOC_Os03g49610, LOC_Os03g49710, LOC_Os03g49730, LOC_Os03g49900, LOC_Os03g49940, LOC_Os03g50030 and LOC_Os03g50070. These gene names were abbreviated to 49610-like, 49710-like, 49730-like, 49900-like, 49940-like, 50030-like and 50070-like, respectively. To estimate the Rht-D1b copy number variation, Quantity one v4.6.1 software (BioRad) was used to analyse the hybridization signal intensity on Southern blot. Based on the instructions in the Volumes Quick Guide, we set the 4DS band of CS as standard, other materials as unknown, and in the Volume Analysis Report, selected Volume, then got the relative concentration.

Aibai/CS BAC library construction and screening

The dwarf Aibai/CS near-isogenic line was used to construct a BAC library according to the method described by Zhang et al. (1995) and Ma et al. (2000). The BAC library was screened using a PCR method described by Isidore et al. (2005). All the primers used for screening were 4D-specific based on PCR analyses using Chinese Spring nullisomic/tetrasomic lines N4AT4B, N4DT4A and line mono4B4A. A BAC-by-BAC shotgun method at 5–9× sequencing coverage and sequence assembly were followed by Kong et al. (2004).

Quantitative real-time PCR (Q-PCR) and RT-PCR

Total RNA from internodes below spikes were isolated using Trizol reagent and reverse transcribed using the SuperScript II Reverse Transcriptase (Invitrogen). Quantitative real-time PCR was carried out with SYBR®Premix Ex Taq™ (TaKaRa, Ohtsu, Shiga, Japan) on ABI Prism 7300 (Applied Biosystems, Foster, CA, USA). The expression of Rht-D1 was normalized against the housekeeping gene GAPDH in all samples and relative gene expression was analysed by the inline image method compared with CS in wheat. To determine the copy number of Rht-D1 in Aibian 1 and Aibai NILs by Q-PCR, we used the 50070-like gene as a reference – for its location on the outside of the Rht-D1b duplicated region and having the same copy number in the Aibian 1, Aibai and CS – and the relative quantitative method with CS as a control. Gene amplifications were carried out by PCR using primers 5′-TGAGCATGGAGGACAACACAG-3′ and 5′-ATCCACCTCTTCACGCCA-3′ for Rht-D1, which was part of the 3′UTR of Rht-D1b and specific to chromosome 4DS that could amplify Rht-D1a and Rht-D1b, not specific to Rht-D1b; and 5′-TTAGACTTGCGAAGCCAGCA-3′ and 5′-AAATGCCCTTGAGGTTTCCC-3′ for GAPDH; and 5′-ACCTGACGGAAGTGCCAT-3′ and 5′-CCTAGTTAGAAGGCAACCATT-3′ for the 50070-like gene, which were specific to chromosome 4DS. Three sets of biologically independent replicates were used for each category of material. For RT-PCR in transgenic rice, the concentration of the cDNAs was adjusted using the rice actin gene with the primer sequences of 5′-CATTGGTGCTGAGCGTTTCC-3′ and 5′-AGAAACAAGCAGGAGGACGG-3′.

Generation of Rht-D1b transgenic wheat and rice

For generating transgenic plants overexpressing Rht-D1b, two constructs were made. The coding region Rht-D1b was obtained from BAC 1J9 with the primers 5′-GGAACCGAGGCAAGCAA-3′ and 5′-CCTGCAGGGGATTACATTACTACATGCCGGT-3′, and cloned into the vector pCAMBIA2200 (kindly gifted by Dr Andrzej Kilian, Canberra, Australia) under control of its own promoter region, which in turn was cloned from the BAC 1J9 with the primers 5′-GGTACCTACGCGTTGGAATGCTGGACAA-3′ and 5′-CTTCATGATCCGCGAGCTA-3′. In the process of single copy construction, the forward primer of the promoter region was linked with the KpnI sequence recognition site and the other side of the promoter joined to the 5′-terminal Rht-D1b with a HindIII sequence recognition site, while the 3′-terminal of Rht-1Db was linked to polyA with the SbfI sequence recognition site, which was cloned from the vector pJIT163 by the primers 5′-CCTGCAGGATGGCGTGCAGGTCGACT-3′ and 5′-GGTACCGATCTCTCGAGGATATCGC-3′. The KpnI sequence recognition site was added to the other side of the polyA site. The second construct comprised two parts: a single copy Rht-D1b with promoter and polyA was fully digested by KpnI, and the vector with a single copy Rht-D1b was partially digested. After ligation a tandem two-copy unit of Rht-D1b with its promoter and polyA sequences was identified. Plasmid constructs were introduced into Agrobacterium tumefaciens strain C58C1 and used for transformation of wheat cultivars Bobwhite and CB037. T0 and T1 transgenic wheat plants were grown in a glasshouse. The two constructs were also introduced into rice cv Zhonghua 11 by Agrobacterium tumefaciens strain GV3101. All transgene-containing plants from regenerated T0 and T1 were identified by PCR using primers designed from polyA: 5′-ATGGCGTGCAGGTCGACT-3′ and 5′-GATCTCTCGAGGATATCGC-3′.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The Rht10 (Rht-D1c) gene in Aibian 1 was allelic to Rht-D1b with a strong effect on reducing plant height

Aibai was crossed with Chinese Spring (CS), a tall variety, followed by 14 generations of backcrossing to CS. Two levels of plant height segregated in the BC14F1 population. There were 1414 dwarf plants (mean height 60 cm) and 1416 tall plants (mean height 113 cm), indicating a 1 : 1 segregation (χ2 = 0.0014, P < 0.001). These results suggested that the dwarf trait in Aibai was controlled by a single dominant gene, Rht10 (Rht-D1c), derived from Aibian 1. The result was consistent with previous reports of a dominant dwarfing gene in Aibian 1 (Izumi et al., 1981). All the dwarf plants were completely male sterile and the tall plants were fertile. The heterozygous dwarf plants were c. 60 cm and taller than Aibian 1 (Fig. 1). Interestingly, one semi-dwarf sterile plant (85 cm) found among > 13 000 plants in the Aibai/12*CS NIL population (Fig. 1) was crossed with Chinese Spring and followed by three generations of backcrossing to CS. Apart from its taller phenotype this plant had the same background as the Aibai/15*CS NIL population and was genotyped in subsequent experiments.

image

Figure 1. Relative plant heights of Chinese wheat (Triticum aestivum) Aibian 1 and Aibai/CS near-isogenic lines (NILs). 1, Aibian 1 (c. 30 cm); 2, dwarf plant from Aibai/15*CS (c. 62 cm); 3, semi-dwarf plant from Aibai/15* CS (c. 85 cm); 4, CS (c. 112 cm). Bar, 10 cm.

Download figure to PowerPoint

Rht-D1b and Rht-D1c were both mapped to the same region of chromosome 4DS (Izumi et al., 1983; Börner & Mettin, 1988). In order to study the relationship between Rht-D1b and Rht-D1c, an Rht-D1b-specific primer was designed based on the codon for specific E61 to stop codon mutation in Rht-D1b and used to detect the Rht-D1b alleles in Aibian 1 (Rht-D1c), Aibai (Rht-D1c), Youbao (Rht-D1b), Norin 10 (Rht-B1b + Rht-D1b) and CS (Rht-D1a) (Fig. 2a). All materials except CS amplified the Rht-D1b–specific band. The same marker was used to analyse the two segregating BC14F1 populations of Aibai/CS. Plant height co-segregated with the Rht-D1b marker; all dwarf plants, including the single semi-dwarf (85 cm), amplified the Rht-D1b marker whereas the tall plants did not (Fig. 2b,c). This confirmed that Rht-D1c was an allele of Rht-D1b as reported by Börner & Mettin (1988). However, it is still unclear why the effect of allele Rht-D1c and Rht-D1b on reducing plant height is significantly different.

image

Figure 2. Co-segregation between the Rht-D1b molecular marker and wheat (Triticum aestivum) materials with Rht-D1b. (a) Amplification of the Rht-D1b molecular marker in materials with Rht-D1b. 1, Aibian 1 (dwarf homozygote, c. 30 cm); 2, Aibai/15*CS (dwarf heterozygous near-isogenic line (NIL), c. 62 cm); 3, Aibai/15*CS (single semi-dwarf NIL plant, c. 85 cm); 4, CS (c. 112 cm); 5, Youbao (c. 90 cm); 6, Norin 10 (c. 66 cm). (b) Co-segregation between the Rht-D1b molecular marker and dwarf Aibai/CS near-isogenic lines. Dwarf NILs with bands were c. 60 cm; tall plants producing no band were c. 113 cm. (c) Co-segregation between the Rht-D1b molecular marker and semi-dwarf Aibai/CS near-isogenic lines (semi-dwarf NILs with bands were c. 85 cm, tall plants producing no band were c. 116 cm).

Download figure to PowerPoint

Copy number of Rht-D1b detected in Aibian 1 and its derivatives

The difference between Rht-D1c and Rht-D1b and their flanking sequences was further investigated using an Aibai BAC library constructed with a HindIII cloning site. The library consisted of one million clones with an average insert-size of 118 kb, representing c. 6.5-fold genome equivalents. Three BAC clones were identified from the Aibai BAC library by screening using the Rht-D1b-specific marker. One of the largest BAC clones (c. 200 kb) was sequenced and assembled (GenBank accession number HQ435325). Based on the flanking sequences of Rht-D1b, primers were designed to amplify 5 kb upstream and 3 kb downstream of Rht-D1b in Aibian 1, and the dwarf NIL Aibai. The results showed that the sequences from the two lines were identical to Rht-D1b.

Given that the Rht-D1c and Rht-D1b sequences were identical, Southern blotting and quantitative real-time PCR were carried out to examine if there was variation in gene copy number. The Rht-D1b gene was employed as a probe in Southern blot hybridization. The EcoRV hybridized fragment carrying Rht-D1c was located on homoeologous group 4 chromosomes using Chinese Spring nullisomic-tetrasomic lines (Fig. 3a). The strongest signal was detected in Aibian 1 (Rht-D1cRht-D1c), followed by Aibai (Rht-D1cRht-D1a), and the weakest in Chinese Spring (Rht-D1aRht-D1a) (Fig. 3a). Based on the quantification analyses using Quantity one v4.6.1 software, we estimated that there were two copies of Rht-D1b in Aibian 1, and 1.5 copies in Aibai due to its heterozygous status. One copy of Rht-D1b was detected in progenies derived from the single 85 cm-high semi-dwarf described above (Fig. 3a).

image

Figure 3. Rht-D1b copy number detection in wheat (Triticum aestivum) Aibian 1 and its derivatives by Southern blot and Q-PCR. (a) Southern blot of DNA digested with EcoRV and Rht-D1b as a probe. 1, Aibian 1; 2, dwarf plant of Aibai/CS; 3, semi-dwarf plant of Aibai/CS; 4, CS; 5, Norin 10; 6, CSN4AT4B (Chinese Spring nullisomic 4A-tetrasomic 4D line); 7, CS mono4BT4A (Chinese Spring monosomic 4B-tetrasomic 4A line); 8, CSN4DT4B (Chinese Spring nullisomic 4D-tetrasomic 4B line). Arrow indicates the 4D fragment. The band from 4DS had the difference on the signal intensity, but the band from 4A or 4B showed the almost same signal intensity in Aibian 1, dwarf plant of Aibai/CS, semi-dwarf plant of Aibai/CS and CS. This meant that the DNA was loaded the same amount for each sample. (b) Detection of the copy number of Rht-D1b in Aibian 1 and Aibai/CS NILs by Q-PCR. A 4DS-specific genomic sequence 50070-like gene was as a reference. 1, Aibian 1; 2, dwarf plant of Aibai/CS; 3, semi-dwarf plant of Aibai/CS; 4, CS. The error bars indicate +SD.

Download figure to PowerPoint

In order to further examine the variation in copy number of Rht-D1b, quantitative real-time PCR was performed on Aibian 1, Aibai/CS and CS using the 50070-like gene as a reference for constant copy number. The results were in agreement with those obtained by Southern hybridization, that is, 2 Rht-D1b copies in Aibian 1, 1.5 in Aibai and 1 in derivatives of the single 85-cm plant from the Aibai/CS NIL and CS (Fig. 3b). The same result was also revealed by the TaqMan PCR method (Supporting Information Fig. S1). These results revealed that the allelic variation between Rht-D1b and Rht-D1c is Rht-D1c allele in Aibian 1 containing two copies of Rht-D1b, likely caused by duplication.

A large segmental duplication of Rht-D1b identified in Aibian 1

The size of the duplication in the region around Rht-D1b was explored by assessing the hybridization signals in Southern blots probed with the genes located upstream and downstream of Rht-D1b based on comparative genomics between wheat and rice (Table S1, Fig. 4). Among the seven probes, four upstream and one downstream gene probes generated strong hybridization signal bands in Aibian 1, less strong hybridization signals in Aibai, and a weak signal in the single 85-cm variant of Aibai, which was the same as Rht-D1b (Fig. 4). No signal level changes were detected in the genes mapping to the upstream 49610-like and the downstream 50070-like genes, suggesting that the boundary of the duplicated region is between these two genes. The distance between LOC_Os03g49610 and LOC_Os03g50070 was c. 310 kb in rice chromosome 3. In order to assess the distance between the LOC_Os03g49610 and LOC_Os03g50070 like genes in wheat, the collinear genes (Table S1) were used to screen the Aibai BAC library for corresponding BAC clones. Nine BAC clones (4N5, 4D13, 1P9, 5P5, 11D10, 1J9, 8M1, 9B16, 1C14) in the duplicated region were obtained. Although a continuous BAC contig was not constructed, the order of the BACs along the genetic map was determined using the markers developed from these BACs (Fig. S2). Based on the marker order in the genetic map, this region showed good colinearity with the orthologous region in rice. This allowed us to anchor these BAC clones to the wheat genetic map and estimate the size of the duplication region.

image

Figure 4. Segment duplication size determined. The colourful parts showed the genes on the map of the Rht-D1b segment duplication, which was determined by the Southern blots and the collinearity between wheat (Triticum aestivum) and rice. 1, CS; 2, semi-dwarf plant of Aibai/15*CS; 3, Aibian 1; 4, dwarfing plant of Aibai/15*CS. DNAs from Aibian 1, dwarf Aibai/CS near-isogenic line (NIL), semi-dwarf Aibai/CS NIL and CS separately digested with HindIII and EcoRI, were produced using the 49610-like, 49710-like, 49730-like, 49900-like, 49940-like, 50030-like and 50070-like genes as probes. All four lines gave the same results as Fig. 3 except for the 49610-like and 50070-like genes (1st and 7th from the left, respectively).

Download figure to PowerPoint

The total size of the nine BACs is 1104 kb (Table S2), therefore, the duplicated region should be > 1 Mb considering the gaps that exist between the neighbouring BACs. Six markers developed from the BACs (1C14, 1J9, 4D13 and 4N5) were mapped on a 0.02 cM interval, a value much smaller than the 3 cM genetic distance as determined in the same region from the diploid Aegilops tauschii genome (Fig. S2). The results suggested that this region has been subjected to a tandem segmental duplication (TSD), an event that looks like causing severe repression of recombination in this region. Only a single semi-dwarf plant was observed in the Aibai/CS NIL segregation population of over 13 000 plants; the recombination ratio was < 0.00008. This suggested that the TSD formed a haplotype block, which harbours two copies of Rht-D1b separated by over 1 Mb distance, but segregates essentially as a single locus.

Detection of segmental duplication breakpoints

Based on the Southern blot results, the left boundary of the original segment was between the 49710-like and 49610-like genes in BAC 4D13 and 4N5. The right boundary of the original segment was flanked by the 50030-like and 50070-like genes in BAC 1C14. Possible breakpoint detection was performed by careful alignment of the two intervals. Seventy bp fragments: (AGACACGTCTCCGGTCAATAACCAATAGCGGAACCTG GATGCTCATATTGGCTCCCACATATTCTACGAA) from the Ty1-copia retrotransposon Angela occurred at 70 519–70 588 bp in 4N5 and 73 023–73 092 bp in 1C14. Based on the sequence identity, it is possible that sister chromatids underwent nonallelic homologous recombination. In addition, sequences CCCCCCTTTCCTCCCCCCTCTCCCC in BAC 4N5 (70 949–70 973 bp) and CCCCCCTGCCCCC in BAC 1C14 (72 570–72 582 bp) matched the CCNCCNTNNCCNC sequence associated with recombination hot-spots (Myers et al., 2008). Moreover, high levels of sequence similarities (96%) were present around the two motifs.

Expression of Rht-D1b in the segmental duplication in Aibian 1 and Aibai/CS NILs

Rht-D1b expression was measured in Aibian 1 and Aibai/CS NIL using quantitative real-time PCR to investigate the mechanism of Rht-D1c-mediated height control. Expression of Rht-D1b in Aibian 1 was c. 3-fold higher than in CS, 2-fold higher than in Aibai/CS with the heterozygous Rht-D1c locus, and 1.5-fold higher for the 85-cm plant from the Aibai/CS NIL (Fig. 5a). The higher gene expression level appeared to be correlated with the degree of height reduction (Fig. 5b). It is likely that the high expression of Rht-D1b in Aibain 1 is due to multiple Rht-D1b copies resulting from the segmental duplication.

image

Figure 5. Relationship between gene expression level and wheat (Triticum aestivum) plant height. (a) Gene expression level and (b) plant heights. 1, Aibian 1; 2, Aibai/15*CS; 3, semi-dwarf Aibai/15*CS; 4, CS. The error bars indicate +SD.

Download figure to PowerPoint

Transformation with the tandem duplication of Rht-D1b

The additive effect of two copies of the dwarfing gene on plant height was examined by transformation with two constructs, one with a single Rht-D1b under its own promoter (pRht-D1b :: Rht-D1b) and the other with a tandem Rht-D1b duplication with its own promoter(s) (pRht-D1b :: Rht-D1b :: pRht-D1b :: Rht-D1b). The constructs were transformed into wheat lines Bobwhite (without Rht-D1b) and CB037 (with Rht-D1b) using Agrobacterium tumefaciens strain C58C1; 125 and 107 T0 plants were obtained from Bobwhite and CB037, respectively. Fifteen (12%) and 24 (22%) plants carrying the transferred Rht-D1b were detected by PCR (Table 1).

Table 1.   Heights of T0 transgenic wheat (Triticum aestivum) plants
Transgenic plantsBobwhiteCB037
No. of plantsHeight, cmReduction, cm (%)No. of plantsHeight, cmReduction, cm (%)
  1. Values are means ± SD.

Construct with 2Rht-D1b736.9 ± 6.318.8 (33.5)1234.1 ± 5.817.4 (34)
Construct with Rht-D1b841.9 ± 2.113.8 (24.6)1241.1 ± 1.610.0 (19.3)
Control11155.6 ± 4.1 8351.5 ± 3.9 
Total125  107  

Forty-seven T1 plants of Bobwhite and 36 T1 plants of CB037 were generated from the T0 plants. Because CB037 already carried one Rht-D1b, there were four copies of Rht-D1b in plants with a single homozygous transgenic Rht-D1b. Transgene copy number was determined by Southern blot analysis on T1 lines of Bobwhite that exhibited reduced height. Each line possessed a single copy of the transgene (Fig. S3). The mean plant heights of T1 plants with the single homozygous transgenic Rht-D1b in the CB037 background was 42 cm, 24.5% shorter than counterparts without a transgenic Rht-D1b (55.9 cm) (Table 2).

Table 2.   Heights of T1 transgenic wheat (Triticum aestivum) lines
Transgenic plantsBobwhiteCB037
No. of plantsHeight, cmReduction, cm (%)No. of plantsHeight, cmReduction, cm (%)
  1. Values are means ± SD.

Hom. tandem dup. (4Rht-D1b)512.4 ± 1.743.7 (78)312.0 ± 2.043.9 (78.4)
Het. tandem dup. (2Rht-D1b)338.0 ± 5.818.1 (32)442.5 ± 1.313.4 (23.9)
Hom. single Rht-D1b (2)436.0 ± 5.720.1 (35.7)442.0 ± 2.213.9 (24.5)
Het. single Rht-D1b (1)643.3 ± 2.712.7 (22.6)547.6 ± 1.18.3 (14.8)
Control (0)2956.1 ± 6.0 2055.9 ± 4.7 
Total47  36  

The mean heights of transgenic plants with the homozygous tandem duplicated transgenic Rht-D1b was 12 cm in both Bobwhite and CB037 T1 lines (Fig. 6a), a reduction of up to 78%–this effect was about three times that of a single Rht-D1b and similar to that of Rht-D1c itself. The expression of Rht-D1b in the transgenic lines (Fig. 6b) was also consistent with the expression levels seen in Aibian 1, Aibai and the 85-cm NIL of Aibai (Fig. 5a). The results showed that the strongest effect of Rht-D1c on height reduction came from the tandem duplication of Rht-D1b.

image

Figure 6. Phenotypes and Rht-D1b expression levels in T1 transgenic wheat (Triticum aestivum) plants. (a) Phenotypes of T1 Bobwhite plants. (b) Expression of Rht-D1b in T1 plants compared to Bobwhite. 1, homozygous tandem duplicated transgenic Rht-D1b (4 copies); 2, heterozygous tandem duplicated transgenic Rht-D1b (2 copies); 3, heterozygous single transgenic Rht-D1b (1 copy); 4, Bobwhite (o copy). The error bars indicate +SD.

Download figure to PowerPoint

In addition to the functional validation experiment in wheat, we also introduced the two constructs into rice variety Zhonghua 11 by Agrobacterium tumefaciens strain GV3101 and obtained identical results (Fig. S4, Table S3). The heights of the transgenic rice plants declined with increased expression of Rht-D1b. The heights of lines with the tandem duplication were shorter than lines bearing nonduplicated Rht-D1bs (Fig. S4).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The biological significance of variation in copy number has received very little attention in plants although it is a common phenomenon in plant genomes. Rht-D1c (Rht10) carried by Chinese wheat line Aibian 1 is an allele at the Rht-D1 locus. This allele has the strongest effect of all dwarfing genes thus far described in wheat. We demonstrated that this strongest effect in reducing plant height resulted from Rht gene copy number variation. This Rht locus region has been subjected to a tandem segmental duplication (TSD) event in a region over 1 Mb in size.

Mechanism of the large size tandem segmental duplication involving Rht-D1b

Segmental duplication is an important evolutionary process that plays a key role in generating genetic novelty. Various genomic events can cause gene duplication, including unequal crossing over, illegitimate recombination, TE transposition and whole chromosome/genome duplication (Babushok et al., 2007; Semon & Wolfe, 2007; Kaessmann et al., 2009). The large segmental duplications described in this study could have resulted from unequal crossing over, because segmental duplications caused by TE transpositions are usually much shorter whereas chromosome/genome duplications usually create much longer duplicated segments (Jiang et al., 2004). In addition, we also found the putative boundaries of the original segment. Based on well-characterized recombination hotspots, motifs and high similarities (two Ty1-copia retrotransposons), we suggest that nonallelic homologous unequal crossover recombination led to the duplicated segment (Fig. S5) as proposed by Hastings et al. (2009) and Myers et al. (2008).

Our extensive sequence analyses suggest that in addition to the coding region, the regions of 5 kb upstream and 3 kb downstream of the duplicated Rht-D1b gene show no sequence polymorphism; this implies that the regulation of the duplicated Rht-D1b genes may also be the same, and that the duplication is a recent event because sequence divergence between the duplicated segments has not occurred.

Tandem duplication and its association with gene function

Rht-D1c is the strongest height-reducing locus in wheat. Pearce et al. (2011) and our results revealed that the extreme dwarfism of Rht-D1c is due to overexpression of the semi-dwarfing Rht-D1b allele, caused by an increase in gene copy number. Duplications of genomic content, including tandem and segmental duplications and whole genome duplications, have played major roles in the evolution of many eukaryotic species. For example, 16% and 14% of the genomes of Arabidopsis and rice were tandemly duplicated, respectively (Rizzon et al., 2006). Duplicate genes related to environmental stresses tended to be differentially expressed (Chen, 2007; Ha et al., 2009). FLOWERING LOCUS C loci display additive effects on flowering time (Michaels & Amasino, 1999), whereas heavy metal resistance in Arabidopsis halleri (Hanikenne et al., 2008), and boron tolerance in barley (Sutton et al., 2007), which are associated with tandemly duplicated genes, show nonadditive effects (gene activation).

Segmental duplication is common in the human genome and is often associated with human disease (Marques-Bonet & Eichler, 2009; She et al., 2004). However, events that influence important traits have been less frequently reported in animals (Kahn & Raphael, 2008; Liu et al., 2009; Quinlan et al., 2010) and plants (Xu et al., 2006; Sutton et al., 2007; Hanikenne et al., 2008; Xu & Messing, 2008; Flagel & Wendel, 2009; Jiang et al., 2009; Hayashi et al., 2010; Zhang et al., 2011). In this study, we discovered that Rht-D1c conferring an extreme dwarf phenotype resulted from a TSD of over 1 Mb carrying the Rht-D1b. The effect of the two copies of Rht-D1b in tandem was as strong as three single Rht-D1b, suggesting a synergistic effect on gene function. Rht-B1b and Rht-D1b both have nucleotide substitutions that create stop codons shortly after the translation start site, resulting in truncated proteins (Peng et al., 1999). Both have the ability to reduce plant height by 15–20% relative to near-isogenic backgrounds (Gale & Youssefian, 1985; Flintham et al., 1997; Blake et al., 2009; Miedaner & Voss, 2008). Rht-B1b plus Rht-D1b, as with two copies of either Rht-B1b or Rht-D1b, reduces height by c. 40% (Flintham et al., 1997). Our transformation results also showed that two separate copies of Rht-D1b reduce height by c. 40%. However, when present in a TSD they showed a much stronger effect (Figs 6, S4).

Understanding the genetics of TSD genes is important for elucidating the alternation of gene function. Our study revealed that recombination in the TSD region is very low. This may result from a hairpin structure produced during chromosome pairing in heterozygotes. Therefore, a TSD may behave like a haplotype block in heredity when the varieties with TSD cross with the varieties without the TSD. Because the effect of the tandemly duplicated Rht genes on height reduction was much stronger than that for two single copies, the effect of this duplication was easily identified. There were at least 19 collinear genes in the present TSD (Table S1), we only characterized the Rht-D1b function. This finding may provide an opportunity to identify the function of other remained genes.

The significance of tandem duplications in transgenic breeding

The discovery of enhanced function of tandemly duplicated genes relative to a single copy gene has potential value for plant breeding. Function is closely related to gene expression. In routine studies of transgenes, 35S or Ubiquitin are promoters of choice when overexpression of genes of interest is desired. This leads to intrinsic problems of constitutively high expression in all tissues/organs, a situation that may not be ideal for crop production. Tandem gene duplication driven by natural promoters could enhance gene expression levels at suitable times and in appropriate tissues. Therefore, this approach may have great potential for crop production and could be practiced for transgenic breeding.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank Robert McIntosh (University of Sydney, Australia), Mike Bevan (John Innes Centre, UK), Peter Langridge (University of Adelaide, Australia), Xiangdong Fu (Institute of Genetics and Developmental Biology, CAS, China) and Haichun Jing (Institute of Botany, CAS, China) for helpful comments; and Lingli Zheng, Lei Pan and Fu Li for their assistance in the work. The work was supported by grants from National Transgenic Research Project (2009ZX08009-110B) and National Basic Research Program of China (2010CB125902).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Babushok D, Ostertag E, Kazazian H. 2007. Current topics in genome evolution: molecular mechanisms of new gene formation. Cellular and Molecular Life Sciences 64: 542554.
  • Bailey JA, Gu Z, Clark RA, Reinert K, Samonte RV, Schwartz S, Adams MD, Myers EW, Li PW, Eichler EE. 2002. Recent segmental duplications in the human genome. Science 297: 10031007.
  • Blake NK, Lanning SP, Martin JM, Doyle M, Sherman JD, Naruoka Y, Talbertet LE. 2009. Effect of variation for major growth habit genes on maturity and yield in five spring wheat populations. Crop Science 49: 12111220.
  • Börner A, Mettin D. 1988. The genetic control of gibberellic acid insensitivity of the wheat variety Ai-Bian 1. In: Miller TE, Koebner RMD, eds. Proceedings of the 7th International Wheat Genetics Symposium, Cambridge, UK. Bath, UK: Bath Press, 489492.
  • Carroll SB. 2005. Evolution at two levels: on genes and form. PLoS Biology 3: e245.
  • Chao S, Sharp PJ, Worland AJ, Warham EJ, Koebner RMD, Gale MD. 1989. RFLP-based genetic maps of wheat homoeologous group 7 chromosomes. Theoretical and Applied Genetics 78: 495504.
  • Chen ZJ. 2007. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annual Review of Plant Biology 58: 377406.
  • Deng J, Gao Z. 1982. Discovery and determination of a dominant male sterile gene and its importance in genetics and wheat breeding. Scientia Sinica - Series B 5: 508520.
  • Deng J, Gao Z. 1987. Determination of a dominant male sterile gene and its prospect in practice. In: Jingyang D, ed.Taigu genic male sterile wheat. Beijing, China: Science Press, 39.
  • Dill A, Thomas SG, Hu J, Steber CM, Sun TP. 2004. The Arabidopsis F-box protein SLEEPY1 targets gibberellin signaling repressors for gibberellin-induced degradation. Plant Cell 16: 13921405.
  • Flagel LE, Wendel JF. 2009. Gene duplication and evolutionary novelty in plants. New Phytologist 183: 557564.
  • Fleck B, Harberd NP. 2002. Evidence that the Arabidopsis nuclear gibberellin signalling protein GAI is not destabilised by gibberellin. Plant Journal 32: 935947.
  • Flintham JE, Börner A, Worland AJ, Gale MD. 1997. Optimizing wheat grain yield effects of Rht (gibberellin-insensitive) dwarfing genes. Journal of Agricultural Science 128: 1125.
  • Fu X, Sudhakar D, Peng J, Richards DE, Christou P, Harberd NP. 2001. Expression of Arabidopsis GAI in transgenic rice represses multiple gibberellin responses. Plant Cell 13: 17911802.
  • Gale MD, Youssefian S. 1985. Dwarfing genes in wheat. In: Russell GE, ed. Progress in plant breeding. Cambridge, UK: Butterworth & Co, 135.
  • Ha M, Kim ED, Chen ZJ. 2009. Duplicate genes increase expression diversity in closely related species and allopolyploids. Proceedings of the National Academy of Sciences, USA 106: 22952300.
  • Hanikenne M, Talke IN, Haydon MJ, Lanz C, Nolte A, Motte P, Kroymann J, Weigel D, Krämer U. 2008. Evolution of metal hyper accumulation required cis-regulatory changes and triplication of HMA4. Nature 453: 391395.
  • Hastings PJ, Lupski JR, Rosenberg SM, Ira G. 2009. Mechanisms of change in gene copy number. Nature Reviews Genetics 10: 551564.
  • Hayashi N, Inoue H, Kato T, Funao T, Shirota M, Shimizu T, Kanamori H, Yamane H, Hayano-Saito Y, Matsumoto T et al. 2010. Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local genome duplication. Plant Journal 64: 498510.
  • Isidore E, Scherrer B, Bellec A, Budin K, Faivre-Rampant P, Waugh R, Keller B, Caboche M, Feuillet C, Chalhoub B. 2005. Direct targeting and rapid isolation of BAC clones spanning a defined chromosome region. Functional & Integrative Genomics 5: 97103.
  • Itoh H, Sasaki A, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Hasegawa Y, Minami E, Ashikari M, Matsuoka M. 2005. Dissection of the phosphorylation of rice DELLA protein, SLENDER RICE1. Plant and Cell Physiology 46: 13921399.
  • Itoh H, Ueguchi-Tanaka M, Sato Y, Ashikari M, Matsuoka M. 2002. The gibberellin signaling pathway is regulated by the appearance and disappearance of SLENDER RICE1 in nuclei. Plant Cell 14: 5770.
  • Izumi N, Sawada S, Sasakuma T. 1981. A dominant gene of dwarfism located on chromosome 4D in Triticum aestivum cv. ‘Ai-bian 1’. Wheat Information Service 53: 2124.
  • Izumi N, Sawada S, Sasakuma T. 1983. Genetic analysis of dwarfness in Triticum aestivum L. cv. ‘Ai-bian 1’. Seiken Ziho 31: 3848.
  • Jiang N, Bao Z, Zhang X, Eddy SR, Wessler SR. 2004. Pack-MULE transposable elements mediate gene evolution in plants. Nature 431: 569573.
  • Jiang SY, Christoffels A, Ramamoorthy R, Ramachandran S. 2009. Expansion mechanisms and functional annotations of hypothetical genes in the rice genome. Plant Physiology 150: 19972008.
  • Kaessmann H, Vinckenbosch N, Long M. 2009. RNA-based gene duplication: mechanistic and evolutionary insights. Nature Reviews Genetics 10: 1931.
  • Kahn CL, Raphael BJ. 2008. Analysis of segmental duplications via duplication distance. Bioinformatics 24: 133138.
  • Kong XY, Gu YQ, You FM, Dubcovsky J, Anderson OD. 2004. Dynamics of the evolution of orthologous and paralogous portions of a complex locus region in two genomes of allopolyploid wheat. Plant Molecular Biology 54: 5569.
  • Liu BH. 1987. Isolation of a spontaneous chromosome translocation in common wheat. Plant Breeding 98: 266267.
  • Liu BH. 2001. Theory and methodology of crop improvement. Beijing, China: China Agricultural Scientech Press.
  • Liu BH, Deng JY. 1986. A dominant gene for male sterility in wheat. Plant Breeding 97: 204209.
  • Liu GE, Ventura M, Cellamare A, Chen L, Cheng Z, Zhu B, Li C, Song J, Eichler EE. 2009. Analysis of recent segmental duplications in the bovine genome. BMC Genomics 10: 571.
  • Liu C, Wang J, Huang T, Wang F, Yuan F, Cheng X, Zhang Y, Shi S, Wu J, Liu K. 2010. A missense mutation in the VHYNP motif of a DELLA protein causes a semi-dwarf mutant phenotype in Brassica napus. Theoretical and Applied Genetics 121: 249258.
  • Lynch M. 2002. Genomics. Gene duplication and evolution. Science 297: 945947.
  • Ma Z, Weining S, Sharp PJ, Liu C. 2000. Non-gridded library: a new approach for BAC (bacterial artificial chromosome) exploitation in hexaploid wheat (Triticum aestivum). Nucleic Acids Research 28: e106.
  • Marques-Bonet T, Eichler EE. 2009. The evolution of human segmental duplications and the core duplicon hypothesis. Cold Spring Harbor Symposia On Quantitative Biology 74: 355362.
  • Michaels SD, Amasino RM. 1999. FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949956.
  • Miedaner T, Voss HH. 2008. Effect of dwarfing Rht genes on fusarium head blight resistance in two sets of near-isogenic lines of wheat and check cultivars. Crop Science 48: 21152122.
  • Myers S, Freeman C, Auton A, Donnelly P, McVean G. 2008. A common sequence motif associated with recombination hot spots and genome instability in humans. Nature Genetics 40: 11241129.
  • Ohno S. 1970. Evolution by gene duplication. New York, NY: Springer-Verlag.
  • Pal C, Papp B, Lercher MJ. 2006. An integrated view of protein evolution. Nature Reviews Genetics 7: 337348.
  • Pearce S, Saville R, Vaughan SP, Chandler PM, Wilhelm EP, Sparks CA, Al-Kaff N, Korolev A, Boulton MI, Phillips AL et al. 2011. Molecular characterization of rht-1 dwarfing genes in hexaploid wheat. Plant Physiology 157: 18201831.
  • Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, Beales J, Fish LJ, Worland AJ, Pelica F et al. 1999. ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature 400: 256261.
  • Quinlan AR, Clark RA, Sokolova S, Leibowitz ML, Zhang Y, Hurles ME, Mell JC, Hall IM. 2010. Genome-wide mapping and assembly of structural variant breakpoints in the mouse genome. Genome Research 20: 623635.
  • Rizzon C, Ponger L, Gaut BS. 2006. Striking similarities in the genomic distribution of tandemly arrayed genes in Arabidopsis and rice. PLoS Computational Biology 2: e115.
  • Semon M, Wolfe KH. 2007. Consequences of genome duplication. Current Opinion Genetics Development 17: 505512.
  • She X, Jiang Z, Clark RA, Liu G, Cheng Z, Tuzun E, Church DM, Sutton G, Halpern AL, Eichler EE. 2004. Shotgun sequence assembly and recent segmental duplications within the human genome. Nature 431: 927930.
  • Sutton T, Baumann U, Hayes J, Collins NC, Shi BJ, Schnurbusch T, Hay A, Mayo G, Pallotta M, Tester M et al. 2007. Boron-toxicity tolerance in barley arising from efflux transporter amplification. Science 318: 14461449.
  • Taylor JS, Raes J. 2004. Duplication and divergence: the evolution of new genes and old ideas. Annual Reviews of Genetics 38: 615643.
  • Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, Bailey-Serres J, Ronald PC, Mackill DJ. 2006. Sub1A is an ethylene-response-factor-like gene that confers submergence tolerance to rice. Nature 442: 705708.
  • Xu JH, Messing J. 2008. Diverged copies of the seed regulatory Opaque-2 gene by a segmental duplication in the progenitor genome of rice, sorghum, and maize. Molecular Plant 1: 760769.
  • Zhang H, Zhao X, Ding X, Paterson AH, Wing RA. 1995. Preparation of megabase-size DNA from plant nuclei. Plant Journal 7: 175184.
  • Zhang X, Feng Y, Cheng H, Tian D, Yang S, Chen JQ. 2011. Relative evolutionary rates of NBS-encoding genes revealed by soybean segmental duplication. Molecular Genetics & Genomics 285: 7990.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

Fig. S1 Detection of the copy number of Rht-D1b in Aibian 1 and Aibai/CS NILs by TaqMan PCR

Fig. S2 The genetic and physical maps of Rht-D1c locus, and its micro-collinearity between wheat and rice.

Fig. S3 Southern blot to detect the copy number of transgenic Rht-D1b in transgenic Bobwhite plants following by HindⅢ and EcoRV digestion.

Fig. S4 Phenotypes and Rht-D1b expression levels in T1 transgenic rice plants.

Fig. S5 Mechanism of the greater than 1 Mb tandem segmental duplication involving Rht-D1b.

Table S1 Collinear genes between rice and wheat in the greater than 1 Mb segment

Table S2 BAC insert sizes

Table S3 Heights of T1 transgenic rice lines

FilenameFormatSizeDescription
nph4243_sm_FigS1-S5-TableS1-S3.doc3775KSupporting info item